ID: 1147703030

View in Genome Browser
Species Human (GRCh38)
Location 17:42407784-42407806
Sequence AGTGAATGATAAGAGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 397}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147703030_1147703036 15 Left 1147703030 17:42407784-42407806 CCCTCTGCCTCTTATCATTCACT 0: 1
1: 1
2: 3
3: 29
4: 397
Right 1147703036 17:42407822-42407844 GTTTTCCTTGTTCTGAGTGTAGG 0: 1
1: 0
2: 3
3: 26
4: 294
1147703030_1147703034 -10 Left 1147703030 17:42407784-42407806 CCCTCTGCCTCTTATCATTCACT 0: 1
1: 1
2: 3
3: 29
4: 397
Right 1147703034 17:42407797-42407819 ATCATTCACTGAGGCATTGAAGG 0: 1
1: 1
2: 0
3: 11
4: 144
1147703030_1147703035 -9 Left 1147703030 17:42407784-42407806 CCCTCTGCCTCTTATCATTCACT 0: 1
1: 1
2: 3
3: 29
4: 397
Right 1147703035 17:42407798-42407820 TCATTCACTGAGGCATTGAAGGG 0: 1
1: 0
2: 2
3: 9
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147703030 Original CRISPR AGTGAATGATAAGAGGCAGA GGG (reversed) Intronic
900810792 1:4800104-4800126 ACTAAATGACAAGAGGCTGATGG + Intergenic
901123265 1:6911978-6912000 AGGGAAAGATAAGAGAAAGAAGG - Intronic
902743376 1:18456165-18456187 AGTGACTGCTAATAGGCACAAGG - Intergenic
903434789 1:23339834-23339856 TGTTATTGATAAGAGGCTGATGG - Intronic
904864874 1:33570531-33570553 AGTGATTGTAAAGAGGTAGAAGG - Intronic
905014034 1:34764892-34764914 AATGAATGAGGAGAGGTAGATGG - Intronic
905071189 1:35226758-35226780 GGAGAATGAAAAGAGGAAGAGGG - Intergenic
905542722 1:38772905-38772927 AGTGAATGAGAATGGACAGAAGG + Intergenic
905691912 1:39949555-39949577 AGAGAATGAGAAAAGGCAAAAGG - Intergenic
906068779 1:43002314-43002336 TGTGAATGAGCAGAGGAAGAAGG - Intergenic
907842783 1:58173029-58173051 GGTGAAGGAGAAAAGGCAGAAGG + Intronic
908659390 1:66420985-66421007 GGTGAAGGAGAAAAGGCAGAAGG - Intergenic
908677244 1:66619194-66619216 AGTGAGGGATGAGAGGCAGGAGG + Intronic
909078353 1:71080498-71080520 GGTGAACTATAAGAGGCAAAAGG + Intronic
909359242 1:74742598-74742620 GGTGAAGGAGAAAAGGCAGAAGG - Intronic
909377523 1:74957158-74957180 AGTGAAGGATAAAGGGGAGAGGG - Intergenic
910299403 1:85688902-85688924 ACTGAATGTTCAGAGGTAGATGG - Intronic
911422651 1:97663398-97663420 AGTGAAGGACAGGAGTCAGAAGG - Intronic
912158383 1:106950403-106950425 AGTGCATGATTAAATGCAGAGGG - Intergenic
913383031 1:118230934-118230956 GGTGAAGGAGAAAAGGCAGAAGG + Intergenic
913554976 1:119956686-119956708 AGTGAAGGATAACAGGAAAAAGG + Intronic
916015528 1:160746480-160746502 ACTTTATGTTAAGAGGCAGAAGG + Intronic
916517838 1:165536531-165536553 AGTAAATGTCAAGAGACAGATGG - Intergenic
917086537 1:171310227-171310249 GGTGAAGGAGAAAAGGCAGAAGG + Intergenic
917326964 1:173843150-173843172 AGTTAATGATATGTGGCATATGG + Intronic
917703522 1:177605667-177605689 AGTGACTGAAAAGAGGCACCAGG + Intergenic
918975515 1:191480141-191480163 AGTGAAAGATATGATGCAAATGG + Intergenic
919227703 1:194728908-194728930 AGTGAATATTAAGATGTAGAAGG + Intergenic
919543307 1:198878685-198878707 AGTGAGTGAAAAGAAGAAGATGG - Intergenic
920615098 1:207483941-207483963 AGTGAAGGAAGAGAGGCAGGGGG + Intronic
921160208 1:212467041-212467063 AGTGATGGAAAAGAAGCAGATGG + Intergenic
921622582 1:217342356-217342378 AGTCAATGCAAAGAGGCAGGTGG - Intergenic
922130245 1:222770684-222770706 TGTGAAAGATAAGGGGCATAGGG + Intergenic
922560701 1:226567481-226567503 ATTTAATGAGAAGAGGTAGATGG + Intronic
922794984 1:228335426-228335448 AGAGAATGAAAAGAGGAAGGAGG - Intronic
922901616 1:229141520-229141542 AATCAATGATGGGAGGCAGAAGG - Intergenic
923215345 1:231843652-231843674 AGTGGATGCTTAGAGGCAGGAGG + Intronic
924370181 1:243339145-243339167 AGGGAATGATGGGTGGCAGAGGG + Intronic
924699607 1:246438402-246438424 GGTGAATGATAAGAGACAAGTGG + Intronic
1063047697 10:2410366-2410388 AGTGTCTGATAACAGGCAGCAGG + Intergenic
1063565382 10:7168931-7168953 AAAGAATGATTGGAGGCAGAGGG - Intronic
1064290303 10:14027923-14027945 AGTGAATGATATGAGCCACTTGG + Intronic
