ID: 1147703047

View in Genome Browser
Species Human (GRCh38)
Location 17:42407912-42407934
Sequence CTCCAGTAGCAGGCAGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147703047_1147703051 11 Left 1147703047 17:42407912-42407934 CCTTACCCTGCCTGCTACTGGAG 0: 1
1: 0
2: 1
3: 32
4: 191
Right 1147703051 17:42407946-42407968 TAAGACTTATACATCATTGTAGG 0: 1
1: 0
2: 0
3: 18
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147703047 Original CRISPR CTCCAGTAGCAGGCAGGGTA AGG (reversed) Intronic
900133645 1:1103683-1103705 TTCCAGGAGCAGGCAGGGGAAGG - Intronic
900483828 1:2912147-2912169 CTCCGGGAGCAGGCCAGGTAAGG - Intergenic
901463247 1:9404280-9404302 CTGCAGGAGCAGCCAGGATATGG + Intergenic
901599288 1:10410059-10410081 CTGAAGTGGCAGGAAGGGTAAGG + Intronic
902897548 1:19489356-19489378 CTCCAGTAGGAGGCCAGGCATGG - Intergenic
904066196 1:27753282-27753304 CACAAGAAGCAGGAAGGGTAGGG + Intronic
904237141 1:29123164-29123186 CTCCAGTCGGAGGCAGGGATGGG - Intronic
913000017 1:114571029-114571051 CTCCAAGATCAGGCAGGGCATGG - Intronic
914839202 1:151233818-151233840 CTCCAATAGCAATCAGAGTAAGG - Intronic
915216471 1:154343887-154343909 CTCCAGGAGTACGCAGGGGAAGG + Exonic
919759986 1:201091793-201091815 CTGCAGAGGCAGGCAGGGAAGGG + Intronic
920195403 1:204223193-204223215 CTCCAGAAGCAGGCAGGGAATGG - Intronic
920209108 1:204315274-204315296 CTTATGTAGCAGGCAGGGGAGGG - Intronic
920255402 1:204651069-204651091 CTCCAGCAGCAGGCAGAAGAGGG + Intronic
922896934 1:229108041-229108063 GTCCAGTAGCAGGAAGGGAGGGG - Intergenic
923857952 1:237864877-237864899 CTCCTGTGGGAGGCAGGGGAGGG - Intergenic
924111197 1:240701492-240701514 CTCCAGTACCAGGCCGGGCATGG - Intergenic
924545325 1:245020918-245020940 CTCCAGTATAAGGCTGGGTGTGG - Intronic
924703178 1:246474852-246474874 GTCAAGTAGCAGGAAGGGGAAGG + Intronic
1062984289 10:1753169-1753191 CCACAGAAGTAGGCAGGGTAGGG + Intergenic
1067616004 10:47759603-47759625 CTTCTGGAGCAGGCAGGGTCTGG - Intergenic
1068458805 10:57298543-57298565 CCCCAGTTGCAGGGAGGTTAGGG + Intergenic
1069420082 10:68239237-68239259 CTCCACTGGCAGGCAGGGATAGG - Intergenic
1070066861 10:73043988-73044010 CTCCAGTAGCAGGCAATTTTGGG + Intronic
1070372224 10:75793202-75793224 CTGCAGTAGCTGGCAGAGTCTGG + Intronic
1071478057 10:86041897-86041919 CCTCAGTAGCAGGCAGCGTGAGG - Intronic
1072806076 10:98424716-98424738 CTGCAGAAGCTGGGAGGGTATGG + Intronic
1076482334 10:130792724-130792746 CTCCTGTAGGAGGCAGGGTCTGG + Intergenic
1077728828 11:4705947-4705969 CTCCAGGAGCAGGGATGGTGGGG + Intronic
1077831922 11:5882161-5882183 CCACAGTAGCAGACAGTGTATGG - Intronic
1081594948 11:44452717-44452739 CCCCAGTGGGAGGCAGGGGAGGG - Intergenic
1082078472 11:47993581-47993603 CTACAGACGCAGGCTGGGTACGG - Intronic
