ID: 1147705215

View in Genome Browser
Species Human (GRCh38)
Location 17:42421483-42421505
Sequence GATCCCGCCTCCCTGGGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147705205_1147705215 -8 Left 1147705205 17:42421468-42421490 CCCCCTGCCCCACACGATCCCGC 0: 1
1: 1
2: 0
3: 19
4: 248
Right 1147705215 17:42421483-42421505 GATCCCGCCTCCCTGGGGTTAGG 0: 1
1: 0
2: 2
3: 7
4: 121
1147705206_1147705215 -9 Left 1147705206 17:42421469-42421491 CCCCTGCCCCACACGATCCCGCC 0: 1
1: 0
2: 1
3: 20
4: 260
Right 1147705215 17:42421483-42421505 GATCCCGCCTCCCTGGGGTTAGG 0: 1
1: 0
2: 2
3: 7
4: 121
1147705204_1147705215 -7 Left 1147705204 17:42421467-42421489 CCCCCCTGCCCCACACGATCCCG 0: 1
1: 0
2: 1
3: 15
4: 271
Right 1147705215 17:42421483-42421505 GATCCCGCCTCCCTGGGGTTAGG 0: 1
1: 0
2: 2
3: 7
4: 121
1147705207_1147705215 -10 Left 1147705207 17:42421470-42421492 CCCTGCCCCACACGATCCCGCCT 0: 1
1: 0
2: 0
3: 13
4: 172
Right 1147705215 17:42421483-42421505 GATCCCGCCTCCCTGGGGTTAGG 0: 1
1: 0
2: 2
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147705215 Original CRISPR GATCCCGCCTCCCTGGGGTT AGG Intronic
906057624 1:42929159-42929181 ACTGCCTCCTCCCTGGGGTTTGG + Intronic
914386319 1:147172809-147172831 GAGGCCGCCTCCCTGGGCTCCGG + Intergenic
915287568 1:154862632-154862654 GATGCCTCCTCTCTGGGGTCTGG - Intronic
915330264 1:155107227-155107249 GATCCCCCACTCCTGGGGTTGGG - Intergenic
924037598 1:239953157-239953179 GACCCAGCCTCCCTGGTGGTGGG + Intergenic
924212642 1:241786661-241786683 GATCCCTCCTCCCTTAAGTTTGG + Intronic
1067694125 10:48523414-48523436 GGTCCGGCCTCCCGGGGGCTGGG - Intronic
1075063768 10:119275045-119275067 GACCCAGCCTCTCTGGGTTTGGG + Intronic
1076637524 10:131892008-131892030 AATCCCACCTTCCTGGAGTTTGG - Intergenic
1076810612 10:132884635-132884657 CATCTCGCCTTCCTGGGGGTGGG + Intronic
1080457947 11:32432247-32432269 GATTCCTCTCCCCTGGGGTTTGG + Intronic
1081702539 11:45161269-45161291 GATCCCACCTCCATGGGCTGGGG + Intronic
1083192390 11:61061607-61061629 GAGCCCCCCTCCCTAGGGTGGGG - Intergenic
1083272787 11:61580635-61580657 GATCCCGCGCCCCCGGGGCTGGG + Intronic
1083841826 11:65309061-65309083 GCTTCAGCCTCCCTGGGGGTAGG + Intergenic
1083941727 11:65899809-65899831 GATCCCGCCTCCCTCCCGTGTGG + Intronic
1084000346 11:66292397-66292419 GACCCCGCGGCCCTGGGGGTGGG - Intronic
1085470381 11:76753753-76753775 TTTCCCGCCAACCTGGGGTTAGG - Intergenic
1090592938 11:128291500-128291522 GATCCAGCCTCCCTGGATATTGG + Intergenic
1090592948 11:128291558-128291580 GATCCAGCCTCCCTGGATATTGG + Intergenic