1064531676 10:16316791-16316813 ATTAAATGATAATAAGCAGAAGG + Intergenic
1064826104 10:19402896-19402918 AGTAAGTGACAAGACGCAGAAGG - Intronic
1065486790 10:26243486-26243508 AGTTAATAGTAAGAGGCTGATGG + Intronic
1065548947 10:26851160-26851182 AGTGAATGAAAAGTGGGAGATGG + Intronic
1067935388 10:50607500-50607522 AGTGAAAGCTAAGATGCAGATGG + Intronic
1069862581 10:71480854-71480876 AAGGAATGATATGAGGGAGATGG + Intronic
1070567639 10:77615687-77615709 CGTGGGTGATGAGAGGCAGAGGG + Intronic
1072371221 10:94767977-94767999 GGTGAAGGAGAAAAGGCAGAAGG - Intronic
1073622377 10:105062617-105062639 ACAGAAGGGTAAGAGGCAGAAGG + Intronic
1074298603 10:112213170-112213192 AATGAATGATAGCAGGCTGATGG - Intronic
1074723671 10:116285733-116285755 TATGAATTCTAAGAGGCAGATGG + Intergenic
1075245574 10:120819095-120819117 AGTGACTGCTAAGAGGTAGAGGG + Intergenic
1075285716 10:121184181-121184203 TGAGAATGAGAAGAGGCACAGGG - Intergenic
1076234701 10:128854410-128854432 AGAAAATGCTAAAAGGCAGAGGG - Intergenic
1078711786 11:13799492-13799514 AGTGAAAGATAAGAGGCCAGTGG + Intergenic
1079290346 11:19182748-19182770 TGTGAATGAGAAGAGGATGAAGG + Intronic
1079943918 11:26717390-26717412 AGTGTATGATAAGAGAAGGAAGG + Intronic
1081678410 11:44984808-44984830 AGAGGATGGTAAGAGGCGGAGGG + Intergenic
1081819399 11:45977048-45977070 GGTGAATGGTAAGAGGCCCAGGG - Intronic
1081938275 11:46919157-46919179 AGTGAATGAAAAGGGGCGGGGGG - Intergenic
1082171071 11:49006376-49006398 AAGGAATGGTAAAAGGCAGAGGG - Intergenic
1085433063 11:76473223-76473245 AGTAAATGATAAGAGGTAGGAGG + Intronic
1086053986 11:82626732-82626754 GGTGAAGGAGAAAAGGCAGAAGG + Intergenic
1087409323 11:97770763-97770785 AGTGAAAGAGAAAAGCCAGAGGG + Intergenic
1087607944 11:100399866-100399888 AATGAATGGTAAAAGGCAAATGG + Intergenic
1088154067 11:106782857-106782879 AGTGAAGGATAAAAAGTAGAGGG - Intronic
1088492975 11:110404771-110404793 AGTGAAGGACAAAAGGCAGAAGG + Intergenic
1088805094 11:113345263-113345285 AGTGAATGAAAAAACTCAGAAGG - Intronic
1090462188 11:126901481-126901503 AGAGAATGTGAAGAGTCAGAGGG + Intronic
1091955315 12:4636413-4636435 AATGAATGATAAGGTTCAGAGGG + Intronic
1094078772 12:26509253-26509275 AGTGACTGCTAAGAGGCATGGGG + Intronic
1095557151 12:43521569-43521591 TTTGAATGATAAGAGGCCGAAGG - Intronic
1096758194 12:53817406-53817428 TGTGGGTGAGAAGAGGCAGAGGG + Intergenic
1096815438 12:54198947-54198969 AATGAATGACAAGGGGCAGTGGG - Intergenic
1099376681 12:81901818-81901840 AGTAAAGGAGAAAAGGCAGAAGG + Intergenic
1099599006 12:84707664-84707686 ATTGAATGATAAGTTGCATATGG + Intergenic
1100112174 12:91259181-91259203 TGTGAATGATAAAGGGTAGATGG + Intergenic
1100787061 12:98089845-98089867 AGGGAAGGATAAAAGGAAGAAGG + Intergenic
1100818779 12:98411684-98411706 AGTGAAGAATAAGAGGCAGAGGG - Intergenic
1101219118 12:102618304-102618326 AGGCAAGGATAAAAGGCAGATGG - Intergenic
1102009326 12:109608274-109608296 AGTGAGGGAGAAGATGCAGACGG - Intergenic
1102545614 12:113652941-113652963 TGTAAATGAAGAGAGGCAGAAGG + Intergenic
1103959990 12:124603429-124603451 ACAGAAGGGTAAGAGGCAGACGG - Intergenic
1104269459 12:127269563-127269585 AGTGAATGAAAAGGGGTACAAGG + Intergenic
1107011687 13:35676755-35676777 AGTGACTGGTAAGGGCCAGAGGG + Intergenic
1107884663 13:44865480-44865502 AGTGAATGATTAGAGTAATATGG + Intergenic
1107914903 13:45139611-45139633 AGTGAATAATAAGAGGGTAAGGG - Intronic
1110145027 13:72179980-72180002 TGTGACTGATAATAGGCAAAAGG - Intergenic
1110589774 13:77242766-77242788 AGTTATTGATAGTAGGCAGATGG + Intronic
1110592010 13:77274415-77274437 AGTGAATAATCAGATGGAGAGGG + Intronic
1111676625 13:91396474-91396496 AGTTATGGATAAGAGGTAGAAGG + Intergenic
1111974634 13:94952668-94952690 AGTGAATCATGAGAGTCAGTAGG - Intergenic
1112142805 13:96664578-96664600 AGTGAGTGAGAGGAGGAAGATGG - Intronic
1112387446 13:98952970-98952992 ATTGTATTATTAGAGGCAGAGGG - Intronic
1113207810 13:107938036-107938058 AGTGACTCATAATAGTCAGATGG - Intergenic