1083019495 11:59492324-59492346 CTCAAGTCTCAGGCAGGATAGGG + Intergenic
1083398741 11:62409582-62409604 CTCCAAGAACAGGCTGGGTATGG + Intronic
1083707548 11:64526577-64526599 CACCAGGAGCAGGCGGGGCAGGG - Intergenic
1084098326 11:66928095-66928117 CACCTGTGGCAGGCCGGGTATGG + Intronic
1084486111 11:69449292-69449314 CTCCATTAGCATGCAGGGTTGGG - Intergenic
1085736735 11:79045570-79045592 CTCCAGTAGCAGCCAGGCCAGGG - Intronic
1086116254 11:83254263-83254285 TTCCAGAAACAGGCAGGGTATGG - Intronic
1087183481 11:95161492-95161514 CTCCAGTATTTGGCAGGGCAAGG - Intergenic
1091595264 12:1874304-1874326 GGCCAGTAGCAGGCAGCATAAGG + Intronic
1092064969 12:5582383-5582405 CTCCAGCTTCAGGCAGTGTAGGG - Intronic
1092214612 12:6672344-6672366 CTCCAGCAGCACACACGGTAAGG - Exonic
1093885572 12:24456001-24456023 CTCCAGTACCAGGCAGAGGGAGG - Intergenic
1097194148 12:57234659-57234681 AGCCAGTAGCAGGCAGGGGTGGG + Exonic
1097541057 12:60943969-60943991 CTCCAGCAGTAGGCAGGCAACGG + Intergenic
1100468596 12:94871539-94871561 CTCCAGAACCAGACAGGGTCTGG + Intergenic
1101555097 12:105801514-105801536 TTCCAGTAACAGGCAGGGGTTGG + Intergenic
1101726601 12:107393320-107393342 TTCCTGTATCAGGCAGGGTGGGG + Intronic
1102013240 12:109631785-109631807 CTCCCGTAGCAGACAGGGCCTGG - Intergenic
1102013410 12:109632698-109632720 CTCCTGTAGCAGACAGGGCCTGG + Intergenic
1104053833 12:125214528-125214550 CTCCTGGAGCAGGGAGGGAAGGG + Intronic
1104366234 12:128180292-128180314 CTCCATTTGGAGGCAGGGTGGGG + Intergenic
1108643215 13:52402437-52402459 TTCCTGAAGGAGGCAGGGTAGGG - Intronic
1108734544 13:53269016-53269038 CTCCAGTATCAGCAAGGATATGG - Intergenic
1111779679 13:92706597-92706619 ATACAGGAGCAGGCAGAGTAAGG - Intronic
1117016519 14:51523987-51524009 CTCCAGAACAATGCAGGGTATGG + Intronic
1118816406 14:69317339-69317361 CTCCAGTGGGAGTCAGGGTGGGG + Intronic
1121169987 14:91845592-91845614 CTCAAGTAAAAGGCAGGGAATGG + Intronic
1121755472 14:96398902-96398924 AGAGAGTAGCAGGCAGGGTAAGG - Intronic
1121959554 14:98246856-98246878 GAGCAGTAGCAGGGAGGGTAGGG - Intergenic
1124052513 15:26210879-26210901 CTCCAGCAGCAGACAGGCAAAGG + Intergenic
1124269604 15:28268520-28268542 CTCCAGTAGCAGCCAAGGCTAGG + Exonic
1124562818 15:30791430-30791452 CTCCAGTAGAATGCAGAATAGGG - Intergenic
1131258085 15:90874391-90874413 CTCCAGGCCCAGGCAGGGCAGGG + Intronic
1135561292 16:23478877-23478899 CTCCTGTTACAGGCATGGTAAGG - Exonic
1137549579 16:49428025-49428047 CTCCAAGAGCAGGCTGGGTGGGG - Intergenic
1138395676 16:56702702-56702724 CTTTAGCAGCAGGAAGGGTAGGG - Intronic
1139928712 16:70507568-70507590 CTCCAGTTGTTGGCAGGGTATGG + Intronic
1143646399 17:8232943-8232965 GGCCAGGAGCAGGCAGGGCAGGG + Exonic