1091228164 11:133970595-133970617 CATCCCGCCTGCCTGTGGTAGGG - Intergenic
1091760622 12:3084950-3084972 CCTCCCGCCTCCCTGGGGCCCGG + Intronic
1092147252 12:6223209-6223231 GACTGGGCCTCCCTGGGGTTGGG + Intronic
1093415628 12:18917252-18917274 AATCCTGCCTGCTTGGGGTTGGG + Intergenic
1095739677 12:45593311-45593333 GATCTCCCCTCCCTGGTGTGCGG - Intergenic
1096386497 12:51198196-51198218 TATCCCCCCTCCCTGGGGCCAGG + Intronic
1097177167 12:57149949-57149971 GATCCTGCCTCTCTGGCCTTGGG - Intronic
1102254757 12:111409126-111409148 GTTCCAGCCTCCCCAGGGTTGGG + Intronic
1102678287 12:114673229-114673251 GCTCCCTCCTCCCTGGAGTGGGG + Intronic
1102950274 12:117026484-117026506 GTCCCTGCCTCCCTGGGGTTGGG - Intronic
1106054994 13:26229302-26229324 GGCCCAGGCTCCCTGGGGTTGGG + Intergenic
1106100818 13:26694250-26694272 GATCCTGCCACACTGGGTTTTGG + Intergenic
1106563149 13:30863691-30863713 ATTCCCGTCTCCCTGGAGTTTGG + Intergenic
1118254243 14:64191388-64191410 GATCCCATCTTCCTGGGATTAGG + Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1124204326 15:27704224-27704246 GCGCCTGCCTCCCTGGGTTTGGG + Intergenic
1129704104 15:77784782-77784804 GATCCCTTCTCCCTGGGGTCTGG - Intronic
1129708994 15:77810784-77810806 TTCCCCGCCTCCTTGGGGTTAGG - Intronic
1129882896 15:79018819-79018841 GATCCCACCTCCCTGGGCCTAGG + Intronic
1137057375 16:35752127-35752149 GGTCCTGCCTCGCTGGGGCTTGG + Intergenic
1137463071 16:48683366-48683388 GCTGCTGCCTCCCTGTGGTTTGG + Intergenic
1138141837 16:54575267-54575289 GTTCCAGCCACCCTGGGTTTGGG - Intergenic
1138577334 16:57916344-57916366 GATCCCTCCTCCCTGGGGGCTGG - Intronic
1138624242 16:58236617-58236639 GAACCAGCCTCCCAGGGCTTAGG + Intronic
1141482921 16:84318678-84318700 GATGAAGCCTCCCTGGGGGTGGG + Intronic
1142288980 16:89184094-89184116 GCTCCCACCTCCCTGGGGGCCGG + Intronic
1142400899 16:89858322-89858344 GCTCCCGTCTCCCCAGGGTTTGG + Exonic
1142715659 17:1745582-1745604 GCTCCCTCTTCCCTGGGGCTGGG + Intronic
1143057867 17:4175931-4175953 GACCCCGCCTTCCTGGGGCCCGG - Intronic
1147652349 17:42069716-42069738 GACCCTGCCTCGCTGGGCTTTGG + Intergenic
1147705215 17:42421483-42421505 GATCCCGCCTCCCTGGGGTTAGG + Intronic
1148122575 17:45221723-45221745 CAGCCCGCCCCCCTGGGGCTGGG + Intronic
1148676854 17:49450821-49450843 GAGCCTGCCTTCCTGGGGGTGGG - Intronic
1150226357 17:63526682-63526704 CTTCCCACCTCCCTGGAGTTGGG - Intronic
1152548929 17:81019666-81019688 GCTCCCGCCTCCCCGGAGTGGGG - Intergenic
1157320034 18:46627301-46627323 GTTCCCACCTGCCTGGGGCTGGG - Intronic
1157802015 18:50628369-50628391 GATCTCGCCTCCCTGGGGCCTGG + Intronic
