ID: 1147720441

View in Genome Browser
Species Human (GRCh38)
Location 17:42536470-42536492
Sequence GCGCCGCGCCGCCGCCGCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 779
Summary {0: 1, 1: 3, 2: 13, 3: 114, 4: 648}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147720441_1147720444 -7 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720444 17:42536486-42536508 GCGGCGCGCGTGCGGGTGCGCGG 0: 1
1: 0
2: 2
3: 25
4: 300
1147720441_1147720452 21 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720452 17:42536514-42536536 CGGGCGTGGCGGCCGCCGCGGGG 0: 1
1: 0
2: 4
3: 48
4: 588
1147720441_1147720451 20 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720451 17:42536513-42536535 ACGGGCGTGGCGGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 24
4: 236
1147720441_1147720447 7 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720447 17:42536500-42536522 GGTGCGCGGCTCCACGGGCGTGG 0: 1
1: 0
2: 1
3: 10
4: 120
1147720441_1147720450 19 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720450 17:42536512-42536534 CACGGGCGTGGCGGCCGCCGCGG 0: 1
1: 0
2: 1
3: 13
4: 195
1147720441_1147720448 10 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720448 17:42536503-42536525 GCGCGGCTCCACGGGCGTGGCGG 0: 1
1: 0
2: 0
3: 13
4: 106
1147720441_1147720446 2 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720446 17:42536495-42536517 GTGCGGGTGCGCGGCTCCACGGG 0: 1
1: 0
2: 1
3: 2
4: 68
1147720441_1147720445 1 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720445 17:42536494-42536516 CGTGCGGGTGCGCGGCTCCACGG 0: 1
1: 1
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147720441 Original CRISPR GCGCCGCGCCGCCGCCGCCC AGG (reversed) Exonic
900119198 1:1041342-1041364 GCGCCGCGCCTGCGCCCGCCAGG + Exonic
900159594 1:1217266-1217288 CCGCGGCGCCGCCTCCTCCCTGG - Exonic
900180130 1:1307657-1307679 GGGCCGGGCCGCGGCCGCCGGGG - Intronic
900180188 1:1307856-1307878 GCGCCGAGCGGCAGCCGCGCCGG + Exonic
900349526 1:2228118-2228140 GAGAGGCGCCTCCGCCGCCCCGG + Intergenic
900393556 1:2444026-2444048 GCGCGGGGGCGCCGCAGCCCTGG + Intronic
900513014 1:3069318-3069340 GCGCCGCGCCGCCGGGGCCCGGG + Intronic
900640032 1:3684222-3684244 CCGCCCCGCCTCCGCCGCCCAGG + Intronic
900671362 1:3856968-3856990 GCGCCGCCTGGCCGCCTCCCCGG - Exonic
900988921 1:6089004-6089026 GCCCCGCTCCGTCTCCGCCCTGG - Exonic
901045372 1:6393000-6393022 CCGTGGCGCGGCCGCCGCCCTGG + Intronic
901109555 1:6784696-6784718 GCGCCGCGTCCCCACGGCCCCGG - Intergenic
901109836 1:6785644-6785666 GCCCGGCGCCGCCGATGCCCGGG - Intronic
901183662 1:7358540-7358562 GCCCCGCGCCACCCCTGCCCCGG + Intronic
901525973 1:9823706-9823728 GCGCCGCCCCGCTCCCGCGCTGG - Exonic
901540079 1:9910057-9910079 GGGCCGCGCCTGCACCGCCCGGG - Intronic
901673049 1:10867127-10867149 GCTGCGCGCCCCCGCCTCCCCGG + Intergenic
902375133 1:16026921-16026943 GCCCCGCCCCGCCGCCCCCGGGG - Intronic
902400831 1:16155855-16155877 GCCCTGCGCCGCCGCGGCCGCGG + Exonic
902585711 1:17437883-17437905 GCGCCCCTCCCCCCCCGCCCCGG - Intronic
902823110 1:18955637-18955659 CCGCCCCTCCCCCGCCGCCCTGG - Intronic
903950673 1:26994300-26994322 GGCCCGCGCCGCGGCCGCCGCGG + Exonic
904181398 1:28668988-28669010 GCGTGCCGCCGCCGCCGCCGGGG + Intronic
904252931 1:29237667-29237689 GGGCCCCGCGGCCGCCGCCTCGG + Intronic
904620453 1:31772032-31772054 CCGCGCCGCCGCCGCCGCCACGG - Intergenic
905548576 1:38818392-38818414 CCGCCGCGCAGCCGCGGACCCGG - Intergenic
905626283 1:39492154-39492176 GCGCGGGGCCGGGGCCGCCCGGG - Exonic
905648269 1:39639685-39639707 GCCCCGCCCCGGCCCCGCCCCGG + Exonic
905670613 1:39788301-39788323 GCGCGGGGCCGGGGCCGCCCAGG + Exonic
905990785 1:42335283-42335305 GCGTCGCTGCGCCGCCGGCCCGG + Intronic
906293021 1:44632093-44632115 GCGCGGTGCCGCCCCAGCCCTGG - Intronic
906532816 1:46533203-46533225 GCCCGGCGCGGCCGCCACCCTGG + Intergenic
906615824 1:47232213-47232235 GGGCCGGGCCGCCGCCGCTCAGG - Intronic
906627023 1:47333822-47333844 CCGCCGCGGCCCCGCCGCCGTGG - Exonic
906637015 1:47416490-47416512 GGCCGCCGCCGCCGCCGCCCCGG - Exonic
906662541 1:47593269-47593291 GCGGCCCGCCGCCGCCAGCCCGG + Intergenic
906719949 1:47997323-47997345 CGGCCGCGCGGCCGCTGCCCGGG + Intergenic
906961009 1:50419468-50419490 CCTCCTCGCCGCCGCCGCCAGGG + Exonic
907541019 1:55215384-55215406 GAGGCGCGGCCCCGCCGCCCGGG - Intergenic
908501277 1:64745451-64745473 GCGCCGCCCCGCCGCCCCTCGGG - Intronic
908561326 1:65309557-65309579 GCGAGGCGAAGCCGCCGCCCTGG - Exonic
908714284 1:67053735-67053757 GCGGCGCGGCGCCGGCTCCCTGG - Intronic
910676443 1:89821176-89821198 GCAGCGCGCCTTCGCCGCCCCGG + Exonic
911133799 1:94418316-94418338 CCGCCGCGCCGCCCGCGCTCTGG - Intergenic
912401555 1:109397743-109397765 CCGCTGCGCCGCTGCCGCGCTGG - Exonic
912716890 1:111989572-111989594 GCTCGGCGCCTCCGCGGCCCCGG - Intergenic
912800187 1:112715326-112715348 CCGCGGCCCCGCCCCCGCCCAGG + Exonic
913048055 1:115089940-115089962 GCGCCGCGGAGCCGCAGCCCTGG - Intergenic
913186428 1:116373772-116373794 GGGGCGCGCAGCCCCCGCCCAGG - Intronic
915326916 1:155085481-155085503 CCGCCGCGCCGGCCCCGCCCCGG - Intronic
916107004 1:161440286-161440308 CCAGCGCGCCGCCGACGCCCGGG + Intergenic
