ID: 1147717222

View in Genome Browser
Species Human (GRCh38)
Location 17:42516570-42516592
Sequence AAACCCAGGGCTCAAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147717222_1147717232 27 Left 1147717222 17:42516570-42516592 CCTGTCTCTTGAGCCCTGGGTTT 0: 1
1: 0
2: 3
3: 13
4: 222
Right 1147717232 17:42516620-42516642 TTCCAGCCCACGTGGGTAGCCGG 0: 1
1: 0
2: 0
3: 11
4: 91
1147717222_1147717229 19 Left 1147717222 17:42516570-42516592 CCTGTCTCTTGAGCCCTGGGTTT 0: 1
1: 0
2: 3
3: 13
4: 222
Right 1147717229 17:42516612-42516634 CACCTTGATTCCAGCCCACGTGG 0: 1
1: 0
2: 1
3: 8
4: 113
1147717222_1147717230 20 Left 1147717222 17:42516570-42516592 CCTGTCTCTTGAGCCCTGGGTTT 0: 1
1: 0
2: 3
3: 13
4: 222
Right 1147717230 17:42516613-42516635 ACCTTGATTCCAGCCCACGTGGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147717222 Original CRISPR AAACCCAGGGCTCAAGAGAC AGG (reversed) Intronic
900478050 1:2885286-2885308 AAGCCCTGGGCCCAAGAAACAGG + Intergenic
900836626 1:5009884-5009906 AAACACAGTGCTCCAGGGACTGG - Intergenic
901096034 1:6680947-6680969 AGACCCAGAGCTCAAGTCACAGG - Exonic
903064970 1:20694439-20694461 ACACACATGGCTCAAGAGAAGGG + Intronic
903862204 1:26371374-26371396 AACTCCTGGGCTCAAGAGATGGG - Intronic
904768916 1:32870438-32870460 AAACCCAGGGCTGAGGTGACAGG + Intronic
905378973 1:37546170-37546192 ATACACAGGGCTCAAGTGAGGGG + Intronic
905891440 1:41520978-41521000 AGACCCAGGTCTCAAGACTCGGG + Intronic
911244244 1:95499060-95499082 AAACCCAGGGCTCTAGAGTTTGG + Intergenic
911373081 1:97017764-97017786 CAACCCAAGACTAAAGAGACAGG + Intergenic
912692983 1:111818655-111818677 AAACTCAGGGGACAATAGACGGG - Intronic
912703173 1:111893700-111893722 CAACCCAGGGCCCAAGTGACAGG + Intronic
913966701 1:143382787-143382809 AAGCCCAGGCCTTAGGAGACAGG - Intergenic
914061078 1:144208394-144208416 AAGCCCAGGCCTTAGGAGACAGG - Intergenic
914118072 1:144757975-144757997 AAGCCCAGGCCTTAGGAGACAGG + Intergenic
914850321 1:151309367-151309389 GACCCCAGGCCTCAAGAGAGAGG + Intronic
917675236 1:177312412-177312434 AAACATATGGCTCAAGAGATGGG + Intergenic
917967011 1:180185332-180185354 GAACCCAGGTCTCAAGAGACAGG + Intronic
918037970 1:180894053-180894075 AAGCCCAGGGCTTAATAGAGTGG + Intergenic
920457413 1:206111735-206111757 CAACTCATGGCTCAAGAGAAGGG + Intronic
922346975 1:224704412-224704434 AAACCCAGGGATCCAGAGGCAGG + Intronic
922616587 1:226964636-226964658 TAAACCAGGGCGCAAAAGACAGG - Intronic
924775968 1:247114648-247114670 AAGCCCAGGCCTCAACAGGCAGG + Intergenic
1064659110 10:17587842-17587864 AAAACCTGGGCTCAACAGAAAGG - Intergenic
1065228739 10:23574960-23574982 AAGTCCAGGGATCAAGATACTGG + Intergenic
1066981599 10:42421667-42421689 AATCCCAGGGATACAGAGACTGG - Intergenic
1068868304 10:61917781-61917803 AAAGCCAGGGCTCTGGAGTCTGG + Intronic
1070602291 10:77874137-77874159 AAGCCAGGGGCTCAAGAGCCTGG + Intronic
1070904838 10:80062927-80062949 AAACCCTGGGATCAACAGAAAGG + Intergenic