1158618891 18:59013143-59013165 TCTCCCGCCTCCCTGGGGTTAGG + Intergenic
1158664446 18:59420122-59420144 GCCCCAGCCCCCCTGGGGTTGGG - Intergenic
1159908335 18:74119043-74119065 CATCCCGCCTCCCAGGGCCTGGG - Intronic
1161221782 19:3121183-3121205 CATCCCGTCTCCCTGGGCCTGGG - Exonic
1161468161 19:4443602-4443624 GATCCCTCCTGCCCTGGGTTGGG + Intronic
1165059105 19:33196058-33196080 GCACCCACCTCCGTGGGGTTTGG - Intronic
1166231348 19:41427239-41427261 GTTCCCCAGTCCCTGGGGTTGGG - Intronic
1167103568 19:47418489-47418511 GAGCCTGTCTCCCTGGGGATGGG - Intronic
1167446964 19:49543386-49543408 GACAGCCCCTCCCTGGGGTTGGG - Exonic
1167633401 19:50639551-50639573 GATCCCCCCGCGCTGGGGATCGG + Intronic
928176499 2:29037608-29037630 GAGCCCAGCTCCCTGGGGCTGGG + Intronic
929550903 2:42891205-42891227 GATCCCCCTTCACTGGGGTAGGG + Intergenic
932745170 2:74328150-74328172 GTTCTGGCCTCCCTGGGATTTGG - Exonic
933877941 2:86637438-86637460 TCTCCGGCCTCCCTGGAGTTAGG + Intronic
935198591 2:100836283-100836305 GATCCCACCTCTCTGGGATGGGG - Intronic
937424866 2:121790318-121790340 CATCCTCCCTCCCTGGGCTTCGG - Intergenic
946182478 2:217956955-217956977 GATCCCGTCTCCTTAGGGCTGGG - Intronic
946392642 2:219425858-219425880 GATCCTGCGGCCCTGGGGTGGGG + Intronic
948479409 2:238240549-238240571 GACCCTGCCTCCCCGGGGCTTGG - Intronic
1169265179 20:4163042-4163064 GCTCCCTCCACCCTGGGCTTAGG - Intronic
1171337066 20:24394269-24394291 GCTCCCTCCTCCCTGGGATCAGG + Intergenic
1174218239 20:48933459-48933481 GTTCCTGCCTCCCTGGGTTGTGG + Intronic
1174917543 20:54669233-54669255 GAGCCAGCCTGCCTGGGTTTGGG + Intergenic
1175856989 20:62126418-62126440 TATGCCGCCTCCCTGGGTCTAGG + Exonic
1180082661 21:45493847-45493869 GCTCGCGCCTCCCTGGGGCCTGG + Intronic
1184790756 22:46698311-46698333 GATCCTGCCTTCCTGCGGCTCGG - Intronic
1185146580 22:49140212-49140234 GATCCCGAGTCCCTGTGGGTGGG - Intergenic
1185180200 22:49355569-49355591 GAACCTGCCTCGCTGGGATTTGG - Intergenic
1185218113 22:49615177-49615199 CATCCCGCAGCCCTGGGGTGTGG - Intronic
950453112 3:13076594-13076616 GATCCTGAATCCCTGGGATTCGG - Intergenic
954222187 3:49161672-49161694 CATTCCCCCTCCCTGGGGTAGGG - Intergenic
954696345 3:52429256-52429278 GATGCTGTCTCCCTGGGGTCAGG - Intergenic
955275846 3:57546134-57546156 GACCCCGCTACCCTGGGGCTTGG - Intergenic
958780951 3:98541920-98541942 GCTCCCTCCACCCTGGGGATGGG + Intronic
961356593 3:126343519-126343541 GAACCCGCGTCCCTGGGGGCTGG - Exonic
961783217 3:129333826-129333848 GAGCCCCCCTCACTGGGGTGGGG - Intergenic
962750678 3:138432933-138432955 GATCCTGTCTCCAAGGGGTTTGG + Intergenic
