ID: 1147718105

View in Genome Browser
Species Human (GRCh38)
Location 17:42521632-42521654
Sequence GCGTCTTTTGCCCACCCCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147718099_1147718105 21 Left 1147718099 17:42521588-42521610 CCCACTCTTGGATTAGCAGGGGT 0: 1
1: 0
2: 1
3: 8
4: 65
Right 1147718105 17:42521632-42521654 GCGTCTTTTGCCCACCCCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 91
1147718100_1147718105 20 Left 1147718100 17:42521589-42521611 CCACTCTTGGATTAGCAGGGGTG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1147718105 17:42521632-42521654 GCGTCTTTTGCCCACCCCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 91
1147718104_1147718105 -6 Left 1147718104 17:42521615-42521637 CCAGGAAGATGATATTTGCGTCT 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1147718105 17:42521632-42521654 GCGTCTTTTGCCCACCCCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147718105 Original CRISPR GCGTCTTTTGCCCACCCCCC TGG Exonic
900269413 1:1779214-1779236 CCGTGTTTTGCGCACCCCACAGG + Intronic
902509755 1:16959884-16959906 CCGCCTTTCCCCCACCCCCCAGG + Intronic
903181793 1:21608575-21608597 GCTTCATGTCCCCACCCCCCAGG + Intronic
904399118 1:30244198-30244220 GGGTCTTCTGCCCCCACCCCAGG + Intergenic
911388639 1:97210240-97210262 GCGTTTTTTTCCCTCCCCCTTGG + Intronic
917853243 1:179082580-179082602 GCGTCCCCTGCGCACCCCCCTGG + Intronic
920381420 1:205536651-205536673 GTGACTTTTGCCCAACCCCCAGG - Intergenic
920865104 1:209745330-209745352 GCCTCTTTTGAGCACTCCCCTGG + Intergenic
1070407454 10:76109844-76109866 GTGGCTTTTGACCACCTCCCTGG + Intronic
1070551764 10:77495756-77495778 TCCTCTTTTGCCCACCCCTTGGG - Intronic
1072890082 10:99316081-99316103 GCCTCTTCTGTCCACCCACCCGG + Intergenic
1081908622 11:46685654-46685676 GAGACTTGTGCCCACCTCCCAGG - Intronic
1083683056 11:64360060-64360082 GCCTCATTTGCACACCCTCCTGG + Intronic
1084372248 11:68751533-68751555 GCGCCTCTTCCCCTCCCCCCAGG - Exonic
1092923229 12:13250976-13250998 GCATCTTGTGCCCACCCACATGG + Intergenic
1095096583 12:38152504-38152526 GCGTCCTTTTCCCTTCCCCCGGG - Intergenic
1097854238 12:64445053-64445075 CCCTCTTTTCCCCACCCCCCAGG + Exonic
1103665405 12:122560446-122560468 GCAACCTCTGCCCACCCCCCAGG + Intronic
1104010275 12:124925376-124925398 TCCTCTTGTGCCCACCCACCTGG + Intergenic
1112423521 13:99275635-99275657 GCCTCTTCTACCCACCCCCCAGG + Intronic
1113583891 13:111449529-111449551 GTGTCTTTTGTCCTCCACCCAGG + Intergenic
1113749172 13:112766647-112766669 TTGGCTTCTGCCCACCCCCCAGG + Intronic
1116521319 14:45850787-45850809 GCGTCATGTGCCCACCCCAGTGG + Intergenic
1118184517 14:63524712-63524734 ACGTCTTGTGCCCAGCTCCCCGG + Intronic
1121429051 14:93874018-93874040 GAGCCTTTTGCTCACCCTCCAGG + Intergenic