916108565 1:161447700-161447722 CCAGCGCGCCGCCGACGCCCGGG + Intergenic
916110153 1:161455081-161455103 CCAGCGCGCCGCCGACGCCCGGG + Intergenic
916111738 1:161462491-161462513 CCAGCGCGCCGCCGACGCCCGGG + Intergenic
916113325 1:161469872-161469894 CCAGCGCGCCGCCGACGCCCGGG + Intergenic
916548309 1:165827527-165827549 ACGCCTCGCCGCCTCCGCCTCGG + Exonic
918388764 1:184037056-184037078 GCGTCCCGCCGCGGCGGCCCGGG + Intronic
919070689 1:192751496-192751518 GGGCAGCTCCGCCGCAGCCCTGG + Intergenic
919463241 1:197902936-197902958 CCGCCCCGCCGCGGCCGCCCCGG + Intronic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
921029700 1:211326761-211326783 GCGCCCCTCCGCCCGCGCCCCGG + Intronic
921152770 1:212414913-212414935 GCGCCTGGCCGCTGCCGCCCAGG + Intergenic
921945702 1:220884599-220884621 CCGAGGCGCCGCCGCCGCCAAGG - Exonic
922513146 1:226186475-226186497 GCCCCCAGCCGCCGCCTCCCCGG + Exonic
922739610 1:228007771-228007793 GCGCCTCCCCGCCGCAGTCCGGG + Intronic
922821408 1:228487922-228487944 GCGCCTCTCCGCCCCCGCCCCGG + Intronic
923007918 1:230067081-230067103 GCCGCGCGGCGCCGCCGGCCCGG + Intronic
923119629 1:230978506-230978528 GCCCCGCTGCCCCGCCGCCCCGG + Intronic
923372658 1:233328342-233328364 GCCCCGCGCCGCCGCCCTCGCGG + Exonic
923506545 1:234609995-234610017 CCGCCCGGCCGCCGCCACCCCGG - Intergenic
924289724 1:242524715-242524737 CCCCGCCGCCGCCGCCGCCCCGG - Intergenic
924436820 1:244049283-244049305 GCCCCGCGCCGCAGCTGCACCGG - Intronic
1063418204 10:5890185-5890207 GCTCCGCCCCGCCGCAGCCCCGG - Intronic
1063450064 10:6145123-6145145 GGGCGGCACCGCCGCAGCCCGGG - Intronic
1063504018 10:6580176-6580198 GCCCCGCGCCGCCGCCGGGAGGG - Intronic
1064022877 10:11823626-11823648 GCCCGGCGCCGCCGCCGCAGAGG + Intronic
1064622443 10:17229379-17229401 CCGCGCCACCGCCGCCGCCCAGG + Exonic
1065099552 10:22320710-22320732 GCGCCGCGGCGCCGGAGCCTGGG + Intronic
1065099606 10:22320852-22320874 GCTCCGCGCGGCCGCCGCTCCGG - Intronic
1065140265 10:22713755-22713777 GCGCCGCGCGGCCCCCACACCGG + Intronic
1065214899 10:23439571-23439593 GCGCGGCGCCGGCGGCTCCCGGG - Exonic
1065533630 10:26697749-26697771 GCTCCGCGCCGCCGGCTTCCAGG - Exonic
1065844716 10:29735541-29735563 GCGCCCCGTCGCAGCGGCCCGGG + Intronic
1067436532 10:46282868-46282890 GCGCATCGCCGCGGCCCCCCTGG + Intergenic
1067474470 10:46556753-46556775 CCACCGCCCCGCCGCGGCCCGGG + Intergenic
1069019145 10:63465992-63466014 GCTGCGCGCCGCCGCTGCCCGGG - Intergenic
1069474572 10:68721393-68721415 GAGCCCCACCGTCGCCGCCCGGG - Intronic
1070257638 10:74825542-74825564 GCGCCGCGCTCCCCCCGCCCGGG - Intergenic
1070800837 10:79243560-79243582 CCGCGCCGCCGCCGCCGCCGGGG + Intronic
1070954141 10:80453887-80453909 GCGCTGCGCAGACGCCGCTCTGG - Intergenic
1072151845 10:92690226-92690248 GCACCACTCCGCCGCCGCGCTGG + Exonic
1072421106 10:95291067-95291089 GGGCGGAGCCGCCCCCGCCCTGG - Intergenic
1072891606 10:99329723-99329745 GGGCCACGCCGCCACCGCCCGGG - Exonic
1072930674 10:99659478-99659500 ACGTGGCGCCGCCGCCGGCCGGG + Intergenic
1073207424 10:101776285-101776307 CGGCCGCCCCGCCCCCGCCCCGG - Intronic
1073287877 10:102399364-102399386 GCGCCCCGCCCCCGCCTCCCGGG - Exonic
1073330735 10:102668539-102668561 GCTCCACGCCGCCTCCTCCCTGG - Intergenic
1073363607 10:102919077-102919099 ACCCCGAGCCGCCGGCGCCCAGG - Exonic
1073491408 10:103855509-103855531 GCGCAGCGCGGCGGCCGCGCGGG - Intronic
1074088405 10:110226073-110226095 GCGCCGAGCCGCGGCCGAGCTGG + Intronic
1074169730 10:110919989-110920011 GCGCCGGCTCGCCGTCGCCCAGG - Intronic
1075032131 10:119030397-119030419 CAGCCGGGCGGCCGCCGCCCCGG - Exonic
1075430297 10:122374766-122374788 CACCCGCGCCGCCGCGGCCCCGG - Exonic
1075492089 10:122880014-122880036 GCGCCGGGCCGCCGGCGACCGGG + Intergenic
1075629393 10:123991934-123991956 GCGCCGGGCCCCCGCACCCCTGG + Intergenic
1075645454 10:124093304-124093326 GCGCGCCGCCTCCGCCGGCCCGG + Intronic
1075697510 10:124447674-124447696 GCGCCGCGCCGTCGGCACCCGGG + Exonic
1076750092 10:132538070-132538092 GCCCAGCGCCCGCGCCGCCCGGG + Exonic
1076792536 10:132784927-132784949 CCCCCGCGCCGCCGCCGCACGGG + Exonic
1076792811 10:132785949-132785971 GGGCGCCGCCGCCGCCGGCCCGG + Exonic
1076985973 11:236359-236381 TCGCCCCGCCCCCGGCGCCCCGG + Exonic
1077090625 11:776876-776898 GCGCCCCGCGGCCCCCGTCCTGG - Intronic
1077103661 11:832892-832914 GCCCCGCCCCGGCCCCGCCCCGG - Exonic
1077107950 11:849976-849998 GCGCCCCGCACCCGCCGCCCCGG - Intronic
1077121509 11:910955-910977 GCGCGGCCCCGCCCCGGCCCCGG - Intronic
1077544946 11:3165178-3165200 CCGCCGCCCTGCCGCCCCCCGGG + Intronic
1077891266 11:6419427-6419449 GTGCGGCGCCGCGGCCGCGCGGG + Intergenic
1078266246 11:9758161-9758183 GCGCCCCGCCTCCCTCGCCCAGG - Intergenic
1079689405 11:23403534-23403556 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1080012328 11:27472003-27472025 ACCCCGCCCCGCCGCCGCCCGGG - Intronic
1080283600 11:30585391-30585413 GCGCCCCGCGGCCGCCCCCGGGG - Intronic
1080802100 11:35618651-35618673 GCGGGGCGCCGCCGCCACCGCGG + Exonic
1081845597 11:46238350-46238372 GCGCCGCGCCGCCTCCGCCCGGG - Intergenic
1081896837 11:46593984-46594006 ACCCGGCGCCGCCGCCGCTCAGG + Intronic
1082807725 11:57461028-57461050 GGGCCGCGCCCCCGCCGCCAGGG + Intronic
1082986080 11:59172361-59172383 GCGCGCCGCCGCCGCCGCCGGGG - Intronic
