ID: 1147715722

View in Genome Browser
Species Human (GRCh38)
Location 17:42506833-42506855
Sequence GGCACGTGGGCAGACGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147715722_1147715728 25 Left 1147715722 17:42506833-42506855 CCATCAGCGTCTGCCCACGTGCC 0: 1
1: 0
2: 1
3: 5
4: 133
Right 1147715728 17:42506881-42506903 AGAGCTGTCTGCTGAAGAAAAGG 0: 1
1: 0
2: 2
3: 42
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147715722 Original CRISPR GGCACGTGGGCAGACGCTGA TGG (reversed) Intronic
901854988 1:12038867-12038889 GGCACGTGGTCTGACGGGGAGGG + Intergenic
902055899 1:13600174-13600196 GGCACCTGGGCAGAAGGGGAAGG + Intronic
902510935 1:16966567-16966589 GCCAGGTGGGCAGGAGCTGAGGG + Exonic
903274304 1:22210945-22210967 TGCCCCTGGGCAGAGGCTGAGGG + Intergenic
906300540 1:44678303-44678325 GGCAAGTGGGGAGAAGATGAAGG + Intronic
911687773 1:100796820-100796842 AGCAAGTGGGGAGATGCTGATGG + Intergenic
912525937 1:110282602-110282624 GGCATGTGGCCAGAGGCTGGAGG + Intronic
912831404 1:112956675-112956697 GGCACCCGGGAAGACGCTGGGGG + Intronic
921595319 1:217048219-217048241 GGGACAAGGGCAGTCGCTGACGG + Intronic
1065795818 10:29307263-29307285 GGAAAATGGGGAGACGCTGATGG - Intronic
1065945791 10:30604754-30604776 GGCATGGTGGCAGACGCTGGAGG - Intergenic
1067414248 10:46091657-46091679 GCCACGTGAGCAGAGGCAGAGGG + Intergenic
1067434297 10:46266171-46266193 GCCACATGGGCAGAGGCAGAGGG + Intergenic
1067439397 10:46300157-46300179 GCCACGTGAGCAGAGGCAGAAGG - Intronic
1067581644 10:47450226-47450248 GCCACGTGAGCAGAGGCAGAGGG - Intergenic
1068865504 10:61890791-61890813 AGAAAGTGGGCAGACCCTGATGG - Intergenic
1069909891 10:71752555-71752577 GCCACAAGGGCAGAGGCTGAGGG - Intronic
1073101900 10:101010777-101010799 GGCACTTGGGGAGACCTTGAGGG + Intronic
1075083473 10:119398959-119398981 GGCACTGGGGCAGCCACTGAGGG + Intronic
1076114364 10:127885150-127885172 GACCCGTGGGCATATGCTGAGGG - Intronic
1076170128 10:128312225-128312247 GTCACTTGGGCAGAAGATGACGG + Intergenic
1076988629 11:257409-257431 GGCAGGTGGGAAGAGGTTGAAGG - Intergenic
1078191502 11:9095299-9095321 GGCAGCTGGGCTGAGGCTGAGGG + Intronic
1079110274 11:17601492-17601514 GGGAGGTGGGCAGGGGCTGAGGG + Intronic
1079330444 11:19528519-19528541 GGCAGGTGGGCAGAGGCGGCTGG + Intronic
1080002229 11:27363056-27363078 CGCACGTGGGCAGGGGCTGGAGG - Exonic
1082808060 11:57462364-57462386 GGCCTGCGGGCAGATGCTGAGGG - Intronic
1084087660 11:66861961-66861983 GGCACGTGGGGAGCTGCTGAGGG + Intronic
1084546190 11:69816284-69816306 GTCACGTGGGTGGGCGCTGACGG - Intronic
