ID: 1147720441

View in Genome Browser
Species Human (GRCh38)
Location 17:42536470-42536492
Sequence GCGCCGCGCCGCCGCCGCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 779
Summary {0: 1, 1: 3, 2: 13, 3: 114, 4: 648}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147720441_1147720448 10 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720448 17:42536503-42536525 GCGCGGCTCCACGGGCGTGGCGG 0: 1
1: 0
2: 0
3: 13
4: 106
1147720441_1147720445 1 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720445 17:42536494-42536516 CGTGCGGGTGCGCGGCTCCACGG 0: 1
1: 1
2: 0
3: 3
4: 72
1147720441_1147720447 7 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720447 17:42536500-42536522 GGTGCGCGGCTCCACGGGCGTGG 0: 1
1: 0
2: 1
3: 10
4: 120
1147720441_1147720444 -7 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720444 17:42536486-42536508 GCGGCGCGCGTGCGGGTGCGCGG 0: 1
1: 0
2: 2
3: 25
4: 300
1147720441_1147720446 2 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720446 17:42536495-42536517 GTGCGGGTGCGCGGCTCCACGGG 0: 1
1: 0
2: 1
3: 2
4: 68
1147720441_1147720451 20 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720451 17:42536513-42536535 ACGGGCGTGGCGGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 24
4: 236
1147720441_1147720452 21 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720452 17:42536514-42536536 CGGGCGTGGCGGCCGCCGCGGGG 0: 1
1: 0
2: 4
3: 48
4: 588
1147720441_1147720450 19 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720450 17:42536512-42536534 CACGGGCGTGGCGGCCGCCGCGG 0: 1
1: 0
2: 1
3: 13
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147720441 Original CRISPR GCGCCGCGCCGCCGCCGCCC AGG (reversed) Exonic