1083048241 11:59755348-59755370 GCGCTGCGCCGGCGCCGGCCCGG + Exonic
1083232680 11:61333104-61333126 GCCCCGCGCCCCGGCCGCTCTGG - Exonic
1083335121 11:61917604-61917626 GCCCCGCCCCTCCGCCGGCCCGG + Intronic
1083885770 11:65572834-65572856 GAGCCGCGCCGCCCGCGCCCCGG + Exonic
1083997218 11:66278413-66278435 GCCCCGCGCTGGCGCCCCCCGGG + Exonic
1084028396 11:66466922-66466944 GCGCGGAGCCGCCGCGGGCCGGG + Exonic
1084070075 11:66728179-66728201 CCGCCGCGCCCCCGCCCGCCCGG - Intronic
1084295754 11:68212937-68212959 GCCCCGCGCCGGCCCCGCACCGG + Intronic
1084385807 11:68841980-68842002 GCCCCGCCCCGCCGAGGCCCCGG - Intronic
1085044004 11:73343091-73343113 CCCCCGCCCCGCCGCCACCCCGG + Intronic
1085295662 11:75430318-75430340 GGCCAGCGCCGCCGCCGCCCCGG + Exonic
1086993442 11:93330647-93330669 CCGCCGCGCTCCCGCCGCCTGGG - Intronic
1087188723 11:95230833-95230855 CCGACGGGCTGCCGCCGCCCCGG + Exonic
1089432715 11:118436697-118436719 GCTTCCCGCCGCCGCCGCCGCGG - Exonic
1089499922 11:118925842-118925864 GCCGCGCGCCGCCGCCTCCCCGG + Intronic
1089520040 11:119057240-119057262 CGGCCCCGCCCCCGCCGCCCCGG + Intergenic
1089533845 11:119149206-119149228 GCCCCGCCCCGGCCCCGCCCCGG + Exonic
1089567855 11:119381534-119381556 GCGCCGCGCCAGCGCCAGCCGGG - Exonic
1089796567 11:120985983-120986005 GCGCCGCAGTCCCGCCGCCCCGG + Exonic
1089842123 11:121427379-121427401 GAGCTGCGCAGCCGCCGCGCCGG + Intergenic
1090699312 11:129279630-129279652 GAGGCGCGCCGCCGCGGCCGCGG + Intergenic
1091303619 11:134523507-134523529 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303628 11:134523538-134523560 GCGCCTCCCCGCGGCCGGCCTGG - Intergenic
1091303648 11:134523600-134523622 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303668 11:134523662-134523684 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303679 11:134523693-134523715 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303700 11:134523755-134523777 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303719 11:134523817-134523839 GCGCCTCCCCGCGGCCGGCCTGG - Intergenic
1091303730 11:134523848-134523870 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303750 11:134523910-134523932 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303811 11:134524096-134524118 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303831 11:134524158-134524180 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303853 11:134524220-134524242 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091303864 11:134524251-134524273 GCGCCTCCCCGCGGCCGGCCCGG - Intergenic
1091688993 12:2583141-2583163 GCGCGGCGCCGCTGCGGGCCCGG - Intronic
1091857727 12:3752962-3752984 GCGCCGCCCCCCGGCCGCCCCGG + Intronic
1092899498 12:13044823-13044845 CCGTCCCGCCGCCCCCGCCCAGG - Intronic
1093435486 12:19130225-19130247 GCCCCGCCTCGCCGCCTCCCGGG - Intronic
1094041111 12:26122617-26122639 CCGCCGCCGCGCCGCCCCCCGGG + Exonic
1094375426 12:29783810-29783832 GCCGCGCGCCGCCGGGGCCCCGG - Exonic
1094564892 12:31590677-31590699 GCTCAGCGCCGCCGCAGCCCTGG + Intronic
1094564937 12:31590853-31590875 GGCCGCCGCCGCCGCCGCCCGGG + Exonic
1096191342 12:49622239-49622261 GCGGCCCGCAGCCGCCGCCGCGG - Intronic
1096191535 12:49623356-49623378 CCCCCGCGCCGCCGCGTCCCGGG - Intronic
1096783876 12:54006222-54006244 GCCCCGCGCCTCGGCCGGCCCGG + Intronic
1097891387 12:64780865-64780887 TCGCCTCGCCACCGCCGCCGCGG - Intergenic
1098255432 12:68611078-68611100 GCCCCGCGCGGCCGCCGCCGCGG - Intronic
1098991176 12:77065836-77065858 GCCCCGCGCCGCCCCCACCTTGG - Intergenic
1100186535 12:92145558-92145580 CCGCCGAGCCCCAGCCGCCCCGG - Exonic
1100444814 12:94650579-94650601 GCCCTGCGCCGCCGCCGCCGCGG + Intergenic
1101466923 12:104958361-104958383 GCGCAGCCGCGCCGCCGCCGGGG + Intronic
1101865180 12:108515295-108515317 GCTCCGGGCCGCCGGCTCCCGGG - Exonic
1102254057 12:111406026-111406048 CCCCCGGGCCGCCGCCGCCGGGG - Exonic
1102256430 12:111418198-111418220 GCCCCGCGGGGCCGCCGCCGGGG - Exonic
1102256512 12:111418516-111418538 TGGCCCCGCCGCGGCCGCCCGGG + Exonic
1102475388 12:113185346-113185368 GCGCCGAGGCGCGGCCTCCCAGG - Exonic
1102678075 12:114672066-114672088 GGGCCCCGCGGCCGCCGCCATGG + Exonic
1102853884 12:116277288-116277310 GCGCCGCGGCGACGCCGCGCCGG + Exonic
1102884077 12:116508535-116508557 CCGCCGCGCCGCCGCGGCTCTGG + Intergenic
1103488191 12:121296736-121296758 CCCCCGCGCGCCCGCCGCCCGGG - Intronic
1103581490 12:121918715-121918737 GGGCCGCGTGGCCTCCGCCCCGG - Intronic
1103604879 12:122079017-122079039 GCGCCGCGCCACCGCCGCCTCGG + Exonic
1103649635 12:122422628-122422650 GTGACGCGCCGCCGCCGCCGCGG + Intronic
1103764652 12:123271622-123271644 GCCCGGCGCGCCCGCCGCCCGGG - Exonic
1104376287 12:128267425-128267447 GCACAGCGGCGCCGCCGGCCCGG - Exonic
1104448841 12:128853532-128853554 CGGCCCCGCCGCCGCCGACCAGG - Exonic
1104448851 12:128853563-128853585 GCATGCCGCCGCCGCCGCCCGGG - Exonic
1104862038 12:131929028-131929050 TCGCTCCGCCGCCGCCTCCCGGG - Intergenic
1104929197 12:132329357-132329379 GCGCCGGGCCACGGCCGCCGGGG + Intergenic
1105327329 13:19382378-19382400 GCCCCGCTCCGCCGCCCTCCCGG - Intergenic
1105411818 13:20177384-20177406 GCGCCGCGCCGCCTCCCGCAGGG + Intergenic