1090852673 11:130584191-130584213 GGAATGGGGGCAGATGCTGAGGG + Intergenic
1091871895 12:3898894-3898916 GACAAGTGGACAGAGGCTGAAGG + Intergenic
1092045619 12:5430418-5430440 GGCACGAGGGGAGCCACTGAAGG + Intergenic
1095321662 12:40835894-40835916 GGCACTAGGCCAGACACTGAGGG + Intronic
1096216714 12:49801762-49801784 GGCACGTGAGAAGACAGTGATGG + Intronic
1098444242 12:70550100-70550122 GGAATGTAGGCAGACGGTGATGG + Intronic
1104255004 12:127128265-127128287 TGCACGTGCGCTGAGGCTGAGGG + Intergenic
1106019933 13:25904871-25904893 GGCAATTTGGCAGACACTGAGGG - Intronic
1109903183 13:68801432-68801454 CGCATGTGAGCAGATGCTGAGGG - Intergenic
1112614477 13:100989016-100989038 GCCACGTGGCAAGATGCTGAGGG + Intergenic
1112701869 13:102019354-102019376 GGCAGGTGGGTAGACACAGAGGG - Intronic
1113867663 13:113538328-113538350 GGCAGGTGGGCAGAGTCAGAGGG - Intronic
1113940325 13:114015412-114015434 GGCGCGTGGGGAGGGGCTGAGGG + Intronic
1114219148 14:20681978-20682000 AGGGCGTGGGCAGAGGCTGACGG - Intergenic
1114620667 14:24094383-24094405 GGCACCTGGGCAGGGGCTGCGGG - Exonic
1120966393 14:90171252-90171274 GGCACATGGGTAGACTATGAAGG + Intronic
1123042255 14:105495233-105495255 GGCAGGAGGGCAGAGGCTCAGGG + Intronic
1124093518 15:26628376-26628398 GCCACATGGGCAGCCCCTGAGGG - Intronic
1126105962 15:45147409-45147431 TGCACTTGGGCAGAAGCAGAGGG - Intronic
1130710713 15:86278351-86278373 GCCATGTTGGCAGAAGCTGAGGG + Intronic
1132001210 15:98181835-98181857 GGCACATGGGCAGGGGCTGGTGG + Intergenic
1132303275 15:100789542-100789564 GGCAGGAGGGCAGACACTGAGGG - Intergenic
1132663415 16:1071383-1071405 GGATGGTGGGCAGAGGCTGAGGG + Intergenic
1132725930 16:1338377-1338399 GGCACCTGGTCAGGCGGTGAGGG - Intronic
1135052545 16:19204412-19204434 GACACGAGGGCAGAGGGTGAGGG + Intronic
1138555658 16:57769904-57769926 GGCCCATGGGCAGATGCTGGAGG - Exonic
1139476193 16:67203625-67203647 GGCAGATGGGCAGACCCTCACGG + Intronic
1141764048 16:86047051-86047073 GGCTGCTGGGCAGCCGCTGAGGG + Intergenic
1142180038 16:88663834-88663856 GGCCCGAGGGCAGGCGCTGGAGG + Intergenic
1142249004 16:88982659-88982681 GGGAGGTGGGCAGCCACTGAAGG - Intergenic
1144831384 17:18133201-18133223 TGCATGAGGGCAGAGGCTGAGGG - Intronic
1147715722 17:42506833-42506855 GGCACGTGGGCAGACGCTGATGG - Intronic
1147988957 17:44321857-44321879 GGGCTGTGGGCAGAGGCTGAGGG - Intronic
1148603094 17:48908711-48908733 GCCCCGTGGGCAGCGGCTGAGGG - Exonic
1152276429 17:79360454-79360476 GGCACCTTTGCAGAAGCTGACGG - Intronic
1152570335 17:81118877-81118899 GGCACGTGGGCAGAGGCTGTAGG + Intronic
1153006930 18:505213-505235 GGAACTTGGGCAGAGCCTGATGG + Intergenic