1113551047 13:111193377-111193399 AGTGAAGGAGAAAAGGCAGAAGG - Intronic
1114490608 14:23099331-23099353 GGTGAATGGTAAGAGGCAGATGG + Exonic
1115052775 14:29084710-29084732 AGTGACTGATAATAGTAAGAGGG + Intergenic
1116697795 14:48199866-48199888 GGTGAAGGAGAAAAGGCAGAAGG + Intergenic
1116760810 14:49011262-49011284 ATTCAATGATAAAAGGCAAAAGG - Intergenic
1118038366 14:61892327-61892349 TGTGAAGGAGAGGAGGCAGACGG - Intergenic
1118593873 14:67421169-67421191 AGAGAATGAAAACAGGCACAGGG + Intergenic
1120464971 14:84844883-84844905 AGTGAATCATCAGAGGCAAAAGG - Intergenic
1121066540 14:90972322-90972344 AATGAAAGATCAGGGGCAGAGGG + Intronic
1121417906 14:93791553-93791575 AGTGAAGGACAAGAGGTGGAAGG + Intergenic
1122388202 14:101363029-101363051 TGGGGATGGTAAGAGGCAGAGGG - Intergenic
1122451099 14:101808209-101808231 AGTGAAGGCTTAGAGGCAGGAGG + Intronic
1123775471 15:23575051-23575073 AGTACATGATAAGAGCCACATGG + Intronic
1124830877 15:33148277-33148299 AGTAGATTATAAGAGGCTGAAGG - Intronic
1125340704 15:38672689-38672711 AGTGAATGTCAATAGGCAGCAGG + Intergenic
1125930904 15:43599454-43599476 AGGAAATGAAAAGAGGCAGTGGG + Exonic
1125944068 15:43699270-43699292 AGGAAATGAAAAGAGGCAGTGGG + Intergenic
1126070978 15:44864498-44864520 GGTGAAGGAGAAAAGGCAGAAGG - Intergenic
1126453160 15:48832627-48832649 AGTGAAGGAGAAGAAGAAGAGGG - Intronic
1127315533 15:57790972-57790994 ATTGAATGAGAAAAGCCAGAGGG - Intergenic
1127604463 15:60572407-60572429 AGTGAACCATAAGAAACAGAGGG + Intronic
1128193224 15:65724839-65724861 AGTGAATGGTAAGACACAGTGGG - Intronic
1128397268 15:67240909-67240931 AATGAAAGAAAAGAGGCAGCTGG + Intronic
1128973187 15:72127213-72127235 AGGGAAAGAGAAGAGGCAGGGGG + Intronic
1129646118 15:77435153-77435175 AGTGAATGGGAAGGGGCATAAGG + Intronic
1130066103 15:80606264-80606286 TGTGGATGAAAATAGGCAGAGGG - Intergenic
1130850596 15:87789984-87790006 AGGGAATGATCAGAGAAAGAAGG + Intergenic
1130882811 15:88069739-88069761 AGAGAATGAGAAGAGGCAGATGG - Intronic
1131696035 15:94878857-94878879 AGGGAAAGACAAGAGACAGAAGG - Intergenic
1132767342 16:1541236-1541258 AGTGAAAGATTTGTGGCAGATGG + Intronic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1135772182 16:25225941-25225963 AGTGAATGAGAAAATGCAAATGG - Intronic
1138217166 16:55214512-55214534 AGGGAAAGAGAAGAGGGAGAAGG + Intergenic
1138494220 16:57397543-57397565 GGTGAAGGAGAAAAGGCAGAAGG - Intergenic
1141216163 16:82025808-82025830 AGTGGCTGACAAGAGGCAGAAGG + Intergenic
1141217760 16:82041198-82041220 AGAGACTGAGAAGAGGCACATGG - Intronic
1143433214 17:6902245-6902267 AGGGAAAAAGAAGAGGCAGAGGG + Intronic
1144333373 17:14245690-14245712 AGTGAATGATAAAGGATAGAAGG - Intergenic
1144492984 17:15731040-15731062 AGTCAATGAGGAGAGGAAGATGG - Intergenic
1144785088 17:17827067-17827089 ACTGAATGATATGAGGGAGTGGG + Intronic
1144874108 17:18388228-18388250 AGTCAATGAGGAGAGGAAGATGG - Exonic
1144907268 17:18645613-18645635 AGTCAATGAGGAGAGGAAGATGG + Intronic
1145158116 17:20556188-20556210 AGTCAATGAGGAGAGGAAGACGG + Intergenic
1146310938 17:31767861-31767883 GGTGAAGGACAAAAGGCAGAAGG + Intergenic
1146504876 17:33396015-33396037 AGTGAAAGACAAGAGTCTGACGG - Intronic
1146628593 17:34454075-34454097 AATGAAGGTTCAGAGGCAGAGGG - Intergenic
1147703030 17:42407784-42407806 AGTGAATGATAAGAGGCAGAGGG - Intronic
1149816997 17:59735348-59735370 AGTGAATGAAAAGAAGAGGAGGG + Exonic
1150068132 17:62128739-62128761 AGTGACTGTAAAGAGGCACAAGG + Intergenic
1150727935 17:67666651-67666673 AGAGATTGAGAAGAGGCAGGAGG + Intronic
1155280523 18:24235011-24235033 AGTGAGTGTGAAGAGGCAGTAGG + Intronic
1155364250 18:25034437-25034459 AGTGATTTAAAAAAGGCAGAGGG + Intergenic
1155475688 18:26234263-26234285 GGTGAAGGAGAAAAGGCAGAAGG - Intronic
1155874422 18:31068082-31068104 AGTGAACGACAAGAAGAAGATGG - Exonic
1155931911 18:31717358-31717380 ATTGACTGAAAAGAGGCACAAGG + Intergenic