1105472188 13:20704074-20704096 GCGCAGCCCCGCGGCCGCGCGGG - Exonic
1105964530 13:25372324-25372346 GCCCCGCGCCGCCCCCGCCCCGG - Intronic
1106422479 13:29595415-29595437 GAGCCCCGCCGCCGCCGGCTTGG - Exonic
1106735794 13:32586782-32586804 GCGCCCCGCGACCCCCGCCCCGG - Intronic
1106735836 13:32586914-32586936 GCCCGCCGCCGCCGCCGCCCCGG - Intronic
1106735889 13:32587054-32587076 GCGCCGCCCGCCTGCCGCCCGGG - Intronic
1107604014 13:42040754-42040776 GGCCGCCGCCGCCGCCGCCCCGG - Intronic
1108689376 13:52847764-52847786 GCGGCGGGCGGCCGCCGTCCTGG + Exonic
1110705950 13:78602197-78602219 CCGGGCCGCCGCCGCCGCCCGGG + Exonic
1111811997 13:93102788-93102810 CCGCCCCGCCCCCGCCGCCATGG - Intergenic
1112091670 13:96090368-96090390 GCGGCCCGCTCCCGCCGCCCCGG - Intergenic
1112450291 13:99501688-99501710 GCGCCGCTCCGGCGCGGGCCAGG - Exonic
1112652697 13:101416270-101416292 CGGCCGCGCCGCAGCCTCCCGGG + Intronic
1113841617 13:113364288-113364310 GCCCCGCCCCTCCCCCGCCCTGG - Intergenic
1113841669 13:113364394-113364416 GCCCCGCCCCTCCCCCGCCCTGG - Intergenic
1113880503 13:113622958-113622980 GGGCCGCGCTGACGCCACCCAGG - Intronic
1114485175 14:23057684-23057706 GCGCCGCGCGTCCGCCCCCTCGG + Intergenic
1115752918 14:36508372-36508394 GCCCCGCCCCGCCCCTGCCCAGG - Intronic
1115819394 14:37197917-37197939 GCGGCGCGCCGCCGCCCCGTAGG + Intronic
1116817862 14:49599795-49599817 CCGCGGCGCTGCCGCCGCCGCGG - Intronic
1116817889 14:49599863-49599885 ACGCCGCGGGGCCGCCCCCCCGG - Intronic
1116849445 14:49893421-49893443 GCGCCGCGCGAGCGCCGCCGCGG - Exonic
1117176780 14:53153371-53153393 GCGCGGCGCCGGTGCAGCCCGGG - Intergenic
1117315112 14:54565991-54566013 GCGTGCCGTCGCCGCCGCCCGGG + Intergenic
1117875930 14:60249724-60249746 GCCCGCCGCCGCCGCCGCGCAGG - Intronic
1118351002 14:64972369-64972391 CTGCGCCGCCGCCGCCGCCCCGG + Intronic
1118627732 14:67674589-67674611 CCGCCGCACCACCGCCGCCCAGG + Exonic
1118971596 14:70642222-70642244 GGGCTCCTCCGCCGCCGCCCGGG - Exonic
1118971672 14:70642543-70642565 GCGCCGCGCCCCCCGCGCCGCGG + Intronic
1119249037 14:73136551-73136573 CCGCCGCCCCGCTGCCGCCGCGG - Exonic
1119438499 14:74612700-74612722 GCCCCGCGCCACCCCCGCTCCGG - Intergenic
1119469023 14:74882079-74882101 GCGCCGCGCCCCTGCCTTCCAGG - Intronic
1121137170 14:91509785-91509807 GGGCCGCGCCGCCGCCTGCATGG + Exonic
1121342701 14:93115039-93115061 GGGACGCGGCGCCGGCGCCCGGG - Intronic
1121645856 14:95516666-95516688 GCCCCGCCCCGGAGCCGCCCGGG - Intronic
1122145173 14:99684515-99684537 TCCCCGGGCCGCCGCGGCCCAGG + Exonic
1122399356 14:101458071-101458093 TGGCCTCGCCGACGCCGCCCTGG - Intergenic
1122546306 14:102524623-102524645 GCTCCTCCCCGCCTCCGCCCCGG + Intergenic
1122582207 14:102777786-102777808 GCGCCGCGCCGGGCCCGCGCCGG - Intronic
1122624231 14:103075886-103075908 GCGCCCCGCAGCCGCGCCCCGGG + Intergenic
1122689123 14:103523189-103523211 GCCCCTCGCCGCCGCCGCGGGGG - Intergenic
1122904401 14:104795319-104795341 GCCCCGCGCCCTCCCCGCCCAGG + Intronic
1122931140 14:104933557-104933579 GCGCCGCGCACCCACCGCCAGGG + Exonic
1122975460 14:105168943-105168965 GCCCCGTGCCCCCGCCGCCCGGG - Intergenic
1122980164 14:105188048-105188070 GCGCCTCGCCACCGTCTCCCAGG + Intergenic
1123036668 14:105474563-105474585 CCGCGGCGCCGCCCGCGCCCCGG - Intronic
1123036671 14:105474572-105474594 GGGCGGCGCCGCGGTCGCCCGGG + Intronic
1123052166 14:105549789-105549811 ACGCGGCCCCGCCGCCCCCCAGG + Intergenic
1123413008 15:20074437-20074459 CCGCCGCGCAGCTGCCGCCTCGG + Intergenic
1123522350 15:21081550-21081572 CCGCCGCGCAGCTGCCGCCTCGG + Intergenic
1123709979 15:22980190-22980212 TCCCGGCCCCGCCGCCGCCCTGG + Intronic
1123721765 15:23067001-23067023 TCGCCGGGCCTCCGCCTCCCAGG + Intergenic
1123734780 15:23175140-23175162 TCGCCGGGCCTCCGCCTCCCGGG - Intergenic
1123853357 15:24382644-24382666 TCGCCTCCCCCCCGCCGCCCAGG + Intergenic
1124285282 15:28396442-28396464 TCGCCGGGCCTCCGCCTCCCGGG - Intergenic
1124297414 15:28515184-28515206 TCGCCGGGCCTCCGCCTCCCGGG + Intergenic
1124427010 15:29570844-29570866 GCGCGCGGCCGCCGCAGCCCTGG - Intergenic
1124743137 15:32315382-32315404 GCGCGGCCCCGAGGCCGCCCCGG + Intergenic
1125051174 15:35299488-35299510 GCTCCGCGCTGCCGCCACCGCGG - Intronic
1125516427 15:40323715-40323737 GCGCTCCGCCGCCGCCTGCCCGG - Intergenic
1125589140 15:40843919-40843941 GCCCCGCGGCCCCGCAGCCCCGG - Intergenic
1125698518 15:41660042-41660064 GCTCCTCGCCGGCTCCGCCCCGG - Intronic
1126150939 15:45522951-45522973 CCACTGCGCCGCCTCCGCCCAGG + Intergenic
1126736573 15:51737321-51737343 AGGGCGCGCCGCCGCGGCCCGGG - Intronic
1127257885 15:57306959-57306981 GCGCCGCGCCGCACCCGCTACGG + Intergenic
1127789891 15:62390444-62390466 GCGCGGCGCCGCGGCCGGACCGG + Intergenic
1127867268 15:63042811-63042833 GCCCCTCGCCGCCGCCACCATGG + Exonic
1128056506 15:64703341-64703363 GCACCGCCCCGCCTCCGCGCAGG + Intergenic
1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG + Intergenic
1129710595 15:77818773-77818795 GCGCCGCGCTGGAGCCGCTCCGG - Intronic
1130115303 15:81000956-81000978 GCTCGCCGCCGCCGCCGCCTCGG - Exonic
1130348015 15:83066896-83066918 TCGCGGCGCCGCCGCCGCTGGGG - Exonic
1130370884 15:83284586-83284608 GGGCCGCCCCGCGTCCGCCCCGG + Exonic