1071561938 10:86651903-86651925 AATCCCAGGTCTCAAGAGGCCGG + Intergenic
1071874784 10:89833458-89833480 AAAACCAGGGAGCAAGTGACAGG - Intergenic
1073002599 10:100296747-100296769 AAACACAGGGCTCAGATGACAGG + Intronic
1073573951 10:104605404-104605426 AGGCCCAGGCCTTAAGAGACTGG - Intergenic
1073918092 10:108429209-108429231 AAAACCAGGGCACCAGAGAGGGG + Intergenic
1073956390 10:108876478-108876500 AAACTCAGCCCTCTAGAGACAGG + Intergenic
1074099290 10:110341724-110341746 AATCCCAAGGCTCAAGGAACAGG + Intergenic
1075209241 10:120476910-120476932 AAACACAGTGCTCTAAAGACAGG - Intronic
1075415873 10:122263784-122263806 AAACCCACGGCACATGAAACAGG - Intergenic
1075438915 10:122463959-122463981 AGTCCCAGGGCTGAAGAGGCTGG + Intronic
1076692867 10:132232676-132232698 AAGCCCAGGGCTCCGGAGCCCGG - Intronic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1079970518 11:27030541-27030563 AGACACAGGGCTCAAGATAGAGG + Intergenic
1080649375 11:34209997-34210019 AAACCCAGTTCTCAGAAGACTGG + Intronic
1082142671 11:48628272-48628294 AAACACAGGGAACAAGAAACAGG - Intergenic
1083255057 11:61490649-61490671 TAACCCAGGGCTTGAGAGGCAGG - Intronic
1083477308 11:62922785-62922807 AAGCCCAGGGCTCTGGAGTCTGG + Intergenic
1085454691 11:76659164-76659186 AAGCCCAGGGCTCCAGAGCTCGG - Exonic
1088680895 11:112240638-112240660 AAATGCAGAGCTCTAGAGACAGG - Intronic
1089146191 11:116331119-116331141 AAACCCAGGTCTCCGGAGATGGG + Intergenic
1091762478 12:3096225-3096247 AAACCCAGTGCTGTAGGGACTGG + Intronic
1091990005 12:4947568-4947590 GAGCCCTGGGCTCAAGTGACAGG + Intergenic
1093140589 12:15506304-15506326 AAAGCAATGACTCAAGAGACAGG + Intronic
1094480790 12:30879944-30879966 GAACCCAGGTCTGGAGAGACTGG - Intergenic
1095991188 12:48035702-48035724 CAACCCAGAGCTCAGGACACAGG + Intergenic
1098405728 12:70123887-70123909 AACCCCAGGGCTCATCAGTCAGG - Intergenic
1099549866 12:84030379-84030401 AAACCTATGGGTCAAAAGACAGG - Intergenic
1099905928 12:88769889-88769911 GAACCCAGGCCTTAAGAAACTGG - Intergenic
1102877439 12:116459003-116459025 GAACCCAGGGCTCCACAGAAAGG - Intergenic
1104654596 12:130564312-130564334 AAACACAGTGCTGAAAAGACTGG - Intronic
1105559789 13:21479788-21479810 AAACCCAGGACTCAAAAGGCTGG + Intergenic
1108544276 13:51475845-51475867 GAACCAAGGGCTCAAGAGTCAGG - Intergenic
1111145381 13:84171246-84171268 AGACCCAGGGCTCAAATGAGAGG - Intergenic
1111224919 13:85256754-85256776 AGCTCCACGGCTCAAGAGACAGG + Intergenic
1113950780 13:114069890-114069912 AGACTCAGGGGTCAGGAGACTGG + Intronic
1114586353 14:23817431-23817453 GAACCCAGGGCTCATGAGGAAGG - Intergenic
1118845447 14:69544634-69544656 ACACAAAGGGCTCAGGAGACTGG - Intergenic
1120841125 14:89085848-89085870 AAGTGCAGGCCTCAAGAGACAGG + Intergenic
1121639884 14:95478227-95478249 AAACACAGGACTTAAGAGGCAGG + Intergenic
1121649220 14:95544845-95544867 AAGCACAGGGCTCCAGAGATAGG - Intergenic
1122272476 14:100574350-100574372 AGACCCAGGGCTCAGGTCACAGG - Intronic
1124404757 15:29383092-29383114 AGACAAAGGGCTCAGGAGACAGG - Intronic