1155935696 18:31751391-31751413 AGTGAAGGGTAAGAGGAAAAGGG - Intergenic
1156423096 18:36977714-36977736 AGTGATTGACAAGACTCAGAAGG + Intronic
1156561309 18:38128825-38128847 AGGAAATGATAGGAGGCAGCTGG - Intergenic
1157327928 18:46682222-46682244 AGTGCCTGATAAGGAGCAGAAGG - Intronic
1157928260 18:51790128-51790150 ATTGAAACATGAGAGGCAGAAGG - Intergenic
1157942782 18:51947133-51947155 AGTTAATGACATAAGGCAGAGGG - Intergenic
1158130568 18:54148427-54148449 AGTGAAAGACATGAGGCAGAAGG + Intergenic
1158273132 18:55738121-55738143 AGGGAAAGATAGGAAGCAGAAGG - Intergenic
1158389164 18:57029875-57029897 AATGAATGATTAGAAGCAGCAGG - Exonic
1158861091 18:61593066-61593088 AGTGACTGAATAGGGGCAGAAGG - Intergenic
1158923598 18:62225390-62225412 AGTGAATGAGAAGACCGAGAGGG + Intronic
1159122538 18:64187354-64187376 AGGGAATAGAAAGAGGCAGAAGG + Intergenic
1162237003 19:9317306-9317328 GGTGAAGGAGAAAAGGCAGAAGG - Intergenic
1166441332 19:42817922-42817944 AATAAATGAAAAGAGGGAGAAGG - Intronic
1166449514 19:42886234-42886256 AATAAATGAAAAGAGGGAGAAGG - Intronic
1166460812 19:42986527-42986549 AATAAATGAAAAGAGGGAGAAGG - Intronic
1166478107 19:43146517-43146539 AATAAATGAAAAGAGGGAGAAGG - Intronic
1168504281 19:56920120-56920142 AGTGAATGAGAAGACCCAGGAGG - Intergenic
925572737 2:5329234-5329256 AATGAATGGTCAGAGGCAAATGG + Intergenic
927620703 2:24654855-24654877 AGAGAATGATAAATGGAAGAAGG - Intronic
927699089 2:25256675-25256697 AGGGAAAGATAAGGGACAGAAGG - Intronic
927699093 2:25256695-25256717 AGGGAAAGATAAGGGACAGAAGG - Intronic
928211994 2:29330225-29330247 AGTCCATGAGCAGAGGCAGAGGG - Intronic
928666770 2:33557760-33557782 AGTAAATGATCAGAGGCAGTTGG + Intronic
929097677 2:38279449-38279471 AGTGAATGAGTAGAGACAGATGG + Intergenic
929219016 2:39444285-39444307 AGTATATGATAAGGGGCAGGTGG - Intergenic
931107279 2:59070270-59070292 TGTGAATGAAAAGAGGAAAATGG - Intergenic
932295333 2:70619603-70619625 AGTTTGTGATAAGAGGGAGAGGG + Intronic
935059242 2:99593533-99593555 CGGGAATGATCAGAGGCTGAAGG - Exonic
935569982 2:104649447-104649469 TGTGACTGAGAGGAGGCAGAGGG - Intergenic
939068285 2:137509751-137509773 AGTGATTGCAAAGAGGCACAGGG - Intronic
939569048 2:143818614-143818636 AGTGAATGAGAAAAGGCTGGAGG - Intergenic
939852279 2:147316761-147316783 GGTGAAAGAGAAAAGGCAGAAGG + Intergenic
940139271 2:150475352-150475374 AGTGAAGAATCAGAGGCACAGGG - Intronic
940413130 2:153389431-153389453 AGTCAGTGATGTGAGGCAGAGGG - Intergenic
940614004 2:156027844-156027866 AGTGAATGATAAGATGTATTTGG - Intergenic
941241605 2:163045627-163045649 ACTGAATGACAAGAGGTATAAGG - Intergenic
942142264 2:172989217-172989239 AGAGAAAGACAAGGGGCAGAGGG - Intronic
942538575 2:176991495-176991517 AGTGAAAGATAATAGGGTGAGGG - Intergenic
944285819 2:197948812-197948834 ACTGAATCAAAAGGGGCAGAGGG + Intronic
946206370 2:218111802-218111824 GGTGAAGGAGAAAAGGCAGAAGG - Intergenic
1169825721 20:9766768-9766790 AGTGATTGAAAAGGGGCATATGG + Intronic
1170575368 20:17658763-17658785 AGTGAAGGCAAAAAGGCAGAAGG - Intronic
1171131104 20:22653381-22653403 AGTGACTCATATGCGGCAGAGGG - Intergenic
1171158849 20:22903028-22903050 AGTAAATGACTAGAGCCAGAAGG + Intergenic
1171169911 20:23006837-23006859 AGTGAATAATCAGAGGCTGTGGG - Intergenic
1172261751 20:33573021-33573043 ATTGAATGTTGAGAGGGAGAGGG + Intronic
1173010232 20:39175575-39175597 AGTGAAAGAAAGGAGGAAGAAGG - Intergenic
1175594236 20:60217844-60217866 AGTTAAAGATAAGAGGGAAATGG - Intergenic
1175629753 20:60525664-60525686 AGTGAATCAGAAGATGCAAATGG - Intergenic
1175648284 20:60694692-60694714 AATGACTGATGACAGGCAGAAGG + Intergenic
1176944579 21:14963644-14963666 AGAGCATGTTAAGATGCAGATGG + Exonic
1178102811 21:29288414-29288436 ACTGAATGCTAAGTAGCAGAGGG - Intronic
1178278755 21:31262993-31263015 AGTGTATTTTAAGAGGCAGTGGG - Intronic
1179365399 21:40754432-40754454 AGTGAACAATAAAAGGAAGACGG + Intronic
1179381940 21:40908050-40908072 AGTGTATGAGAAGAGGATGAAGG - Intergenic
