ID: 1147719808

View in Genome Browser
Species Human (GRCh38)
Location 17:42532131-42532153
Sequence GACGCCCGGCCCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147719808_1147719816 -5 Left 1147719808 17:42532131-42532153 CCGCCGCCGCCGGGCCGGGCGTC No data
Right 1147719816 17:42532149-42532171 GCGTCGCGCGCCGAGGCTCGGGG No data
1147719808_1147719814 -7 Left 1147719808 17:42532131-42532153 CCGCCGCCGCCGGGCCGGGCGTC No data
Right 1147719814 17:42532147-42532169 GGGCGTCGCGCGCCGAGGCTCGG No data
1147719808_1147719818 -3 Left 1147719808 17:42532131-42532153 CCGCCGCCGCCGGGCCGGGCGTC No data
Right 1147719818 17:42532151-42532173 GTCGCGCGCCGAGGCTCGGGGGG No data
1147719808_1147719817 -4 Left 1147719808 17:42532131-42532153 CCGCCGCCGCCGGGCCGGGCGTC No data
Right 1147719817 17:42532150-42532172 CGTCGCGCGCCGAGGCTCGGGGG No data
1147719808_1147719815 -6 Left 1147719808 17:42532131-42532153 CCGCCGCCGCCGGGCCGGGCGTC No data
Right 1147719815 17:42532148-42532170 GGCGTCGCGCGCCGAGGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147719808 Original CRISPR GACGCCCGGCCCGGCGGCGG CGG (reversed) Intergenic
No off target data available for this crispr