ID: 1147702500

View in Genome Browser
Species Human (GRCh38)
Location 17:42404738-42404760
Sequence CTCCAGCAGCGCGTGCACGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 43}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147702498_1147702500 -7 Left 1147702498 17:42404722-42404744 CCGACTCCTCGGTGATCTCCAGC 0: 1
1: 0
2: 0
3: 11
4: 139
Right 1147702500 17:42404738-42404760 CTCCAGCAGCGCGTGCACGTCGG 0: 1
1: 0
2: 0
3: 7
4: 43
1147702496_1147702500 5 Left 1147702496 17:42404710-42404732 CCAGCACGGCGTCCGACTCCTCG 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1147702500 17:42404738-42404760 CTCCAGCAGCGCGTGCACGTCGG 0: 1
1: 0
2: 0
3: 7
4: 43
1147702495_1147702500 8 Left 1147702495 17:42404707-42404729 CCACCAGCACGGCGTCCGACTCC 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1147702500 17:42404738-42404760 CTCCAGCAGCGCGTGCACGTCGG 0: 1
1: 0
2: 0
3: 7
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147702500 Original CRISPR CTCCAGCAGCGCGTGCACGT CGG Exonic
900669131 1:3838991-3839013 CTCCAGCTGCTCGTACACCTCGG + Exonic
903577635 1:24348589-24348611 CTCCAGCAGCGCTTCCAAGCTGG + Intronic
907470549 1:54670877-54670899 CTCCTGCATCGCCTGCACGGAGG - Exonic
1067771787 10:49131802-49131824 CTCCAGCAGAGCGTCCAGGGAGG + Exonic
1072656491 10:97334016-97334038 CTCCAGCAGCTCGTGCTCTCGGG - Exonic
1073029424 10:100513560-100513582 CACCAGAATCGCTTGCACGTGGG - Intronic
1076333761 10:129691429-129691451 CTGAAGCAGCGTGTGCACCTGGG + Intronic
1086953765 11:92915634-92915656 GGCCAGCAGCGCGAGCTCGTGGG - Intergenic
1091224992 11:133951733-133951755 CTGCAGGGGCGCGTGCACCTGGG - Intronic
1091447272 12:551218-551240 GTCCAGCAGAGCCTGCACGTGGG + Intronic
1098123830 12:67269680-67269702 CTCCAGCAGCGCCAGCAGGCGGG + Exonic
1102535372 12:113576887-113576909 CCCCAGGAGCGGGAGCACGTTGG - Intergenic
1122700122 14:103582464-103582486 CTCCAGCCCCGCGTGCTGGTGGG - Intronic
1123476802 15:20596666-20596688 CTCCAGCAGCTTCTGCACGTTGG + Intergenic
1123641209 15:22403698-22403720 CTCCAGCAGCTTCTGCACGTTGG - Intergenic
1132893110 16:2214268-2214290 CACCACCACCGCGCGCACGTCGG + Exonic
1135420490 16:22302709-22302731 CTCAAGCAGCGGGTGCAAGCGGG - Intronic
1136548977 16:30971702-30971724 CTCCAGCAAGGCCTGCAGGTAGG + Exonic
1137231275 16:46569698-46569720 CTCCAGCAGCGCGGGCCCCGGGG - Intergenic
1139682560 16:68576457-68576479 CTCCAGCAGGCCGGGCACGGTGG + Intergenic
1142110581 16:88328982-88329004 CTCCGGCTGCGGGTGAACGTCGG - Intergenic
1142863370 17:2776679-2776701 CTCCGGCTGCGCGTGCGCGGCGG + Intergenic
1147195579 17:38764342-38764364 CTCCATCAGTGCGTGCCAGTGGG + Intergenic
1147702500 17:42404738-42404760 CTCCAGCAGCGCGTGCACGTCGG + Exonic
1160806446 19:994204-994226 CTCCCGCAGAGCGTGCTCGGCGG + Exonic
1161102357 19:2427414-2427436 CTGCAGCAGCTCCTGCGCGTTGG + Exonic
1161170125 19:2808359-2808381 CTGCAGCAGCGAGGGCGCGTCGG - Exonic
1161483741 19:4523831-4523853 CTCCAGCAGCTCGTCCACGCAGG + Exonic
1162481464 19:10929164-10929186 CTCCAGCAGCGCCTCCTCGAAGG - Exonic
1166660959 19:44647139-44647161 CTCCAGGAGCCCGGGCACCTGGG - Intronic
1168109384 19:54183561-54183583 CTCCATCAGGGAGGGCACGTCGG + Exonic
1173729189 20:45316883-45316905 CTCCAGGAGCGCGTCGGCGTCGG - Exonic
1180979460 22:19871877-19871899 CTCTAGCAGGGCCTGGACGTGGG - Intergenic
1182598349 22:31440012-31440034 CTCCAGCTGGGAGTGCATGTGGG + Exonic
968803134 4:2756083-2756105 CTCCAGCAGCGCGTCCACTAGGG + Exonic
968964991 4:3765367-3765389 CTCCAGCAGCGCTGGGAAGTGGG + Intergenic
969350327 4:6594574-6594596 GTCCAGCAGCGGGTCCATGTTGG - Exonic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
977044823 4:92056006-92056028 CTCAAGCAGCCCGTCCACCTTGG - Intergenic
986290665 5:6396725-6396747 CTCCAGCAGCGGGAGCAGGGAGG + Intergenic
1006844757 6:37054575-37054597 CTCCAGTGGCTCGTTCACGTGGG + Intergenic
1017800420 6:157890675-157890697 CTCCTGCTGCCCGTGAACGTGGG - Intronic
1034219369 7:149432209-149432231 ATCCATCAGCGCGTGCACGCGGG - Exonic
1038213112 8:25538438-25538460 CTGCAGCAGCGCGTGCAAAAAGG - Intergenic
1040819870 8:51544280-51544302 CTCCAGCAGATGGTGCAGGTAGG + Intronic
1043871402 8:85438040-85438062 CTCCAGCTCCGCGTGAACCTGGG + Intronic
1054891798 9:70259324-70259346 CTCCGGCAGCGCGCGGGCGTGGG + Intronic
1060405568 9:123371363-123371385 CTGGGGCAGCACGTGCACGTGGG + Exonic
1062340999 9:136094051-136094073 CTCCGGGAGCGCGTGCACCTTGG - Intronic
1189418183 X:40832925-40832947 CTCCAGCAGCGCATCCACCAGGG + Intergenic
1198388005 X:136147259-136147281 CTCCAGTGGCGGGGGCACGTGGG + Intergenic