1144109837 17:12020985-12021007 CGTCAGCAGCATGCAGGGTAAGG + Exonic
1144150307 17:12436591-12436613 CTCGAGTAGCAGGAAGGCTGTGG - Intergenic
1144671426 17:17134696-17134718 CTCCAGAAGCAGGAAGGCCATGG - Intronic
1144874680 17:18391198-18391220 CTCAAGTAGCAAGAAGGGCAAGG + Intergenic
1145157544 17:20553223-20553245 CTCAAGTAGCAAGAAGGGCAAGG - Intergenic
1147428384 17:40356994-40357016 CTCCAGTGGGAGGGAGGGGAAGG - Intronic
1147703047 17:42407912-42407934 CTCCAGTAGCAGGCAGGGTAAGG - Intronic
1148203047 17:45762728-45762750 CCCCAGCACCAGGCAGGGGAAGG + Intergenic
1148228919 17:45919171-45919193 CTGCAGCAACAGGCAGGGTCAGG - Intronic
1148722989 17:49768226-49768248 ATTCAGTAGCCAGCAGGGTAAGG - Intronic
1149468506 17:56897948-56897970 CACCTGTAGCAGGCAGAGTGTGG - Intronic
1152376218 17:79920139-79920161 CTCCTGCAGCGGGCAGGGGAGGG + Intergenic
1152944122 17:83189817-83189839 CTCCAGCAGCAGGCAGGCTCCGG - Intergenic
1153740013 18:8114597-8114619 CTCCAGTGGCAGGCAGTGCTGGG - Intronic
1155244605 18:23895117-23895139 CTCCATAAGCAGGAAGGGAAAGG + Intronic
1155914585 18:31543339-31543361 CTGCAGGAGCAGGCTTGGTAGGG + Intronic
1157159754 18:45302907-45302929 CTCCTGTAGCAGGCAGTGCTGGG + Intronic
1159092784 18:63868670-63868692 AGCCTGTAGCAGGCTGGGTATGG + Intergenic
1161163801 19:2774770-2774792 CTCCTGGAGGAGGCCGGGTATGG - Intronic
1162087643 19:8258099-8258121 TTCCAGGAGGAGGCAGGGAAGGG + Intronic
1162721993 19:12668150-12668172 CCCCAGCAGCAGGCAGGGGAAGG + Exonic
1164445757 19:28316294-28316316 CTCTAGGAGCAGGCAGGATTTGG - Intergenic
1164632980 19:29773820-29773842 GTCCAGTAGTAGGCCGGGTGCGG - Intergenic
1166893501 19:46008855-46008877 CTCCCGTACCAGGCAGGGTCAGG - Intronic
1167269415 19:48499017-48499039 CTCCAGTGGCAGGCAGGAGCAGG + Exonic
1168028305 19:53660038-53660060 CTCCAGTAAAAAGCAGGGTTTGG - Intergenic
924987055 2:281610-281632 CTCCAGCAGCAGCCAGCGGAGGG + Intronic
925097901 2:1222512-1222534 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925097913 2:1222582-1222604 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925097926 2:1222652-1222674 CTCCACCAGCAGGCAGGACAGGG - Intronic
925097936 2:1222722-1222744 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925097948 2:1222792-1222814 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925097960 2:1222862-1222884 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925097973 2:1222932-1222954 CTCCACCAGCAGGCAGGACAGGG - Intronic
925097985 2:1223002-1223024 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925097997 2:1223072-1223094 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925098009 2:1223142-1223164 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925098021 2:1223212-1223234 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925098031 2:1223282-1223304 CTCCAGCAGCAGGCAGGACAGGG - Intronic