1181410857 22:22718085-22718107 GGTGAAAAATTAGAGGCAGAGGG + Intergenic
1181593268 22:23897277-23897299 AGTGATGGAGAACAGGCAGATGG - Intronic
1182045132 22:27268267-27268289 AGTGAATGATAAAATGCATGAGG + Intergenic
1182501321 22:30750020-30750042 AGTGAAAGGTCAGAGCCAGAGGG + Intronic
1183094491 22:35543980-35544002 AGTCAAAGAGAGGAGGCAGAGGG - Intronic
1183554123 22:38511962-38511984 AAAGAAAGATAAAAGGCAGAAGG - Intergenic
1183597139 22:38819407-38819429 AGTGAAGGAACAGAGGCAGGGGG - Exonic
1183699006 22:39439219-39439241 AGTGAATGTTAAAAGATAGAAGG + Intergenic
1183999309 22:41660672-41660694 GGTGAAAGATAAGAAGCAGAAGG - Intronic
1184463911 22:44658113-44658135 AGTGAATGATGAGAGGCTACAGG + Intergenic
1203290072 22_KI270735v1_random:28095-28117 AGAGAATGGTAAGAGGGAGGAGG - Intergenic
949812636 3:8022503-8022525 TGTGAATGGTATGAGGCAGAGGG + Intergenic
949980911 3:9501230-9501252 AGGGCATGAAAAGGGGCAGAAGG + Exonic
950129028 3:10529137-10529159 AGTGACTGATGAGAGGGAGTAGG + Intronic
950802136 3:15561362-15561384 AATCAATGATAAATGGCAGACGG + Intronic
951982050 3:28576271-28576293 AGTGAATGGGAAGATGGAGATGG + Intergenic
952542344 3:34379514-34379536 ATTGAATAATAAAAGGAAGAAGG - Intergenic
952850565 3:37725039-37725061 CATGAAAGATCAGAGGCAGATGG - Intronic
954349420 3:50030544-50030566 AATTACTGGTAAGAGGCAGAAGG - Intronic
954587409 3:51747701-51747723 GGTGAAGGAGAAAAGGCAGAAGG + Intergenic
956333764 3:68140873-68140895 AGTGAATGATAGGAAGCAGCAGG - Intronic
956801613 3:72764821-72764843 AGTGAATGAAAAGTGTCAGCTGG - Intronic
956848161 3:73202977-73202999 AGTGCATGATAATTGGAAGATGG + Intergenic
957215510 3:77315793-77315815 AAAGAATGATAAAAGGCAAAAGG + Intronic
957228064 3:77474377-77474399 AGTGAAACATCAGAGGCAAAGGG + Intronic
957579317 3:82050373-82050395 AGAGAATAATTAGAAGCAGAGGG + Intergenic
958129891 3:89405073-89405095 TGTGAAGGATAAAAGGCAGATGG + Intronic
959103418 3:102039904-102039926 AGTGAATAATAAGTGGAAGAGGG + Intergenic
959342909 3:105153631-105153653 AATGAAAGCAAAGAGGCAGAAGG - Intergenic
959441023 3:106375722-106375744 AGACAAAGACAAGAGGCAGAAGG + Intergenic
960208615 3:114933005-114933027 AGTGAATGATGAGAAGCAATGGG + Intronic
960602760 3:119474390-119474412 AGGGAATGCAAAGAGGCAGAAGG - Intronic
961378889 3:126484444-126484466 AGTGAGGAATAAGAGGCAGGAGG - Intronic
962497205 3:135952951-135952973 AGGGGAAGATGAGAGGCAGAGGG + Intergenic
964916565 3:161848379-161848401 GGTGAAGGAGAAGAAGCAGAAGG - Intergenic
965063154 3:163806961-163806983 GGTGAAGGAGAAAAGGCAGAAGG + Intergenic
965615710 3:170590260-170590282 ATTGAATGATAAGTGGAAAAGGG + Intronic
967589257 3:191253397-191253419 AGTCACTGACATGAGGCAGATGG + Intronic
967865665 3:194187915-194187937 AGGGAATGCTAAGAGGTTGAAGG + Intergenic
970252310 4:14128803-14128825 ATTGAAAGAACAGAGGCAGAAGG + Intergenic
970552834 4:17200534-17200556 AGTGTAAGATAAGAAGCAAATGG - Intergenic
970895284 4:21095428-21095450 AGTGACTGATAAGAATGAGACGG - Intronic
971117122 4:23661708-23661730 ATTGCAAGAAAAGAGGCAGAAGG - Intergenic
971421775 4:26480542-26480564 AAGGAATGTTAAGTGGCAGAAGG - Intergenic
971713233 4:30144204-30144226 AGAGAATGATAAGAAGAACAAGG + Intergenic
971983953 4:33794722-33794744 AGTGAATAATTAAATGCAGATGG - Intergenic
972067608 4:34970041-34970063 AGTGACTGAGTAGAGGCATAAGG + Intergenic
972419587 4:38874077-38874099 AATGTAAGAAAAGAGGCAGATGG + Intronic
972432559 4:38997270-38997292 AGTCAATGACAAGGGGCAGAGGG + Intronic
972993302 4:44849281-44849303 AGTGAGGAAGAAGAGGCAGATGG - Intergenic
975533191 4:75421572-75421594 AGAGAATAAGAAGAGGCCGAGGG - Intergenic
975624284 4:76328391-76328413 AGTAACTGATAAAAGGAAGAAGG + Intronic
975872082 4:78790922-78790944 AGACAATTATTAGAGGCAGATGG - Intronic
975953109 4:79799114-79799136 AGTTAATGAACAGAGGCAAATGG - Intergenic
976097239 4:81521923-81521945 CGTGAATGCTAAGAGAAAGAAGG - Intronic
976549383 4:86377451-86377473 GGTGAAGGAGAAGAGCCAGAAGG + Intronic