1124264866 15:28223326-28223348 GGGTCTTTTTCCCGCCCACCTGG - Intronic
1124489490 15:30144984-30145006 GCATCTTTGGCACAGCCCCCTGG - Exonic
1124754038 15:32393343-32393365 GCATCTTTGGCACAGCCCCCTGG + Exonic
1130221112 15:82020454-82020476 GCATTTTTTGCCCACCCACTAGG + Intergenic
1131051390 15:89350398-89350420 GCGTCTCCTGCCCTCCCCCTTGG + Intergenic
1132090136 15:98941289-98941311 GTGTCTTATTCCCACCCTCCGGG + Intronic
1132175212 15:99708709-99708731 GTGTCTTGTGCCTTCCCCCCAGG - Intronic
1136548290 16:30967479-30967501 CCATCTTTTCCCCATCCCCCAGG + Exonic
1137000098 16:35222005-35222027 GCCCCTCTTGCCCACCCCCGGGG + Intergenic
1137629208 16:49930463-49930485 GCGTTTTTTGCCTACCCCTCTGG - Intergenic
1142349728 16:89574669-89574691 GCCTCTTTAGCCAACCTCCCGGG + Intergenic
1147718105 17:42521632-42521654 GCGTCTTTTGCCCACCCCCCTGG + Exonic
1154355341 18:13620070-13620092 GCGTCTGCTGCCCACACCCTGGG - Intronic
1162550884 19:11357553-11357575 GAGTCCTTTGGCCACACCCCTGG - Intronic
1163142834 19:15362061-15362083 GCGTCTCTTGCCCATCCCGCAGG - Intronic
1165434188 19:35787657-35787679 GCTTCTTCTCCCCAGCCCCCAGG + Exonic
928136841 2:28694094-28694116 GCCTTTCTTGCCCACCACCCAGG - Intergenic
928337847 2:30413442-30413464 GCGTCTCTTTCCCTCCTCCCTGG + Intergenic
931253981 2:60554631-60554653 GCCTCTCTTGCCCAGGCCCCCGG - Intergenic
932826618 2:74947451-74947473 CCATCTTGTCCCCACCCCCCAGG - Intergenic
934261040 2:91477576-91477598 GCGGCTTTTTGCCCCCCCCCTGG + Intergenic
934541370 2:95177936-95177958 GCGTCTTCTGCCTGCCCCTCTGG - Intronic
937340713 2:121088840-121088862 GCAACTTTTGGCCACCCCCCAGG + Intergenic
942070758 2:172313382-172313404 GCCTCTCTTGACCACCCCCACGG - Intergenic
942475573 2:176316425-176316447 GGGTCTTATGCCCATCACCCAGG + Intronic
947451261 2:230211259-230211281 GCCTCCTTTGCCCTCCCCCAGGG + Intronic
1175810375 20:61854450-61854472 GTGCCTTTGGCCCACCCCCAGGG + Intronic
1175810400 20:61854542-61854564 GTGCCTTTGGCCCACCCCCAGGG + Intronic
1175810435 20:61854680-61854702 GTGCCTTTGGCCCACCCCCAGGG + Intronic
1175810492 20:61854909-61854931 GCGCCTTTGGCCCACCCCCAGGG + Intronic
1175810505 20:61854955-61854977 GCGCCTTTGGCCCACCCCCAGGG + Intronic
1175810544 20:61855093-61855115 GCGCCTTTGGCCCACCCCCAGGG + Intronic
1180143793 21:45908811-45908833 GCGGCCTGTGCCCACCCTCCTGG - Intronic
1181120980 22:20668668-20668690 GCAGCCTTTGCCCACCCCCTTGG + Intergenic
1183704853 22:39470084-39470106 GCCACTGTTCCCCACCCCCCAGG - Intronic
1184833993 22:47009881-47009903 GCCTCTTCTGTCCAGCCCCCAGG + Intronic
950643009 3:14360503-14360525 GGGCCTGGTGCCCACCCCCCAGG + Intergenic
952334633 3:32393122-32393144 ACGTCCTGTGCCCAACCCCCTGG - Intronic