1130411834 15:83654221-83654243 GCGCCGAGCCCGCGCGGCCCCGG + Exonic
1131186037 15:90275046-90275068 GCGACTCCCAGCCGCCGCCCGGG + Exonic
1131195617 15:90352434-90352456 GCAGCGCGCCGCTGCCGCCGCGG - Intronic
1131735473 15:95326959-95326981 GCGGAGCGCCGCAGCCGCCGCGG - Intergenic
1131977511 15:97961041-97961063 GGGGCGCGCCACCGCCGCCTGGG + Exonic
1132055674 15:98648984-98649006 CCTCAGCGCCGCCGCCGCCGCGG - Exonic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132482308 16:172741-172763 GCCCCGCGCAGGCCCCGCCCGGG + Intergenic
1132483156 16:176545-176567 GCCCCGCGCAGGCCCCGCCCGGG + Intergenic
1132483851 16:180380-180402 GCGCCGCAGCTTCGCCGCCCGGG - Intergenic
1132519822 16:381951-381973 GGTCCCCGCCGCCGTCGCCCCGG + Exonic
1132560199 16:590055-590077 CCGCCGCGCCGCCCCACCCCCGG - Intronic
1132560225 16:590125-590147 GCCCCGCCCCGCCCGCGCCCGGG - Intronic
1132585806 16:705395-705417 GGGCCGCGCCGCCGCCGCCCGGG - Intronic
1132734718 16:1379692-1379714 GCGCCCCGCCCCCTCCGCGCTGG + Intronic
1132779367 16:1614360-1614382 GCGCCCTCCCGCCGCCGGCCCGG + Intronic
1132843588 16:1990126-1990148 GGGCCGCGCAGGGGCCGCCCTGG + Exonic
1132848051 16:2009727-2009749 GCGCCCCCCGGCCGCCGCCATGG + Exonic
1132856660 16:2048040-2048062 GCGCCGCGCCACCGCGCTCCGGG - Exonic
1132865626 16:2091448-2091470 GCGCTGCGCCGCCTCAGCGCGGG - Exonic
1132889546 16:2196913-2196935 GCCCCGCGCCGCCGCCGCGTCGG - Intergenic
1132897745 16:2236967-2236989 ACGCCGCCCCGCCCCGGCCCGGG - Intronic
1132970003 16:2682584-2682606 GCCCCGCCCCGATGCCGCCCCGG - Exonic
1132987812 16:2777184-2777206 GCCCCCCGCCGCCCCCGGCCCGG + Intronic
1133021557 16:2969179-2969201 GCTCCGCCCCGAGGCCGCCCAGG - Intronic
1133156347 16:3879796-3879818 GCCCCGGGCCCCCGCCGCCCCGG + Intronic
1134539921 16:15055997-15056019 GCGGGGGGCCGCCGCCTCCCTGG - Exonic
1135034732 16:19067675-19067697 GCGGGGAGCCGCCGCCGCCCCGG - Exonic
1135335806 16:21599918-21599940 GGGCCGCCACGCCCCCGCCCCGG - Intronic
1137327990 16:47461025-47461047 GAGCCGGCCCGCCGCCGCCATGG + Exonic
1137426559 16:48385348-48385370 GCGCCCCGCAACGGCCGCCCCGG + Intronic
1137683092 16:50368448-50368470 GGGCGGCGCCGCCGCACCCCCGG - Intronic
1138619260 16:58198231-58198253 GCCCCGCCCCGGCCCCGCCCCGG + Intergenic
1139364817 16:66427009-66427031 GCACCGCGGCGCCGCGGCCCGGG - Intergenic
1139364829 16:66427042-66427064 GAGCCGCGCCGCCGCCGAGGGGG + Intergenic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1139467776 16:67163425-67163447 GCGTTGCGCCGCCGCCACCCTGG + Exonic
1139489596 16:67279300-67279322 GCCCCGCCCCGCCGCACCCCCGG - Exonic
1139637121 16:68264524-68264546 CGGTCGCGCCGCCGCCGCCGCGG - Intronic
1140442775 16:74999739-74999761 GCGCCGTGCCGCCGCCGGGAGGG + Exonic
1140478778 16:75251585-75251607 CCGCCGCGCAGCTGCCGCCTCGG + Intronic
1141709397 16:85689127-85689149 GCTGCGCGCCGGCCCCGCCCCGG + Intronic
1141989676 16:87602753-87602775 GCGCCGCGCCGAGGCCGGGCGGG - Intronic
1142124694 16:88404359-88404381 ACGCACCGCCGGCGCCGCCCAGG - Intergenic
1142249358 16:88984002-88984024 GCGACGTGCCGGTGCCGCCCCGG + Intergenic
1142671221 17:1488233-1488255 GGGCCGCGCCGCCGCATTCCCGG + Intronic
1142672021 17:1491754-1491776 GCCCCGCCCCGCCTCAGCCCCGG + Intronic
1142764080 17:2056123-2056145 TCCCCGCGCGGCCGCCGCCCGGG + Intronic
1142863351 17:2776615-2776637 TCGCCGCGCCTCCGCCACCCGGG - Intergenic
1143030475 17:3964485-3964507 GCCCCGCGCCGCCCCGCCCCGGG - Intergenic
1143164771 17:4892357-4892379 GCGCCCCCCCGCCGCCCCCTCGG + Intronic
1143583918 17:7842119-7842141 GCGCAGCGCCGCAGCCGCGCGGG - Intronic
1144500847 17:15786233-15786255 CCGCCGGACCCCCGCCGCCCCGG + Intergenic
1144527181 17:15999990-16000012 GCGCCGCACGGCCGGGGCCCAGG + Exonic
1144756186 17:17681839-17681861 GCCTCGCGCCGCCCCCGCCCCGG - Intronic
1144756483 17:17682840-17682862 CCGCCGCGCCCCCGCCAGCCCGG - Intronic
1145163008 17:20588895-20588917 CCGCCGGACCCCCGCCGCCCCGG + Intergenic
1146398592 17:32487098-32487120 GCGCCGCGGCCCCGCCGCCGCGG - Exonic
1147612852 17:41811918-41811940 CCGCCGCGCCGCCGGCTCTCCGG + Exonic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1147931488 17:43984097-43984119 GGGCCGCCCCGCCGCCCCCTCGG - Intronic
1147971537 17:44220985-44221007 CCTCGGCGCCGCCGCCTCCCGGG + Intronic
1148021807 17:44558234-44558256 GGGGAGCGCCGCCGCCGCCCGGG - Exonic
1148426591 17:47603166-47603188 CCGCCGCGCCTCAGCCTCCCTGG - Intronic
1149430653 17:56593886-56593908 GCCCTGCGCCGCCGCCGGCCCGG + Exonic
1150217211 17:63477357-63477379 GCCCCGCCCCGCCCCCGCCCGGG - Intergenic
1150675889 17:67245525-67245547 GCGCCGCGCCGCGGGCGGCAAGG - Intronic
1151745271 17:76008528-76008550 GCGCCGTGCCTCCTCCTCCCGGG + Exonic
1151857933 17:76736598-76736620 GCCCCGCGCCGCCCACACCCCGG + Exonic
1151954390 17:77373270-77373292 CCGCCCCGCCCCCGCCTCCCGGG - Intronic
1152222142 17:79074804-79074826 CCGCCGCGCGGCCGCTGGCCGGG + Intergenic
1152222151 17:79074847-79074869 GCGCAGCGCTGACGCCGCGCTGG - Intergenic
1152363853 17:79844288-79844310 GCGACGCGCGGCCGCGGCTCCGG - Intergenic
1152552191 17:81035386-81035408 GCGCGGCCCCGGGGCCGCCCTGG - Intronic
1152552318 17:81035706-81035728 GCCCGCCGCCCCCGCCGCCCCGG - Intronic
1152790013 17:82273722-82273744 GCGCCGCGGCCCCGCCCCGCCGG - Exonic