1125538999 15:40459055-40459077 AGACCCAGCTCCCAAGAGACTGG + Exonic
1127383766 15:58451189-58451211 AGACCCAGGCCTCGAGTGACAGG + Intronic
1127744941 15:61958607-61958629 AAACCAAGAGTACAAGAGACAGG - Exonic
1128706358 15:69839945-69839967 AGTCCTAGGTCTCAAGAGACTGG - Intergenic
1128737932 15:70063974-70063996 AAACCCAGGGCTAAGGACCCAGG - Intronic
1129173122 15:73820143-73820165 AACTCCTGGGCTCAAGAGATTGG - Intergenic
1129884176 15:79027020-79027042 AATCCCAGGGCTACAGAGAAGGG + Intronic
1131379021 15:91948629-91948651 AAACACAGGGCACCAGAGAGTGG - Intronic
1131890339 15:96965521-96965543 ATTCCCAGGACTCAGGAGACTGG + Intergenic
1134138365 16:11695807-11695829 AAGCCCTGGGCTCAAGCGATCGG - Intronic
1135356132 16:21770646-21770668 AAACCCAGGTCTCAAGGCAAAGG - Intergenic
1135454622 16:22586785-22586807 AAACCCAGGTCTCAAGGCAAAGG - Intergenic
1136098363 16:27974946-27974968 AAACCCAGGTCTGAAGGGGCAGG + Intronic
1136228870 16:28875679-28875701 AAACCTTGGCCTCAGGAGACTGG + Intergenic
1136925622 16:34370685-34370707 AAACTCAGGGCTTTAGACACAGG + Intergenic
1136978952 16:35041121-35041143 AAACTCAGGGCTTTAGACACAGG - Intergenic
1137627792 16:49920624-49920646 AAGCCCAGGGCTCCAGAGACTGG + Intergenic
1139439704 16:66960014-66960036 GCACCCAGAGCTGAAGAGACAGG - Intergenic
1140984442 16:80144491-80144513 AGACCTAGAGATCAAGAGACTGG - Intergenic
1141922737 16:87146835-87146857 TAAGCCAGGCCTCAAGAGACAGG - Intronic
1143046504 17:4084887-4084909 AAGCCCAAGGCTCAAGTGATTGG - Intronic
1143065478 17:4243887-4243909 TAACTCAGGGCTCCAGTGACAGG - Intronic
1143256095 17:5559129-5559151 ACACCCAGGGCACAAGACACAGG + Exonic
1143451138 17:7037385-7037407 AAGCCCAGGGCTAATGGGACTGG + Intronic
1144870084 17:18363795-18363817 AATCCCACGGCCCAAGCGACAGG - Intergenic
1146832612 17:36082668-36082690 GAAACCGGGGCTCATGAGACAGG + Intergenic
1147717222 17:42516570-42516592 AAACCCAGGGCTCAAGAGACAGG - Intronic
1148159515 17:45442008-45442030 GGAGCCAGGGCTCAGGAGACAGG - Intronic
1150390850 17:64789095-64789117 GGAGCCAGGGCTCAGGAGACAGG - Intergenic
1151353654 17:73546010-73546032 GACCCCAGGGCTCAAAAGATGGG + Intronic
1153049882 18:892088-892110 TAATTCTGGGCTCAAGAGACAGG + Intergenic
1153912373 18:9715367-9715389 AGACCCAGTGCTAGAGAGACAGG - Intronic
1155342859 18:24830435-24830457 AAACCCACAGCTCAAGAACCAGG - Intergenic
1158679661 18:59555903-59555925 AAACCCACAGCTCAGGAGATTGG + Intronic
1158944009 18:62432676-62432698 AAACCCAGAGCTCCACTGACCGG + Intergenic
1160500694 18:79400089-79400111 ACCCCCAGGGCACAAGAGGCCGG + Intronic
1162448922 19:10742625-10742647 AAACCTTGGACTCCAGAGACAGG - Intronic
1164325923 19:24191627-24191649 CAACACAGGGCTCAAGACATAGG - Intergenic
1164540804 19:29120254-29120276 ACACCCAGGGCTCAAGAGTCCGG - Intergenic
1166420693 19:42633794-42633816 GAACCCAGGGTGCAAGAGAGTGG - Intronic
1166496264 19:43305297-43305319 GAACCCAGGGACCAAGAGAGTGG - Intergenic
1167045416 19:47046307-47046329 AAAGCCAGGGTTGAGGAGACAGG + Intronic