952978351 3:38715197-38715219 CAGTCTTTTGCTCAGCCCCCTGG + Intronic
955782927 3:62505475-62505497 GAGTCATATGCCCACCCCCTCGG - Intronic
958910297 3:99986734-99986756 GATTCTTTTGCCCCACCCCCAGG + Intronic
959849893 3:111072702-111072724 CTGTCTTGTGCCCACTCCCCCGG + Intronic
960235977 3:115282639-115282661 GAGTCTTTTGCCCACACCAGTGG - Intergenic
961683297 3:128613248-128613270 GTGCCTTCTGCGCACCCCCCAGG + Intergenic
962313474 3:134342506-134342528 GCATCTTCTGCCCAGCCCTCGGG + Intergenic
965881960 3:173397493-173397515 GCCCGTTTTGCCCACCCTCCTGG + Intronic
968299276 3:197600851-197600873 GCGTCTTTTCTCCACTCCACAGG - Intergenic
971328166 4:25661343-25661365 GCGTGTTTTACCTACCACCCAGG - Intronic
971417199 4:26442663-26442685 TCCTCTTTTGCCCCCCTCCCTGG + Intergenic
989281051 5:39643808-39643830 GAGGCTTATGCCCACCCCCTGGG + Intergenic
998444845 5:142190772-142190794 GCATTTTTTGCCCAGCCCCAGGG - Intergenic
1006271900 6:32971641-32971663 GCGTCTTGCGGCCACACCCCTGG + Exonic
1007917774 6:45577040-45577062 GCCTCTTTTGGCAACCCACCTGG + Intronic
1013269129 6:108529417-108529439 GAGTCTTATCCCCAGCCCCCAGG - Intergenic
1013556378 6:111260557-111260579 GCGCCTTTTGCCAAACCCCTGGG + Intronic
1019625099 7:2011890-2011912 GCCTCCTCTGCCCATCCCCCTGG - Intronic
1020133689 7:5574304-5574326 GCTTCTTTTGTCAACCCCTCCGG + Intergenic
1022865254 7:34411294-34411316 GGGTCTCTTGACCACCCCTCAGG + Intergenic
1025786914 7:64652123-64652145 ACGTCTTTTTCCCAGCACCCAGG + Intergenic
1026218288 7:68368964-68368986 GCGTCTTATCCCCAGCCCTCTGG - Intergenic
1032489099 7:132310644-132310666 GGGTCTGTTGCTCAGCCCCCAGG + Intronic
1035712504 8:1729381-1729403 GCCCCTCGTGCCCACCCCCCAGG - Intergenic
1035913728 8:3596725-3596747 TCTTCTCTTGCCCACCCTCCTGG - Intronic
1041907733 8:63052166-63052188 GCGTTTATAGACCACCCCCCAGG - Intronic
1042689297 8:71479460-71479482 TCTTTTATTGCCCACCCCCCAGG + Intronic
1049164523 8:141117844-141117866 GTGTCTGCTGCCCACCCCACAGG - Intronic
1049765344 8:144352782-144352804 GACTCTTGTGCCCACCCCCTTGG + Intronic
1059067486 9:111100718-111100740 GCTTCTCTTGCCAACCCCACAGG - Intergenic
1061377752 9:130236230-130236252 GCCTCCATTGCCCACCCGCCAGG + Exonic
1062268164 9:135696834-135696856 GGGTCTATTCCCCAGCCCCCTGG + Intronic
1186749655 X:12608227-12608249 GAGTCTTTGGCCCAACCCTCTGG + Intronic
1187191893 X:17043495-17043517 GCCTTTCTTGCCCCCCCCCCCGG + Intronic
1191253704 X:58270909-58270931 GCGTCATATCCCCATCCCCCGGG + Intergenic
1199846227 X:151694749-151694771 GCGTCCTGTCCCCACCCCCCGGG - Intergenic
1201377907 Y:13342126-13342148 TTGTCTTCTGCCCACACCCCTGG - Intronic
1202372833 Y:24210015-24210037 GCGTCTTTGGCACTGCCCCCTGG + Intergenic
1202497949 Y:25460105-25460127 GCGTCTTTGGCACTGCCCCCTGG - Intergenic