ID: 1147710706

View in Genome Browser
Species Human (GRCh38)
Location 17:42462120-42462142
Sequence TGGGAGGATCGCTGAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102195
Summary {0: 9, 1: 362, 2: 5645, 3: 30290, 4: 65889}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147710702_1147710706 -1 Left 1147710702 17:42462098-42462120 CCAGCTGCTTGGGAAGCTAAGGT 0: 5
1: 170
2: 3084
3: 29059
4: 146728
Right 1147710706 17:42462120-42462142 TGGGAGGATCGCTGAAGCCCAGG 0: 9
1: 362
2: 5645
3: 30290
4: 65889
1147710696_1147710706 27 Left 1147710696 17:42462070-42462092 CCGGATGTGGTGGCACATGGCTG 0: 3
1: 367
2: 5465
3: 23610
4: 66981
Right 1147710706 17:42462120-42462142 TGGGAGGATCGCTGAAGCCCAGG 0: 9
1: 362
2: 5645
3: 30290
4: 65889
1147710700_1147710706 0 Left 1147710700 17:42462097-42462119 CCCAGCTGCTTGGGAAGCTAAGG 0: 7
1: 603
2: 12838
3: 122415
4: 248052
Right 1147710706 17:42462120-42462142 TGGGAGGATCGCTGAAGCCCAGG 0: 9
1: 362
2: 5645
3: 30290
4: 65889

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147710706 Original CRISPR TGGGAGGATCGCTGAAGCCC AGG Intronic
Too many off-targets to display for this crispr