963733694 3:148995084-148995106 GATCCCAGCTACTTGGGGTTGGG + Intronic
964693879 3:159485232-159485254 GAGCCAGCCTGCCTGGGGTCAGG + Intronic
966941547 3:184751024-184751046 GAACCTGCCTTCCTGGGTTTTGG + Intergenic
967979760 3:195058776-195058798 GCTCCTGCCTCCCAGGGGTGCGG + Intergenic
969627087 4:8311175-8311197 GACCCCTCCTCCCTGGGCTCTGG + Intergenic
970472211 4:16390055-16390077 GAAACAGACTCCCTGGGGTTGGG - Intergenic
973971861 4:56221002-56221024 AATCCAGCGTCCTTGGGGTTTGG + Intronic
975883569 4:78939267-78939289 GGTCCCGCCTCCCCGGGGAGGGG + Exonic
976402101 4:84619088-84619110 GCTCCCGCCTCCCAAGGGTGAGG + Intronic
983687661 4:170430711-170430733 GATCCAGCTTCCCTGTGGTAGGG + Intergenic
985569312 5:635913-635935 ATTCCCGCCTCCCTGAGGGTTGG + Intronic
986839485 5:11679843-11679865 GATGCCGCCTCCATGAGGTCAGG - Intronic
992125630 5:73637169-73637191 CACCCAGCCTCACTGGGGTTAGG - Intronic
997759476 5:136431325-136431347 TCTCCCTCCTCCCTGGGGCTGGG + Intergenic
998266976 5:140673649-140673671 GACCCCGCCTCCCAGGGGGGTGG + Exonic
999694819 5:154179464-154179486 TACACCGCCTCCCTGGGGTGGGG + Intronic
1002060837 5:176625034-176625056 GACCCTGCCTCCATGGGGATGGG - Intronic
1004217915 6:13719392-13719414 GAGACTGCATCCCTGGGGTTTGG + Intergenic
1004460894 6:15834829-15834851 ACTACAGCCTCCCTGGGGTTAGG - Intergenic
1004782077 6:18920453-18920475 GATCCAGCTTCCCTGGCTTTTGG - Intergenic
1006452297 6:34112268-34112290 GATGCTGCCTCCCTGGGGCGGGG - Intronic
1006913440 6:37579040-37579062 CATCCTACCTCCCTGGGGTGAGG + Intergenic
1007072818 6:39049128-39049150 GAGGGCGCCTCGCTGGGGTTGGG - Intronic
1007230756 6:40346059-40346081 GGTTCCGCCTGCCTGGGGTCAGG + Intergenic
1019183368 6:170207011-170207033 TACCCAGCCTCCCTGGGGTTGGG + Intergenic
1019385692 7:754872-754894 GATCCCGCCTCTGTGGTGTGCGG + Intronic
1022336311 7:29425162-29425184 GACCCAGCCCCCCTGCGGTTGGG + Intronic
1022639183 7:32165324-32165346 GAGACCCCCTTCCTGGGGTTTGG - Intronic
1024004751 7:45217124-45217146 GATCACTCCTTCCTGGGGTTCGG - Intergenic
1024149586 7:46557427-46557449 AATCCAGCCTCCCTGGGTTCAGG - Intergenic
1033809883 7:145000513-145000535 GATCCCAGCTACCTGGGGGTGGG - Intergenic
1035747400 8:1972299-1972321 TATCCCGCCACCCTGGGGTTGGG - Intergenic
1037707891 8:21331064-21331086 AATCCCTTCTCCCTGGGATTTGG - Intergenic
1048534270 8:135277720-135277742 CATCCCTCCAGCCTGGGGTTGGG + Intergenic
1061614480 9:131770929-131770951 GATATAGGCTCCCTGGGGTTGGG - Intergenic
1189160803 X:38805922-38805944 CCTCCCGCCGCCCTGCGGTTGGG + Exonic
1201240835 Y:11955236-11955258 GACCCCGCGTCCCGGGGATTAGG + Intergenic