977380363 4:96265474-96265496 AGTGAATGTTAACAAGCAGTTGG - Intergenic
977519835 4:98067909-98067931 ACTCAATGATAAGTGACAGATGG - Intronic
978785352 4:112602892-112602914 AGTGATTGAAAAGGGGCAGAAGG + Intronic
979193937 4:117897673-117897695 AGTGAATGCTAAGAAGCTAAGGG - Intergenic
981981117 4:150792373-150792395 ATTGATTGAAAAGAGGCACAGGG + Intronic
982251189 4:153407885-153407907 AGTGAGTGCTAAGGGGCACAAGG + Intronic
983217607 4:165016701-165016723 ATTGAAGGAAAGGAGGCAGAAGG + Intergenic
983503457 4:168526881-168526903 GGTGAAGGATTAGAAGCAGATGG + Intronic
984939518 4:184918938-184918960 GGTGAAGGAGAAAAGGCAGAAGG - Intergenic
985870446 5:2550014-2550036 AGTGAGTGATGATAGGCGGAAGG + Intergenic
987366783 5:17155815-17155837 AGTCAATGAGAAGAGAAAGACGG - Intronic
987818285 5:22931491-22931513 TGTGAAGGAGAAAAGGCAGAAGG + Intergenic
988492942 5:31720454-31720476 AGTGAATCTTCAGAGGCAAAGGG - Intronic
988526980 5:31995749-31995771 AGGGAAGGAGAGGAGGCAGAGGG - Intronic
988857948 5:35247273-35247295 AGTGGGTGACAGGAGGCAGAGGG + Intergenic
988868281 5:35359509-35359531 AGTGATAGATCAGAGGCAGAGGG - Intergenic
989156057 5:38346049-38346071 AGTGCAGGAAAAGAGACAGACGG + Intronic
989429636 5:41337565-41337587 AGAAAATGCTAACAGGCAGAAGG + Intronic
990068429 5:51748054-51748076 AGAGAGTGATGAGAGGGAGAGGG + Intergenic
990091855 5:52061532-52061554 AGTGAATGAGAAAAGGAGGAAGG - Intronic
990681307 5:58247484-58247506 AGTGAATGATCAGTGACAGGAGG - Intergenic
990909124 5:60836443-60836465 ACTGAATGATAAGCAGCAAAGGG + Intronic
992160616 5:73997304-73997326 GATGAATGGAAAGAGGCAGAGGG + Intergenic
992984501 5:82213843-82213865 AGAGAAAGATAGGAGTCAGAGGG - Intronic
993396379 5:87394693-87394715 AGTGAATAATCAGAGGCAAAAGG - Intronic
993539680 5:89133423-89133445 AGGGATTAATAATAGGCAGAAGG - Intergenic
993641469 5:90410478-90410500 ACTGAAAAATAAGAGACAGAAGG - Intergenic
995501900 5:112816254-112816276 AGTGATTCAAATGAGGCAGATGG - Intronic
995706838 5:114995777-114995799 GGTGAAGGAGAAAAGGCAGAAGG + Intergenic
996333075 5:122353319-122353341 AGTGACTGAAATGGGGCAGAAGG + Intronic
996680636 5:126225565-126225587 GGTGAAGGAGAAAAGGCAGAAGG + Intergenic
996691554 5:126345826-126345848 AGGGAGTGAGAAGAGCCAGAAGG + Intergenic
997972883 5:138418454-138418476 CGTTGATGATAAGAGGCACAGGG + Intronic
998111879 5:139508717-139508739 GGTGAAGGAGAAAAGGCAGAAGG + Intergenic
998228207 5:140342942-140342964 AGTGCCTCCTAAGAGGCAGAAGG + Intronic
998535566 5:142927292-142927314 AGTGACTGAGAAGGGGCACAAGG - Intronic
998690151 5:144579282-144579304 AGTGAAAAAGAAGAGGAAGAAGG + Intergenic
998811330 5:145969476-145969498 GGTGATGGAAAAGAGGCAGAGGG + Intronic
998988382 5:147787754-147787776 AATGAATGAAAACAGGCTGAAGG + Intergenic
999081825 5:148851597-148851619 AGTCAATGATAAAAGACCGAAGG - Intergenic
999084922 5:148879556-148879578 AGTAAATGAGATGAGGCACATGG - Intergenic
999117062 5:149173523-149173545 AGTGGATGAGATGGGGCAGAAGG + Intronic
999255661 5:150208843-150208865 AGGGAAAGGTCAGAGGCAGAAGG + Intronic
1001459307 5:171895549-171895571 AATGAATGAAGAGAGGAAGAAGG + Intronic
1002816356 6:684559-684581 ATTAAAGGAAAAGAGGCAGATGG - Intronic
1003639721 6:7866395-7866417 AGTGAATGATAACAAGTAGAAGG - Intronic
1004037967 6:11942758-11942780 AGTGAGGGAGAAGAGGAAGAAGG + Intergenic
1004522287 6:16373395-16373417 AGTGAAAGACAAATGGCAGATGG + Intronic
1004531784 6:16461079-16461101 GGTGAAGGAGAAAAGGCAGAAGG + Intronic
1005868019 6:29951107-29951129 AGTGTATGATCAGGAGCAGATGG - Intergenic
1006995108 6:38252375-38252397 TGTAAATGATAAAAGGCAAAAGG - Intronic
1008052270 6:46912479-46912501 GGTGAAGGGTACGAGGCAGACGG + Intronic
1008060034 6:46987170-46987192 AGTGAAAAATAAAAGGCGGAAGG + Intergenic
1009385558 6:63081405-63081427 AGTAAAGGAGAAAAGGCAGAAGG - Intergenic
1011056723 6:83212820-83212842 AGTGAGTGATGAGAGTCAAATGG - Intronic
1012548694 6:100448669-100448691 AGTGGATGACCTGAGGCAGAGGG + Exonic
1013153809 6:107473803-107473825 CCTGAATGATAAGAGACATATGG + Intergenic