1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG + Intergenic
1154174504 18:12076623-12076645 GCGCGGCCCCGCCGGCGTCCGGG + Intergenic
1154303998 18:13217801-13217823 GCGCGCCGCCGCGGCCGGCCGGG + Intronic
1155053825 18:22169044-22169066 GTCCCGCGCCGCCGCCGCGGCGG - Intergenic
1156118968 18:33820256-33820278 GCGCCGGGCCGGCGCCCACCCGG + Intergenic
1156118980 18:33820284-33820306 GCGCCGGGCCGGCGCCCACCCGG + Intergenic
1156118992 18:33820312-33820334 GCGCCGGGCCGGCGCCCACCCGG + Intergenic
1156119004 18:33820340-33820362 GCGCCGGGCCGGCGCCCACCCGG + Intergenic
1156119016 18:33820368-33820390 GCGCCGGGCCGGCGCCCACCCGG + Intergenic
1156119028 18:33820396-33820418 GCGCCGGGCCGGCGCCCACCCGG + Intergenic
1156119040 18:33820424-33820446 GCGCCGGGCCGGCGCCCACCCGG + Intergenic
1156119052 18:33820452-33820474 GCGCCGGGCCGGCGCCCACCCGG + Intergenic
1156119064 18:33820480-33820502 GCGCCGGGCCGGCGCCCACCCGG + Intergenic
1156119076 18:33820508-33820530 GCGCCGGGCCGGCGCCCACCCGG + Intergenic
1156119088 18:33820536-33820558 GCGCCGGGCCGGCGCCCACCCGG + Intergenic
1156250152 18:35344526-35344548 GGGCCGCCCCTCCCCCGCCCGGG - Intronic
1157446337 18:47749279-47749301 GCGGCGCGCGGCGGCCGCCAGGG - Intergenic
1157496751 18:48161940-48161962 GCGCCGGGCCGCGGCCTCCCGGG - Intronic
1157614086 18:48976523-48976545 GCGGAGCGCCGCCGCCTCCCTGG + Intergenic
1157849043 18:51030460-51030482 GCGCCGCGCCGCTGCCCGCGCGG - Exonic
1157867147 18:51197084-51197106 GCCCTGCGCCGCCGCTGCCGGGG + Exonic
1158976691 18:62716436-62716458 GCCCGGAGCCGCCGCCGCCCGGG + Exonic
1159008590 18:63037199-63037221 GGGCCACCCCGCCCCCGCCCCGG + Intergenic
1159040704 18:63320458-63320480 CCACCGCGCCGCGGCCGCGCGGG - Intergenic
1159798222 18:72868194-72868216 GCTGCGCGCGGCCGGCGCCCCGG + Intergenic
1160204467 18:76822177-76822199 GCCCCGCGCCTCCGTGGCCCGGG - Exonic
1160453599 18:78980679-78980701 CCGCCGCCGCGCCGCCCCCCAGG + Intronic
1160500748 18:79400253-79400275 CCGCCCCGCCCCCGCCCCCCGGG - Intronic
1160577249 18:79863688-79863710 GGGTCCCGCCGCCGCCGCCCGGG - Exonic
1160706306 19:531784-531806 CTGCGCCGCCGCCGCCGCCCGGG - Exonic
1160706345 19:531913-531935 GGGCCCCTCCGCCGCCGCCATGG + Exonic
1160745552 19:709388-709410 GGCCCGAGCCGCCGCTGCCCGGG - Intronic
1160804115 19:984264-984286 GGGCCGCGGGGCCGCCGCTCTGG + Exonic
1160858711 19:1228711-1228733 GCGCCCCGCGGCCCCCGCCCGGG + Exonic
1160930464 19:1567639-1567661 CCCCGCCGCCGCCGCCGCCCCGG - Exonic
1160930702 19:1568310-1568332 CCGCGCCGCCGCCGCCGCCTCGG - Intergenic
1160930758 19:1568446-1568468 GCCCGGCGCCGGCCCCGCCCCGG - Intergenic
1160957090 19:1698775-1698797 GAGCCGCGCTTCCGCCCCCCCGG - Intergenic
1160991603 19:1862583-1862605 GAACCGCGTCGCCGCCGCCGGGG - Intronic
1161048897 19:2151632-2151654 GCCCCGCCCCGCCACCTCCCCGG + Intronic
1161101820 19:2425278-2425300 GCCCCGCACCACCGCGGCCCCGG - Intronic
1161130976 19:2588533-2588555 GCGTCCAGCTGCCGCCGCCCTGG - Intronic
1161233235 19:3186008-3186030 GCGCGGCCCCGCCGCCGGCCAGG + Exonic
1161384884 19:3985591-3985613 GCGCCGCGCCGGCGCCGAATGGG - Intergenic
1161450635 19:4343612-4343634 GCCCCGCGCCTCCGCCCCGCTGG - Intronic
1161682445 19:5686994-5687016 GCTCCGCTCCTCCGCGGCCCCGG + Intronic
1161703246 19:5805938-5805960 GCTCGCCGCCGCCGCCGCCGGGG + Intergenic
1162535826 19:11262448-11262470 GCGTCCCGCCGCCGCCGCCCCGG + Exonic
1163426911 19:17245225-17245247 GCGCCCCGGCCCCGCTGCCCTGG - Exonic
1163529765 19:17842492-17842514 GCGCCGCGTGGCCGCCTGCCAGG - Exonic
1163631398 19:18419623-18419645 GCTCCACGCCGCCGCCGCCGGGG - Exonic
1163708621 19:18832368-18832390 CTCCCGCGCCGCCACCGCCCGGG - Exonic
1163845778 19:19637492-19637514 CCCCCGCGCCTTCGCCGCCCTGG - Exonic
1164834724 19:31349760-31349782 GGGACGCGCAGCCGCCGCCGCGG + Intergenic
1164835081 19:31350766-31350788 CCGCTCAGCCGCCGCCGCCCGGG - Intergenic
1165058640 19:33194460-33194482 GAGCCCCGCCGCGGCCGGCCTGG - Intronic
1165080258 19:33302610-33302632 GCGCCGCGCCGCCGCAGCCCGGG - Intergenic
1165089157 19:33373690-33373712 GCGCGCCGCCGCCGCCATCCCGG - Exonic
1165459601 19:35936686-35936708 CAGCCGGGACGCCGCCGCCCCGG + Intronic
1165939827 19:39409609-39409631 GCGCGGCGCCCCCGACGCCCGGG - Intergenic
1166290530 19:41860476-41860498 GCACCCCGCCGCTGCCCCCCGGG - Intronic
1166361673 19:42255130-42255152 CCTCCCCGCCGCCGCCTCCCGGG + Exonic
1166986115 19:46660827-46660849 GCGCCGGGCCGCAGCGGCCCTGG - Exonic
1167251062 19:48398607-48398629 GCTGCGCACCGCCGCCGCCACGG - Exonic
1167738764 19:51311880-51311902 GCTTCTCGCCGCCGCCGCCCTGG + Exonic
1168258585 19:55180232-55180254 GCTCCGCGGCTCCCCCGCCCCGG - Exonic
1168315152 19:55481868-55481890 GCACGGCGCCGCCCCCGCCCCGG + Exonic
1202681423 1_KI270712v1_random:7112-7134 GCCCTCCGCCGCCGCCGCCCCGG - Intergenic
924962367 2:46284-46306 ACGCCGCGCGGCCGGCGCGCAGG - Exonic
925959853 2:9004051-9004073 GCGCCTCGGCGCCCTCGCCCGGG - Intergenic
926018556 2:9474908-9474930 GCCCCGCGCCGCCTCCCACCCGG + Intronic
926095684 2:10079810-10079832 GCGCAGCGCGACCGGCGCCCAGG + Intronic
926422931 2:12716832-12716854 GCCCCGCCCCGCCCCCGCCCGGG - Intergenic
927809400 2:26173191-26173213 GCGCCCCGGGGCCGCCGTCCCGG - Exonic
927904525 2:26847659-26847681 GGGCAGCGCGGCCGCAGCCCGGG + Intergenic