1155704203 18:28787844-28787866 GACAGGTGGGAAGAAGCTGAGGG - Intergenic
1160428419 18:78794147-78794169 GCCTCGTGGGGAGATGCTGAAGG - Intergenic
1160565500 18:79784422-79784444 GGAACGAGGGCCGAGGCTGATGG + Intergenic
1161226710 19:3150311-3150333 GGCGCGTGGGGAGGGGCTGAGGG + Intronic
1163458081 19:17420435-17420457 GGGAGGTGGGCAGACCCTGGTGG - Intronic
1163636502 19:18439267-18439289 GGGTCTTGGGCAGACCCTGAGGG + Intergenic
1165522246 19:36323830-36323852 GGCTCCAGGGCAGATGCTGAGGG - Intergenic
1166494129 19:43286183-43286205 ACCAGGTGGTCAGACGCTGAAGG - Intergenic
1166977629 19:46614046-46614068 GGCCCCTGGGCAAGCGCTGAGGG + Intergenic
1167467925 19:49659818-49659840 GGCACGTGGGCACAACCTGCAGG + Exonic
925499753 2:4489594-4489616 GGCATGTGGGAGGACCCTGATGG - Intergenic
930850285 2:55952657-55952679 GGTACATGGGCAGCCTCTGATGG + Intergenic
933820075 2:86103207-86103229 GGAACTTGGGCAAAGGCTGAAGG + Intronic
936017548 2:108971135-108971157 GGCAGGCGGTCAGACCCTGATGG + Intronic
938071290 2:128309804-128309826 GGCACGCGGACAGCTGCTGACGG + Intronic
938139999 2:128787454-128787476 GGGAAGTGGGGAGAGGCTGAAGG - Intergenic
947633721 2:231669573-231669595 ACCACGAGGACAGACGCTGAAGG - Intergenic
948638844 2:239360424-239360446 GGTGCCTGGGCAGACCCTGAAGG - Intronic
949026787 2:241770135-241770157 GGGACGCGGGCACACGCTGTGGG - Intergenic
1169914931 20:10674583-10674605 GCGACCTGGGCAGACGCTGCTGG + Intergenic
1170143379 20:13147504-13147526 GGCAAGGGGGCAGAGGGTGATGG - Intronic
1179310009 21:40186835-40186857 GGCATGTGGGCAGTGGCTGATGG - Intronic
1180099514 21:45578011-45578033 GTCACGTGGGCAGGATCTGAGGG - Intergenic
1180127379 21:45801538-45801560 AGCACCTGGCCAGACGCTGTGGG - Intronic
1181583582 22:23841199-23841221 GGCTCGTGGGGAGAAGGTGAGGG + Intergenic
1184058335 22:42067069-42067091 GGCACGTAGGCAAACGGGGAGGG - Intronic
1184711716 22:46254461-46254483 GCCACGTGGGCAGAGGCGGTAGG - Intergenic
1185146300 22:49138679-49138701 GGCAGGTGGGCAAATGGTGAAGG - Intergenic
1185205461 22:49535648-49535670 GGAGGGTGGGCAGAGGCTGAGGG + Intronic
949534232 3:4983441-4983463 GGCAGGTAGGCAGTCGCTGAAGG - Exonic
950485824 3:13273581-13273603 AGCACGTGGGCTGGGGCTGAAGG - Intergenic
952119161 3:30220737-30220759 GGGAGGTGAGCAGACGCTGCAGG + Intergenic
956964529 3:74443472-74443494 GGCTGGTGGGCAGCCACTGAAGG - Intronic
959928538 3:111953276-111953298 GGCATGTCGGCAGAACCTGAGGG - Intronic
960638580 3:119807458-119807480 GGCACGTGGGTGAAGGCTGATGG - Intronic
968593116 4:1469481-1469503 GGGAGGTGGGCAGAAGCTGTGGG + Intergenic
969265815 4:6063517-6063539 GGCACTTGGGCTGAGGCTGGTGG + Intronic