1013313986 6:108923930-108923952 AGTGAATGAGAAGGGGAAGGAGG - Intronic
1013907434 6:115235763-115235785 GGTGAAGGAGAAAAGGCAGAAGG - Intergenic
1014541191 6:122678299-122678321 CCTGAATGAAAAGAGGCAGGAGG + Intronic
1015729225 6:136331346-136331368 AGAGAAAGATAGGTGGCAGAAGG + Intergenic
1015820557 6:137256232-137256254 AGGGAATCATAGCAGGCAGATGG - Intergenic
1015912907 6:138186458-138186480 AGTCAAAGACAAAAGGCAGAAGG + Intronic
1017101371 6:150852434-150852456 GGTGAAGGAGAAAAGGCAGAAGG + Intergenic
1017435148 6:154408641-154408663 AGTGACTGCTAAAAGGCACAAGG + Intronic
1017741104 6:157407369-157407391 AATGAATCCTAGGAGGCAGAGGG - Intronic
1017986780 6:159450701-159450723 TGGGAAAGAAAAGAGGCAGAAGG + Intergenic
1018090849 6:160346544-160346566 ATTCACTGACAAGAGGCAGATGG + Intergenic
1018173666 6:161161428-161161450 AGTGAATGGTAAGAGGCAGAGGG + Intronic
1018773203 6:166990198-166990220 ATTGAATGAAGAGATGCAGAAGG - Intergenic
1018842636 6:167528930-167528952 ATTGATTGCTCAGAGGCAGAGGG - Intergenic
1019007567 6:168813569-168813591 ATTGACTGTGAAGAGGCAGAGGG + Intergenic
1020800534 7:12727178-12727200 AGTGAATGAGAAAGGGAAGATGG + Intergenic
1021417889 7:20408907-20408929 AGTGCATGTTTAGAGGCAAATGG + Intronic
1023136136 7:37054339-37054361 AGTGTATGCTAAGGGGCTGAGGG - Intronic
1023377825 7:39576447-39576469 GGTGAATGGAAAGAGGCAGGTGG - Intronic
1023891523 7:44395523-44395545 AGTGACTGATAATTGGCACAGGG - Intronic
1024272439 7:47652755-47652777 ATTGAGTCCTAAGAGGCAGAAGG + Intergenic
1024436376 7:49360757-49360779 AGTGAACTATAAGTGACAGAAGG + Intergenic
1024870382 7:53957314-53957336 GGTGAAGGAGAAAAGGCAGAAGG - Intergenic
1027791383 7:82641547-82641569 GGTGAAGGAGAAAAGGCAGAAGG + Intergenic
1028082482 7:86595572-86595594 AGTGAGTGAGAAGAGAGAGAAGG - Intergenic
1028432941 7:90768980-90769002 AGTTAATGTTAAGAGGCAAATGG + Intronic
1030555227 7:111015692-111015714 AGTGAATGCTAATAGGTAGAGGG + Intronic
1030951515 7:115795951-115795973 AGTGAAGGAGAAGAGGAAGCGGG - Intergenic
1031303596 7:120096056-120096078 AGAAATTGATAAGAGGCACATGG - Intergenic
1031353389 7:120762557-120762579 AGTAAAGGATGAGAAGCAGAAGG + Intergenic
1031373752 7:120999151-120999173 AGAGAAAGAAAAGAGGGAGAAGG - Intronic
1031581509 7:123480628-123480650 AGTGAAAGATAAAGGGGAGAGGG - Intronic
1031724911 7:125226241-125226263 AATGAATGATAAGAGGATAAGGG + Intergenic
1032008865 7:128328052-128328074 AGTGGAAGATAGGAGGCAGGAGG - Intronic
1032310752 7:130784562-130784584 AGTGACTGCAAAGAGGCAGGGGG - Intergenic
1032357060 7:131221049-131221071 AATCACTGATATGAGGCAGATGG - Intronic
1032586549 7:133152403-133152425 AGTGAAGGATGACAGACAGAGGG - Intergenic
1033043546 7:137940041-137940063 ATTGAAGGATAAGGGACAGAAGG - Intronic
1033988737 7:147257855-147257877 AGTGGAGGTTCAGAGGCAGATGG + Intronic
1037827322 8:22167181-22167203 ATTGATGGATAAGAGGCACAAGG - Intronic
1039831410 8:41218089-41218111 AGTGCAGGATAAGAGGAAGGAGG - Intergenic
1039999283 8:42562758-42562780 GGTGAAGGAGAAAAGGCAGAAGG - Intergenic
1040347285 8:46517677-46517699 ATTGCATGATAAAAGGTAGATGG + Intergenic
1040684688 8:49857528-49857550 AGTGTAAGATTAGAGCCAGAGGG - Intergenic
1040891650 8:52323670-52323692 AGAGACTGATGGGAGGCAGAGGG - Intronic
1040971072 8:53138189-53138211 GGTGAAGGAGAAAAGGCAGAAGG - Intergenic
1041002322 8:53464977-53464999 GGTGAAGGAGAAAAGGCAGAAGG + Intergenic
1041630925 8:60086186-60086208 AGTGAATGAAGGGAGGAAGAAGG + Intergenic
1041795040 8:61738123-61738145 AGTGAAACATGAGAGGCTGATGG - Intergenic
1042016879 8:64322762-64322784 AGGAAATGATAATAGGGAGAAGG - Intergenic
1042089652 8:65144872-65144894 AGTGGTTGAAAAGAGGAAGAAGG - Intergenic
1042258286 8:66829369-66829391 GGAGAATGATTATAGGCAGATGG + Intronic
1042772306 8:72393345-72393367 GGTGAAGGAGAAAAGGCAGAAGG + Intergenic
1043754412 8:83985159-83985181 AGAGAATTAAAAGAGGAAGATGG + Intergenic
1043762385 8:84083878-84083900 AAGAAATGATAAGAGACAGAAGG - Intergenic