1202700485 1_KI270712v1_random:160282-160304 AAGCCCAGGCCTTAGGAGACAGG - Intergenic
929584976 2:43107835-43107857 TAGCCCAGGGGTCAAGAGCCTGG + Intergenic
931141218 2:59460126-59460148 AAATCCAGGGCTCAAAGGAGAGG + Intergenic
932173527 2:69578668-69578690 AAACGATGGGCTCTAGAGACAGG - Intronic
932474525 2:71993744-71993766 AAACACAGGGCTTATGAGCCTGG - Intergenic
932779747 2:74552784-74552806 AGCCCCAGGGACCAAGAGACAGG + Intronic
933730380 2:85451780-85451802 AAACCCAGAGTTCAGGGGACAGG - Intergenic
934171413 2:89543755-89543777 AAGCCCAGGCCTTAGGAGACAGG - Intergenic
934281722 2:91618073-91618095 AAGCCCAGGCCTTAGGAGACAGG - Intergenic
935112609 2:100105971-100105993 AAACCCTGGGTGCAAGTGACGGG + Intronic
936448438 2:112615355-112615377 AAACTCAGGGATCAGGAGAGAGG - Intergenic
936520207 2:113207196-113207218 AAACCCCTGGCTCTAGTGACTGG - Intronic
937939582 2:127274717-127274739 AAACCTGGGTCTCAAGAGTCAGG - Intronic
938014046 2:127852467-127852489 AACTCCTGGCCTCAAGAGACTGG + Intronic
938386738 2:130872218-130872240 AAACACAGGGCTCAAGCTTCAGG + Intronic
938678749 2:133666941-133666963 AAAACCAGGGCTAAAGAGGAAGG + Intergenic
941104161 2:161333514-161333536 AAACCCAGGGCTCTGGAGTTAGG + Intronic
945444518 2:209920302-209920324 TCACACAGGGTTCAAGAGACAGG - Intronic
945883907 2:215354649-215354671 AAATAAAGGGCTCAATAGACAGG - Intergenic
946107899 2:217388125-217388147 GATCCCAGGGCCCCAGAGACAGG + Intronic
947716480 2:232341776-232341798 AGGCCCAGGCCTTAAGAGACTGG + Intronic
949037598 2:241824355-241824377 AAGCCCCGGGCTGAAGGGACCGG - Intergenic
1168758182 20:330263-330285 CAACAGAGGGTTCAAGAGACTGG + Intergenic
1169121665 20:3100313-3100335 ACGCCCAGGGGTCAAGAGAACGG + Intergenic
1170012837 20:11746388-11746410 AAACTCAGGGATGAAGAGGCAGG - Intergenic
1172449804 20:35013925-35013947 AAACCCTGGGCTCATACGACTGG + Intronic
1172624886 20:36341276-36341298 AAAACCAGGGGTCAAGACAAAGG - Intronic
1172879768 20:38192203-38192225 AACTCCTGGGCTAAAGAGACAGG - Intergenic
1173026376 20:39311040-39311062 CAGCCCAGGGCTGAGGAGACCGG - Intergenic
1173124624 20:40325276-40325298 AAAACCAGAGCTCAGAAGACTGG + Intergenic
1173745979 20:45437332-45437354 TAATCCTGGGCTCAAGAGAGAGG + Intergenic
1173960995 20:47072358-47072380 AAACCCAGGGACTAAGAGGCAGG - Intronic
1174273325 20:49385237-49385259 ATACCCAGGGATCAGGAGACAGG + Intronic
1175518668 20:59585587-59585609 AAACCCAGGGCAGCAGTGACTGG + Intronic
1175957809 20:62620711-62620733 ACACCGAGGGCACAAGAGCCTGG + Intergenic
1179289913 21:40009421-40009443 AAAGCCTCTGCTCAAGAGACAGG + Intergenic
1180976815 22:19853278-19853300 AGACCCTGGGCACAAGTGACTGG - Intronic
1181336173 22:22131523-22131545 TTACACAGGGCTCTAGAGACTGG + Intergenic
1182228468 22:28818422-28818444 GAACCCAGGGCTCCTGAGATGGG + Intergenic
1182519753 22:30878688-30878710 AAACCCAGGGACCAAGAGTGCGG - Intronic
949097205 3:99671-99693 AAATGCAAGGCTGAAGAGACGGG - Intergenic
951843159 3:27056877-27056899 AAACCCAAGCCAGAAGAGACTGG - Intergenic