926139574 2:10360159-10360181 CTCCAGGAGCTGGCAAGGGAGGG + Intronic
926251061 2:11155673-11155695 CTTCTGGAGCTGGCAGGGTAAGG + Exonic
927482453 2:23465150-23465172 GTACTGTGGCAGGCAGGGTATGG + Intronic
927775226 2:25897581-25897603 ATCCAGAAGCAGGCAGGGTGCGG - Intergenic
928372818 2:30753358-30753380 CTCCAGTGGCTGGGAGGGCAAGG + Intronic
930158657 2:48130880-48130902 CTCCAGTAGAAGATGGGGTAGGG + Intergenic
934614817 2:95764382-95764404 CTCCAGTAGGAGCCAGGTTCCGG - Intergenic
934646086 2:96060112-96060134 CTCCAGTAGCAGCCAGGTTCCGG + Intergenic
934839489 2:97616195-97616217 CTCCAGTAGCAGCCAGGTTCCGG + Intergenic
935369847 2:102333734-102333756 CTCCAAAAGTAGGGAGGGTAGGG - Intronic
936044035 2:109172377-109172399 CTCCAGGAGCAGGGAGAGGACGG - Intronic
936271535 2:111053023-111053045 CTCCAGTTGCTGGCAGAGTGGGG - Intronic
936293400 2:111246670-111246692 CACCAGCTGCAGGCAGGGTCAGG - Intergenic
943780885 2:191822491-191822513 ATCCTGTGGCAGGCAGGGAAAGG - Intergenic
946359070 2:219208128-219208150 CTCCCCTAGCCGACAGGGTAGGG - Intronic
948425137 2:237882690-237882712 CTCCAGTAGCAGCGAGGGCCTGG + Intronic
949075262 2:242053301-242053323 CTCCAGCAGCAGGGATGGGATGG + Intergenic
1170000142 20:11606277-11606299 CTACTGTAGCAAGCAGGGCATGG + Intergenic
1170534747 20:17329026-17329048 CTCCATTAGCAGGTTGGGAATGG + Intronic
1170671732 20:18440557-18440579 CTCCTGTAGCATGCTGGGTTGGG + Intronic
1170727582 20:18943503-18943525 CTCATGTGGCGGGCAGGGTAGGG + Intergenic
1172409986 20:34713856-34713878 CTCAAGTTGCAGGTAGGGTGGGG + Intronic
1172844464 20:37921449-37921471 CTCTGGTGGCAGGCAGGGGAAGG - Intronic
1175697190 20:61111360-61111382 CTCCAGCACCAGGCAGGGGATGG - Intergenic
1176049157 20:63107561-63107583 CTCCAGTGGCTGGAAGGGTAGGG + Intergenic
1176190128 20:63804601-63804623 CTACAGTACCAGGCCGGGCACGG + Intronic
1177776844 21:25577379-25577401 CTACAGTAACAGGCCGGGTGCGG - Intergenic
1178867286 21:36339848-36339870 CTCCAGGAGAAGGAGGGGTAGGG - Intronic
1181344232 22:22206371-22206393 CACCAGTGGCATGGAGGGTAAGG + Intergenic
1183369884 22:37426575-37426597 CTCCAGCAGCTGTCAGGGGACGG - Intronic
1183987271 22:41576484-41576506 CACCACTAGCAGTCAGGATATGG + Exonic
950431101 3:12951741-12951763 CTCCCCTGGCAGGCAGGGTTTGG + Intronic
952399421 3:32949776-32949798 AACCAGTAGCAGGCTGGGTGCGG + Intergenic
953770298 3:45774591-45774613 CTCCAGTATCATGCCTGGTAGGG - Intronic
953982691 3:47420515-47420537 CTCCAGAAGAGGGCAGGGCAGGG + Intronic
954611491 3:51946840-51946862 CTCCAGTATCAGGAAGTGTTTGG - Intronic
955928964 3:64036667-64036689 CTCCAGAAGCAGGCACTTTAGGG + Intergenic
956040422 3:65139519-65139541 CTCCAGTAGCTGTCAGGGTTGGG - Intergenic