1045928944 8:107601368-107601390 GGTGAAGGAGAAGAAGCAGAAGG - Intergenic
1047442275 8:124888759-124888781 CCTCAATGATAAGAGGCTGAAGG - Intergenic
1047898464 8:129393480-129393502 AGAGATAAATAAGAGGCAGAAGG + Intergenic
1048323327 8:133418818-133418840 AGTGAATGAGATGTGGCAGGAGG + Intergenic
1048365586 8:133735600-133735622 AGTGAGTGATAAGAGGATGGTGG + Intergenic
1050889480 9:10806189-10806211 ACTGAGTGAAAAGAGGCAGGAGG - Intergenic
1051092004 9:13420779-13420801 AGTGAAGGAGTAGAGGTAGATGG + Intergenic
1051136979 9:13933493-13933515 TGGGAATGAAAAGAAGCAGAGGG - Intergenic
1051657549 9:19397360-19397382 ATTGAATAAGAAGAAGCAGAAGG + Intergenic
1051698239 9:19791261-19791283 AGTGAAGGGTGAAAGGCAGAAGG + Intergenic
1051729701 9:20127696-20127718 TGAGAAGGATAAGAGACAGACGG + Intergenic
1052057383 9:23920477-23920499 GGTGAAGGAGAAAAGGCAGAAGG - Intergenic
1052769845 9:32677573-32677595 TGTGAATTTGAAGAGGCAGAAGG - Intergenic
1052813863 9:33084886-33084908 AATGAATGACCAGAGGAAGATGG + Intergenic
1052833339 9:33233056-33233078 ATTGAATAATATTAGGCAGAGGG + Intronic
1053075920 9:35134708-35134730 CCTGAATGATAGGAGCCAGATGG + Intergenic
1053103037 9:35387378-35387400 TGGGAATGAGAAGAGGCAGTAGG - Intronic
1055235497 9:74117731-74117753 AGTTAAAAATTAGAGGCAGATGG + Intergenic
1055467362 9:76578829-76578851 AGTGGATGCTAAGAGGGACACGG - Intergenic
1056084908 9:83137819-83137841 AGTAAATGCTCAGAGGCAGGAGG + Intergenic
1056334524 9:85553929-85553951 TGAGAATGATCAGAGACAGATGG - Intronic
1056392375 9:86151888-86151910 GGTGAAGGAGAAAAGGCAGAAGG - Intergenic
1056465221 9:86847270-86847292 AGACAATAATAAAAGGCAGAAGG - Intergenic
1056632271 9:88303710-88303732 AGTGAATGAGGAAAGGCAGAGGG - Intergenic
1058382540 9:104393274-104393296 AGAGACTGAAAAGAGGGAGAGGG + Intergenic
1058480705 9:105391656-105391678 AATGAATGAAAAGAGGCAGCAGG - Exonic
1058847500 9:108975459-108975481 AGAGAAAGTTGAGAGGCAGAAGG - Intronic
1059002552 9:110365319-110365341 AGTGAATGTCAAGAGAAAGAAGG + Exonic
1060252120 9:121995000-121995022 AGGGAATGAGGAAAGGCAGAGGG + Intronic
1061507415 9:131039285-131039307 ACTGAATGACAAGAAGCAGGAGG + Intronic
1186188188 X:7042098-7042120 AATAAATGAAAAGAGGGAGAAGG - Intergenic
1186631639 X:11355765-11355787 AATGAGTGATATGAGGAAGAGGG + Intronic
1186734148 X:12443095-12443117 AGTGACTGCTAACAGGCAAAGGG + Intronic
1186950347 X:14617645-14617667 ATTGAGTGATAAGAGACACATGG + Intronic
1186965393 X:14781508-14781530 TCTGAAGGATGAGAGGCAGAAGG + Intergenic
1187146180 X:16639433-16639455 AATGAAAGATGAGAAGCAGATGG - Intronic
1188609387 X:32077156-32077178 AGAGACTGAAAAGGGGCAGAAGG + Intronic
1189865934 X:45327080-45327102 AGTGACTGCTAAGTGGCAGAAGG - Intergenic
1192531228 X:71888396-71888418 AGTGATTGAGAAGAGACACAGGG - Intergenic
1192622177 X:72689294-72689316 AGTGACTGCTAAGGGGCACAAGG - Intronic
1192946159 X:75967183-75967205 AGTGAAGGAAAAGATGCAAAAGG + Intergenic
1193658006 X:84222250-84222272 AAAGCATGATAAGAGGTAGAAGG - Intergenic
1193880457 X:86914624-86914646 GGGGTATGATATGAGGCAGAAGG + Intergenic
1195654373 X:107320834-107320856 AGTGTATGACAAGATGGAGAAGG + Intergenic
1196354547 X:114775169-114775191 AGCTGAAGATAAGAGGCAGAGGG - Intronic
1196489138 X:116247098-116247120 GGTGAAGGAGAAAAGGCAGAAGG + Intergenic
1197513792 X:127400410-127400432 GGTGAATGAGAAAAAGCAGAAGG + Intergenic
1198416594 X:136426229-136426251 AGAGACTGATAAGATGGAGAAGG + Intergenic
1201311686 Y:12603327-12603349 GGTGAAAGAGAAAAGGCAGAAGG - Intergenic
1201404140 Y:13633280-13633302 GGTGAAGGAGAAAAGGCAGAAGG + Intergenic
1201454268 Y:14151191-14151213 AGTGGGTGATATGAGGGAGATGG + Intergenic
1201496242 Y:14593710-14593732 GGTGAAGGAGAAAAGGCAGAAGG - Intronic
1201552541 Y:15233901-15233923 AATGAATGCTAATAGGCAGAGGG + Intergenic
1201639903 Y:16167478-16167500 GGTGAAGGAGAAGAAGCAGAAGG - Intergenic
1201662910 Y:16417847-16417869 GGTGAAGGAGAAGAAGCAGAAGG + Intergenic