953829931 3:46287636-46287658 AACTCCTGGGCTCAAGAGATGGG + Intergenic
954236854 3:49263583-49263605 AACCCCTGGGCTCAAGTGATCGG + Intergenic
955571783 3:60314968-60314990 ATGCCCAGGCCTCAAGAAACTGG + Intronic
961031918 3:123613658-123613680 AAACCCAGTTCTCTAGAGTCAGG + Exonic
965788569 3:172362965-172362987 AAACGCAGGGCTCAAGTCAAAGG - Intronic
968213719 3:196869941-196869963 AAACCCAGTGCTCTATACACAGG + Intronic
969028342 4:4192133-4192155 AAGCCCAGGCCTTAGGAGACAGG + Intronic
970698761 4:18709967-18709989 AAGCCCAGAGCTGAGGAGACAGG - Intergenic
973271882 4:48269979-48270001 CCACCCAGGGCCCAAGCGACCGG - Intergenic
973610561 4:52632487-52632509 AAACTCAAGACTTAAGAGACAGG + Intronic
974859107 4:67497754-67497776 AACTCCTGGGCTCAAGTGACCGG + Intronic
975855396 4:78619042-78619064 AACCCCAGAGCCCAAGAAACGGG - Intergenic
976072468 4:81257590-81257612 AACCACTGGGCTCAAGAGCCTGG + Intergenic
978434970 4:108674510-108674532 AAACCCATGGATGAAGAGAATGG + Intergenic
979438184 4:120719998-120720020 CAACCCAGCGCTCCAGGGACTGG + Intronic
985872356 5:2567253-2567275 AATCCCAGAGTTCAAGTGACAGG + Intergenic
986000155 5:3624468-3624490 AAACCCAGATCTCAAAAAACTGG - Intergenic
986983195 5:13472886-13472908 AAACCCAGGGTTCCAGGGAGAGG + Intergenic
991576834 5:68113348-68113370 AAGCCCTGAGCTCAAGAGAGAGG + Intergenic
991722044 5:69502692-69502714 AAACCCAGTGCTGGAGACACTGG - Intronic
992588841 5:78272115-78272137 AAAACCTGGGATCAAGAGAAAGG - Intronic
994828928 5:104752266-104752288 AAACCCTGTACTCAAGAGAAGGG + Intergenic
998651674 5:144127666-144127688 AAACACAGGGATTAAGAGATGGG - Intergenic
999280026 5:150358943-150358965 AATTCCTGGGCTCAAGAGAGTGG - Intronic
1001100938 5:168813832-168813854 AAACACATGGCTCCAGAGACAGG - Intronic
1001309588 5:170601448-170601470 AAACCCAGGGCTCCAGCTCCAGG + Intronic
1004932236 6:20473851-20473873 AATCCCAAGGCTCAAGTGTCTGG - Intronic
1006642303 6:35495754-35495776 AGAACCAGGCCACAAGAGACTGG + Intronic
1007292961 6:40800970-40800992 GAATCCAGGGCTCCAGAGTCTGG - Intergenic
1008491057 6:52087849-52087871 GAACAGAGGGCTCAAGAGAAAGG + Intergenic
1009058302 6:58365735-58365757 ACTCCCATGGTTCAAGAGACGGG - Intergenic
1010648677 6:78424838-78424860 AAAGCCAGGGCTTTAGAGCCAGG - Intergenic
1017084399 6:150700473-150700495 AACCCCAGGGCTAAAGAACCTGG + Intronic
1019193520 6:170267771-170267793 AAAACCAAGACTGAAGAGACAGG - Intergenic
1019965189 7:4492936-4492958 AACTCCTGGGCTCAAGAGATTGG - Intergenic
1021467835 7:20966326-20966348 GAACACAGGGCTCTAGAGCCTGG - Intergenic
1022032462 7:26504859-26504881 TTACACAGGGCTCAAGAGATTGG - Intergenic
1022305807 7:29145867-29145889 AAACCAAGGGCACAGGAGACAGG - Intronic
1022761328 7:33355792-33355814 GAACCCAGAGCTAAAGAAACTGG - Intronic
1023210512 7:37799015-37799037 GAACCCATGCTTCAAGAGACAGG - Intronic
1023422667 7:39999479-39999501 AAAGCCAGGGATAAAGACACTGG + Exonic
1024059085 7:45685141-45685163 GGACCCAGGGCTGCAGAGACAGG + Intronic