960735540 3:120775482-120775504 CATCAGTAGCAGGCAGAGAAAGG + Intronic
960750102 3:120939458-120939480 TTCCAGTAGTAGACAGGGGAGGG - Intronic
963772787 3:149405771-149405793 CTCCAGTAACACACAGGGAAAGG - Intergenic
964778862 3:160312460-160312482 GTCCAGAAGCAGGCAAGGAAAGG - Intronic
965216868 3:165874805-165874827 TTCCAGTACCAGGGTGGGTAGGG + Intergenic
966234617 3:177686796-177686818 GTCCAGGAGCAGCCAGGGGAAGG - Intergenic
968742787 4:2339879-2339901 CCCCAGGAGCAGGGAGGGCAGGG + Intronic
969621500 4:8281090-8281112 CTCCAGGGGCAGCCAGGGGAAGG - Intronic
969715664 4:8867137-8867159 TTCCAGGAGCAGGCAGGCTGGGG - Exonic
971202981 4:24530134-24530156 CTCCAAGAGCAGGCAGTGTTAGG + Intronic
972403838 4:38728732-38728754 TTCCGGGAGCAGGCAGGGTGTGG - Intergenic
972558642 4:40205638-40205660 CTGTGGTATCAGGCAGGGTATGG + Intronic
975561265 4:75710250-75710272 CTCGAGAAGCAGGCTGGGTGTGG - Intronic
976734294 4:88295058-88295080 GTCCAGTTGCAGGCCGGGTGTGG + Intergenic
984246354 4:177279207-177279229 CCCTAGGAGCACGCAGGGTACGG + Intergenic
985030418 4:185783674-185783696 CTCCAGTGGCAGGCATGAGAGGG + Intronic
986405852 5:7424254-7424276 CTCCAGTAGCAGGCACCATGTGG + Intronic
989125516 5:38048989-38049011 TTTCAGGAGCAGGCAGGGAAAGG - Intergenic
989339745 5:40360026-40360048 CTCCCATAGGAGGGAGGGTAGGG + Intergenic
989415342 5:41168860-41168882 CTCAAGTAGTAGGAAGGGAATGG + Intronic
991406593 5:66306073-66306095 CTCTGGTAGCAAGCAGGGCAGGG + Intergenic
993883234 5:93387486-93387508 CACCAGTGGCAGGCATAGTATGG - Intergenic
995142613 5:108749530-108749552 CTCCAGAAGCAGGAAGGGATGGG - Intronic
995555156 5:113320303-113320325 TTTCAGTAGCAGAGAGGGTAAGG + Intronic
996343817 5:122468396-122468418 CTCCAGTAGCAGCTAGGAAATGG - Intergenic
996520493 5:124420692-124420714 CCTCAGTGGCAGGCAGGGCAGGG + Intergenic
997653647 5:135539704-135539726 AGCCAGGAGCAGGCAGGGCAAGG - Intergenic
999384578 5:151145191-151145213 CTCCAGCAGCAGCCTGGGTGGGG - Intronic
1002439248 5:179255839-179255861 CTGCAGCAGCAGGCAGGGCTGGG + Intronic
1003338245 6:5195318-5195340 CCACAGTATCAGGCCGGGTATGG + Intronic
1003403699 6:5811099-5811121 TTGCAGAGGCAGGCAGGGTAGGG + Intergenic
1004051268 6:12081893-12081915 TTCCCGAAGCATGCAGGGTATGG - Intronic
1004285676 6:14318429-14318451 CCCCAGTAGAAGGCAAGGGAGGG - Intergenic
1004587068 6:17012965-17012987 CTCCACTTACACGCAGGGTAGGG - Intergenic
1005205430 6:23397886-23397908 CTCCAGTTGCAGGTGGGGTGGGG - Intergenic
1006017546 6:31094346-31094368 CTCCAGTTGCATGCAGGGTGGGG + Intergenic
1007752376 6:44078105-44078127 CTCCAGGAGCTGGGAGGGTAGGG - Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1016644826 6:146394515-146394537 CTCCAGAAGCAGAAAGGGCATGG - Intronic
1017732911 6:157333784-157333806 CTCCAAGAGCAGGCAGGCGAAGG + Intergenic