969507858 4:7599241-7599263 GGCAGGGGAGCAGAGGCTGAAGG - Intronic
969848000 4:9934807-9934829 GGCCTGTGGGCAGGGGCTGAGGG - Intronic
992061333 5:73050853-73050875 GGCATGTTGGCAGACATTGATGG + Intronic
992990440 5:82278156-82278178 GGCACGTGGTCCGGCGCGGAAGG - Intronic
995380718 5:111530492-111530514 GTGACGTGGGCAGACACAGAGGG - Intergenic
995591100 5:113700314-113700336 GGCACCAGGGCACAAGCTGAGGG - Intergenic
999708423 5:154294851-154294873 GGGAGATGGGCAGAAGCTGAAGG + Exonic
1002436686 5:179235874-179235896 GGCACTTGGCCAGATGCAGAGGG - Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1006026599 6:31150937-31150959 GGTAGGTGGGCGGACGCCGACGG - Exonic
1006420657 6:33931780-33931802 GCCATGTGGGAAGACGCGGAGGG - Intergenic
1007812881 6:44498670-44498692 GGCCCGAGGGCAGAGGCTTAAGG + Intergenic
1011189893 6:84717610-84717632 GGCAGGGGGGTAGACTCTGAGGG + Intronic
1013588723 6:111602506-111602528 GGAAAGTGGGGAAACGCTGAAGG + Intronic
1016656037 6:146519525-146519547 GGCACCTGGCTAGACACTGAGGG - Intergenic
1019372300 7:668982-669004 GTCTCCTGGGCAGATGCTGATGG - Intronic
1022286683 7:28960377-28960399 GGAAGGTGAGCAGACGCTCAAGG + Intergenic
1022577690 7:31514116-31514138 GGCAGGTGGGTAGAGGCTGCTGG + Intronic
1028895438 7:96036025-96036047 GGCACATGGCTAGACCCTGAAGG - Intronic
1029711286 7:102301324-102301346 GGCACCTGGGCAGCAGCTGAGGG + Intronic
1034189379 7:149201990-149202012 GGCACCTCAGCAGACCCTGATGG - Intronic
1035728005 8:1836473-1836495 GCCACGTGGGCTGACGCCGGTGG + Intronic
1037987008 8:23296335-23296357 TGCAGGTGGGCAGCTGCTGAAGG + Intergenic
1040547222 8:48408064-48408086 GCCAGGTGGGCAGCCGCTGCAGG - Intergenic
1047173393 8:122516740-122516762 GTCAAGTTGGCAGCCGCTGAAGG + Intergenic
1047692379 8:127369212-127369234 GGCACATGGGCTGAGGCTGTTGG - Intergenic
1048165699 8:132059491-132059513 GGCAGGTGGGCTGCCTCTGAAGG + Intronic
1051403191 9:16705544-16705566 GGCTCTTGGGCAGACGCCAAAGG + Intronic
1052311852 9:27076145-27076167 GGCACGTGTGGAGACCCTGGAGG - Intergenic
1053124602 9:35569873-35569895 GGCATGTGTGCAGACCATGATGG + Intergenic
1055368650 9:75573293-75573315 GGCAAGTGGCCAGAAGTTGATGG + Intergenic
1061237704 9:129352122-129352144 GGCAAGTGGGAGGACGCAGATGG - Intergenic
1062088497 9:134661419-134661441 GTCCTGTGGGCAGATGCTGACGG + Intronic
1062115454 9:134805882-134805904 GCCCCGTGGGCAGACCCTCAAGG + Intronic
1187274909 X:17808643-17808665 GGCACATGGGGAGACACTGCGGG - Intronic
1197821577 X:130546358-130546380 GGAATGTGAGCAGATGCTGAAGG + Intergenic
1198683372 X:139204429-139204451 CGCAGGCGGGCAGAAGCTGAGGG - Intronic