927904618 2:26847943-26847965 GCCGCGCGCCGCCGCCGCCTGGG - Intronic
929188695 2:39120705-39120727 CCGGCCCGCCGGCGCCGCCCCGG + Intronic
929468639 2:42169385-42169407 GCGCCGCTCAGCCGCCTGCCCGG - Exonic
929701900 2:44169316-44169338 CGGCCGCGCCGCCGAGGCCCCGG + Intronic
929857762 2:45650871-45650893 GCCCAGCGCCGCCGCACCCCGGG + Intergenic
929966879 2:46542919-46542941 GCGCCGCAGGGCCGCCCCCCCGG - Exonic
930700834 2:54456689-54456711 TCCCCGCGCCGCCCCCGCCCGGG - Intronic
931746007 2:65292586-65292608 TCACCTCGCCTCCGCCGCCCAGG - Intergenic
932316939 2:70790697-70790719 CCCCCGCCCCGCCCCCGCCCGGG - Intergenic
933666981 2:84971628-84971650 CCGCGGCGCCGCTGCCGCCACGG + Intronic
933684633 2:85133495-85133517 GAGCCGAGCCGCCTGCGCCCCGG + Exonic
933829418 2:86195057-86195079 GGGCCGCGCTGCCCCCGTCCAGG - Intronic
934618524 2:95790073-95790095 GCGCCCCACAGCCCCCGCCCAGG - Intergenic
934642369 2:96034486-96034508 GCGCCCCACAGCCCCCGCCCAGG + Intronic
935265106 2:101387178-101387200 GCCCCGGGCGGGCGCCGCCCGGG - Exonic
935692680 2:105745071-105745093 GCGCAGCGCGGCCACCGCCCCGG + Exonic
936038176 2:109129115-109129137 ACGCCGCGCCCCGGCCTCCCCGG + Intergenic
937221308 2:120344568-120344590 CCGCCTCCCCGCCGCCGCGCAGG - Intergenic
938796026 2:134718870-134718892 CCACCGTCCCGCCGCCGCCCCGG - Exonic
939969667 2:148644971-148644993 CCGCCCCGCCGCCGCCGCCCGGG + Exonic
941020853 2:160407274-160407296 TGCCCTCGCCGCCGCCGCCCGGG - Intronic
941384863 2:164841122-164841144 GCGCCGCGCCGCCTCTCACCGGG - Intronic
941934686 2:170973673-170973695 GCGACGCCCCGGCCCCGCCCAGG - Intergenic
941951496 2:171160835-171160857 GCCCGCCGCCGCCGCCTCCCGGG - Intronic
942046552 2:172102430-172102452 GGCCGGCGCCGCCGCCGCTCGGG + Exonic
942890493 2:180981011-180981033 CCCCACCGCCGCCGCCGCCCCGG - Intronic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
942947321 2:181684302-181684324 CCGACGCGGCGCCTCCGCCCCGG + Intergenic
943060673 2:183038565-183038587 TGGCCTCGCCGCCGCCGCTCTGG + Exonic
943185165 2:184598312-184598334 GCGCGGCGCCGCTGCCGCAGAGG - Intergenic
944221718 2:197310384-197310406 CCGCCGCGCCGTCCCCGCCCTGG - Intronic
944457616 2:199911540-199911562 GCGCGCCGCCGCTGCCGCCCGGG - Exonic
945673761 2:212832133-212832155 GCGCCCTGCCTCCGCCGCCATGG + Intergenic
946248566 2:218400231-218400253 GGGAGCCGCCGCCGCCGCCCCGG + Intronic
946354860 2:219178291-219178313 GGGCTGCGCGGCCGCCGCCGGGG - Exonic
946378962 2:219331775-219331797 GCCCAGCGCCGCCGCCACGCTGG - Intronic
946386878 2:219388581-219388603 GCGACCCGCAGCCGCCGCCAGGG + Intronic
946422214 2:219571303-219571325 GCGCCCCGACCCCGCCGCCCCGG - Intronic
948393339 2:237627574-237627596 GCGCCGCCCCGGCCCGGCCCCGG - Intronic
948438130 2:237967399-237967421 GTCCCCCGCCGCCGCCGCCGCGG - Intronic
948805710 2:240452815-240452837 GGGCAGCGCCGCAGCCGCACTGG - Intronic
948824653 2:240568411-240568433 GCTCCGCTCGGCCGCCGCCGGGG - Intronic
948874372 2:240819275-240819297 GCGGCGCGCCCCCGGCGCCCGGG - Intronic
1169065483 20:2692619-2692641 CCGCCCCGCCGCCGCGGCCCGGG + Intergenic
1169074464 20:2752451-2752473 CCGGCGCGCCGTAGCCGCCCAGG - Exonic
1169164106 20:3407664-3407686 GCGCCGCGCCCCCTCCCACCCGG - Intergenic
1169214727 20:3786510-3786532 CGGCGCCGCCGCCGCCGCCCCGG + Exonic
1170204691 20:13785296-13785318 CCGCCGCCCCGCCGCCCCGCGGG - Intronic
1171446336 20:25207207-25207229 GCACCGGGCCACCGCCACCCAGG + Exonic
1172015428 20:31870257-31870279 GCGCCGGGCCGCGGCGGCCGGGG + Intronic
1172209255 20:33185554-33185576 GCGCCTCTGCCCCGCCGCCCCGG - Intergenic
1172284735 20:33732392-33732414 GCGCCGCCAAGCCGCCTCCCTGG - Intronic
1172474483 20:35226750-35226772 CCGGCGCGGCGCGGCCGCCCCGG - Exonic
1172756588 20:37289659-37289681 GCGCCGCCGCGCCGCTCCCCCGG - Intronic
1174246856 20:49188153-49188175 CCTCCTCGCCGCCACCGCCCAGG - Exonic
1174506948 20:51023115-51023137 GCGCGGCGCAGCAGCCGCCGAGG + Exonic
1174607081 20:51768621-51768643 GCGCCGCGCCGCGCCTGCCACGG + Exonic
1175715823 20:61253410-61253432 CCGCCCCTCCGCCTCCGCCCAGG - Intronic
1175859401 20:62142588-62142610 GGGCCGGGCTGCAGCCGCCCGGG - Intronic
1175894041 20:62328210-62328232 GGGCCGCGCTGACGCCGCTCTGG + Intronic
1176068914 20:63216002-63216024 CCGCCGCCCGGCCGGCGCCCGGG - Exonic
1176159692 20:63641918-63641940 GCTCCGCCCCGGCCCCGCCCCGG + Intronic
1176221155 20:63969853-63969875 GCGCCCCGCGCCCCCCGCCCCGG - Intronic
1176380696 21:6111024-6111046 CTGCCCCGCCCCCGCCGCCCGGG - Intergenic
1176548360 21:8211521-8211543 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176548596 21:8212230-8212252 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176556490 21:8256438-8256460 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176567291 21:8394556-8394578 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176567527 21:8395265-8395287 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176575429 21:8439480-8439502 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1178513837 21:33229905-33229927 GCGCCGCGCCGCCGCCGGCGCGG - Intronic
1178610340 21:34073866-34073888 CCGCCGCCCGCCCGCCGCCCCGG - Intronic
1178916702 21:36709032-36709054 GCGTCTCCCCGCCGCCTCCCCGG - Intronic
1179742776 21:43427216-43427238 CTGCCCCGCCCCCGCCGCCCGGG + Intergenic