1018773415 6:166992343-166992365 CTCCAGAAGCAAGGAGGGGATGG - Intergenic
1019602652 7:1893053-1893075 CTCCAGGCCCAGGCAGAGTATGG + Intronic
1023213034 7:37829131-37829153 CTCCAGTCCCAGTCAGAGTAGGG + Intronic
1028993553 7:97075876-97075898 TTCCATTATCAGGCTGGGTAGGG + Intergenic
1030411754 7:109189513-109189535 CTCCAGTATTAGGATGGGTAAGG + Intergenic
1031141797 7:117950617-117950639 CCCCAGTGGCTGGCATGGTAGGG + Intergenic
1034283656 7:149870506-149870528 CTCCAGAAGTAGGCAGGGCCTGG + Intergenic
1034439079 7:151077416-151077438 CACCAGTAGCAGGAAGGGCCCGG + Intronic
1037546311 8:19926888-19926910 CTACAGTTGGAGGCAGGGGAGGG + Intronic
1037839880 8:22237044-22237066 CTGCAGTTGTAGGCAGGGAAAGG + Intergenic
1037865149 8:22437422-22437444 CTCAAGAAACAGGCAGAGTACGG + Intergenic
1043296196 8:78666230-78666252 CACCAGTAGCAGGAAGGCGAGGG + Intronic
1044869371 8:96603528-96603550 CTTTAGCAGCAGACAGGGTATGG + Intronic
1045405119 8:101858480-101858502 CTCCAGTATCAGGCTGGGATAGG - Intronic
1047857752 8:128930946-128930968 TTCCAGAAGCAGACAGGGAAAGG - Intergenic
1048885955 8:138909993-138910015 CTGCAGCAGCAGGCAGGGACTGG + Intronic
1049190574 8:141285192-141285214 CTGCTGTTGCAGGCAGGGCAGGG - Intronic
1049357577 8:142196342-142196364 AGCCCGTAGCAGGCAGGGCAAGG + Intergenic
1049483106 8:142836778-142836800 CTCCAGAGGCAGCCAGGGTCAGG - Intronic
1051175102 9:14352727-14352749 CTCCAATAACAGACAGGGAAAGG + Intronic
1052393106 9:27904407-27904429 CTCAAAAAGCAGGCAGGGAAGGG + Intergenic
1052989622 9:34511513-34511535 CCCCACTAGCAAGCAGGGAAAGG + Intronic
1058313373 9:103533739-103533761 GTCCAGGAGCAGGCTGGGTGAGG + Intergenic
1060421498 9:123472693-123472715 CTGCAGAAGCAAGCAGAGTATGG + Intronic
1060663177 9:125416217-125416239 CTCCACTGGCAGGGAGGGGATGG - Intergenic
1061055148 9:128218556-128218578 CTCCAGAAGCGGGCAGGGGAAGG - Intronic
1061271414 9:129545641-129545663 CTCTAGTAGAAGGCAGAGAACGG + Intergenic
1061722969 9:132565061-132565083 ATCCAGTAGCAGGGAGGAAAAGG + Intronic
1062501916 9:136855357-136855379 CTCCAGGGCAAGGCAGGGTAGGG - Intronic
1186881147 X:13867535-13867557 CTCCAGTGACAGGCATGGTGTGG + Intronic
1187484753 X:19692977-19692999 TTCCAGTAGCAGGCCAGGCATGG - Intronic
1193333566 X:80262211-80262233 CTTCAGTAGCTGTCAGGGTTGGG - Intergenic
1193643872 X:84043933-84043955 TTCCACTAGCAGGGTGGGTAGGG + Intergenic
1194229887 X:91308436-91308458 TTGCAGAAGCAGGCAGGGTGAGG + Intergenic
1195396937 X:104421257-104421279 CAGCAGTAGCAGGCAAGGTGGGG + Intergenic
1197882231 X:131178851-131178873 CCACAGAAGCAGGCAGGGTAAGG - Intergenic
1200058020 X:153471651-153471673 CTCCAGGAGATGGCAGGGTAGGG - Intronic
1202115192 Y:21465264-21465286 CTCCAGCTGCAGGCAGAATATGG - Intergenic