1024548281 7:50540066-50540088 AAAGCCAGGCCTCAAGAGAGCGG + Intronic
1026994591 7:74607043-74607065 AAGCCCAGGCCTCCAGGGACTGG - Intergenic
1027220069 7:76208253-76208275 GAAATCAGGGCTCAAGAGATTGG - Intronic
1031728774 7:125270809-125270831 AGAGCCAGGGCATAAGAGACTGG + Intergenic
1034140603 7:148812024-148812046 AAATCAAGGGCTGAAGATACAGG - Intronic
1034389907 7:150778026-150778048 AAAGCCAGGGCTCACCACACAGG - Intergenic
1035570600 8:670159-670181 AAATTCAGGCCTCAAAAGACAGG - Intronic
1036237018 8:7047768-7047790 ACACCCAGAGCTCAGGAGAAGGG - Intergenic
1036728209 8:11239249-11239271 AAATGCAAGGCTCATGAGACTGG - Intergenic
1038813318 8:30874554-30874576 GAACCCAGCCCTTAAGAGACTGG - Intronic
1039130892 8:34262868-34262890 TAACCTTGGGCTCAAGAAACAGG + Intergenic
1044239222 8:89869027-89869049 AACTCCTGGGCTCAAGCGACCGG + Intergenic
1046351109 8:113013721-113013743 AACCACTGGGCTCAAGAGCCTGG + Intronic
1047202380 8:122778222-122778244 AAATCCAAGTCTTAAGAGACTGG - Intergenic
1047561508 8:125991956-125991978 AAACCATGGACTCAAGAGGCAGG - Intergenic
1047727231 8:127694445-127694467 CACCCCAGGGCTCAAGAGCTGGG - Intergenic
1050463481 9:5896782-5896804 GAACACAGGGCCCAAGAGGCTGG + Intronic
1055600449 9:77911956-77911978 AAACCGAGGCCTCAAGAAAAAGG + Intronic
1056559614 9:87718678-87718700 AAAGCCAAGGCTGAAGAGAGAGG - Intergenic
1056810158 9:89757752-89757774 AAACCCAGGGCCCAGGAGGATGG - Intergenic
1056816831 9:89807927-89807949 ACACCCAGGGCTCAAGACCACGG - Intergenic
1056857059 9:90140623-90140645 AAAGCCAGGGCCCAGGAGGCAGG - Intergenic
1059886388 9:118749265-118749287 AAACCCAGGTCTCAAGATGTAGG - Intergenic
1060666759 9:125436436-125436458 AAAACGAGGGCCCAAGAGGCAGG + Intergenic
1061431686 9:130535414-130535436 AAACCGAGGGCTGGAGAGAAAGG + Intergenic
1061949749 9:133929659-133929681 AAACCCAGGGCCAGAGGGACTGG + Intronic
1062485405 9:136772265-136772287 AAAGCCAAAACTCAAGAGACAGG + Intergenic
1188762448 X:34049484-34049506 AAAGCCAGCCCTCAACAGACTGG - Intergenic
1189209207 X:39268967-39268989 AATCACAGGTCTTAAGAGACAGG - Intergenic
1190452377 X:50594872-50594894 AAACCCAGAGCTCCACAGAAAGG + Exonic
1190457144 X:50637515-50637537 AAACCAAGGGCTCAGGGCACAGG - Intronic
1192470772 X:71396807-71396829 AACTCCTGGGCTCAAGAGATAGG - Intronic
1194485931 X:94486182-94486204 AAAACCAGGGATCAATAGAAAGG + Intergenic
1195413636 X:104596690-104596712 AGAGCCAGGGTTCAAGAGAAGGG - Intronic
1195466435 X:105183864-105183886 AGAGCCAGCCCTCAAGAGACTGG - Intronic
1195671574 X:107474414-107474436 AAGCACAGGGATCAAGAGATAGG + Intergenic
1197281480 X:124541894-124541916 GGACCCAGGTCTTAAGAGACTGG + Intronic
1198714696 X:139544674-139544696 AATCCCAGGGGGCAAGAGAAAGG + Intronic
1199792732 X:151170152-151170174 AGACCCAGTGCTCTAGAGCCAGG + Intergenic
1200862716 Y:8009955-8009977 AAAAGCAGGGCTCAGGACACAGG - Intergenic
1202141482 Y:21728317-21728339 AAACCCATGGCTCCAAAGATAGG - Intergenic
1202145383 Y:21775485-21775507 AAACCCATGGCTCCAAAGATAGG + Intergenic