1179891817 21:44339087-44339109 GGGCCTGGCCGCGGCCGCCCCGG - Intronic
1180650003 22:17369665-17369687 GCGCCCCGCCGCCCCCGCCGAGG + Exonic
1180843598 22:18970352-18970374 GCGCCCCCCAGCCCCCGCCCAGG + Intergenic
1180843612 22:18970378-18970400 GCGCCCCCCAGCCCCCGCCCAGG + Intergenic
1180871412 22:19149224-19149246 GTGGCGCGCAGCCGCGGCCCGGG - Intronic
1180960607 22:19760750-19760772 GCGCCGCGCTGCGTGCGCCCCGG - Intronic
1181067354 22:20313216-20313238 GCACCCCCCCGCCCCCGCCCAGG + Intergenic
1181082845 22:20425756-20425778 TCGCTGCGCCCTCGCCGCCCAGG - Exonic
1181087707 22:20449957-20449979 AAGCGTCGCCGCCGCCGCCCCGG - Intronic
1181094441 22:20495888-20495910 GCGCCGCGCAGGCGCCGGGCGGG + Intergenic
1181457939 22:23070309-23070331 GCGCCGCGCCGCCGCCGGCAGGG - Intronic
1181478117 22:23180895-23180917 GCGCCGCGCCGCCGCTGAGACGG + Exonic
1181831744 22:25565236-25565258 GCGCTGAGCCTCCGCTGCCCCGG + Intronic
1182335556 22:29581123-29581145 GCGCCCCGCCTCCGCCACCAGGG - Exonic
1183162480 22:36124116-36124138 GCGCTGCGCAGCCGCAGCCCGGG - Intergenic
1183294144 22:37019818-37019840 GCGCCGCGCCGCGGGGGCCATGG + Intronic
1183525001 22:38317492-38317514 CCGGCCCGCCGCCGCCGCCCCGG + Intronic
1183600280 22:38835923-38835945 GAGACGCCCCCCCGCCGCCCCGG + Intronic
1183683769 22:39350209-39350231 CCGCCGCCGCGCCGCCGCCGGGG - Intronic
1183744819 22:39686222-39686244 CCGCCCCCACGCCGCCGCCCTGG + Exonic
1183912948 22:41092442-41092464 CCGCGCCGCCGCCGCCGCACCGG - Exonic
1184086834 22:42270466-42270488 GGCCCGCCCCGCCGCCGGCCCGG - Intronic
1184228267 22:43143178-43143200 TCGCCGCTCCGTCGCCGCCCAGG + Exonic
1184265367 22:43343348-43343370 TCGCCGCTCCGCCACCGCTCGGG + Exonic
1184562054 22:45269129-45269151 GCGCGGCACCGCCCCCTCCCCGG + Intergenic
1184680696 22:46071075-46071097 CCGGCCCGCCCCCGCCGCCCTGG - Intronic
1184681131 22:46072547-46072569 GCGCGGCGCCGGCGGCGGCCAGG + Intronic
1184759410 22:46536475-46536497 CCGTCGCGCCGGCCCCGCCCGGG + Exonic
1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG + Intergenic
1185301455 22:50083345-50083367 ACGCAGCCCCGCCGCAGCCCAGG + Intronic
1185313824 22:50170433-50170455 GCGCTCCGCCGCCGCCCCCGGGG - Intergenic
1185395218 22:50583192-50583214 CCGCCGCCCCGCCGCCCCGCCGG - Intronic
1203261534 22_KI270733v1_random:173613-173635 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
950253919 3:11488530-11488552 GCGCCGCTGCGCTGCGGCCCGGG - Intronic
952451876 3:33440416-33440438 GCCCCGCCCCGACCCCGCCCCGG + Intronic
952764842 3:36944914-36944936 GCATCGCGCCGCCCCTGCCCCGG - Exonic
952816476 3:37452054-37452076 CCGTCCAGCCGCCGCCGCCCGGG + Intergenic
952816629 3:37452588-37452610 GGCCCGCGCGGCCACCGCCCCGG + Intronic
953982167 3:47418397-47418419 TCCCCGCGCCTCCGCCGCCCGGG + Exonic
954004014 3:47578311-47578333 GCCCCGCCCCGGCCCCGCCCCGG + Intronic
954367814 3:50155515-50155537 CCGTGCCGCCGCCGCCGCCCGGG + Exonic
954632860 3:52056470-52056492 GAGCTGCGCGCCCGCCGCCCCGG + Exonic
954664756 3:52245871-52245893 TCCCCGCGCCGCGGCCGCCTGGG + Intronic
955368741 3:58332960-58332982 ACGCCCGGCCGCCGCCGCCTAGG - Exonic
955911661 3:63864179-63864201 CCGCCGCACCCCCGCAGCCCTGG - Intergenic
958932745 3:100225252-100225274 CCGCCGTGCCACCGCAGCCCAGG - Intergenic
961259798 3:125593138-125593160 GTGGGGCGCCGCCGCGGCCCTGG - Intronic
962263178 3:133927704-133927726 CCGCCCCTCCGCCGCGGCCCGGG - Intergenic
963133248 3:141877036-141877058 GCACTGCGCCGCCGCCGCCCGGG - Intronic
963904455 3:150762657-150762679 CGGCCCCGCCGCCGCCGCCGGGG + Exonic
966355102 3:179071620-179071642 TCTCCGCGCCGCGTCCGCCCGGG + Exonic
966849429 3:184155553-184155575 GCCGCGCGCCGCCGCCGTCTGGG + Exonic
966852742 3:184174831-184174853 CCGCCGCCCCGCCCCGGCCCCGG - Intronic
966866136 3:184260058-184260080 GCGCCCCCCCGCCCCGGCCCAGG - Exonic
966866498 3:184261438-184261460 CCCCCGCGCCTCCGCCTCCCGGG + Exonic
966874520 3:184314761-184314783 GCGCCGCCGCCCCGGCGCCCTGG + Intronic
966878929 3:184338823-184338845 GCTCCGCGCAGCTGCGGCCCAGG - Intronic
966886465 3:184380208-184380230 CCGCCGCACCGCCCCCGGCCCGG + Exonic
967068037 3:185937988-185938010 GCTCCGCACCGCCTCCGCACGGG + Exonic
967118193 3:186360938-186360960 GCGCTGCGCCGCTGCCTCCTCGG - Intronic
967207811 3:187139538-187139560 GCCCCGCCCCGGCCCCGCCCAGG + Intronic
967904030 3:194486585-194486607 CCGCCGCGCCGCCTCCTCCGCGG + Intronic
968235913 3:197029889-197029911 GGGGCGCGCCGGGGCCGCCCAGG - Intergenic
968382389 4:107740-107762 TTCCCGAGCCGCCGCCGCCCGGG - Intergenic
968514981 4:1012014-1012036 GCCCCTCCCCGCCCCCGCCCCGG - Intronic
968556593 4:1248995-1249017 GCGCTGCGCCGCCGCGAGCCCGG + Exonic
968659642 4:1793711-1793733 GCCCGCCGCCGCCGCCGCCCAGG - Intronic
968775449 4:2537019-2537041 GCGCAGCGCCGCCGCCGGGCCGG - Intronic
968835792 4:2963577-2963599 GCCCCTCGCCGCCGCGGCCGGGG - Intergenic
969240382 4:5893122-5893144 GCCCCGCCCCGGCCCCGCCCCGG - Intergenic
969873078 4:10116597-10116619 CCGCCGCGCTGCCCCGGCCCCGG - Intronic
970456350 4:16226993-16227015 GAGCCGGGCCCCCGCCGCCGCGG - Intronic
970637052 4:18021447-18021469 GCGGCGCGGCGCGGCGGCCCCGG - Intronic
971018961 4:22515753-22515775 GCGCGGCCCCGCCGGCGTCCGGG + Exonic
971244084 4:24912928-24912950 TCGCGTCGCCGCCGCCGCCCGGG + Intronic
971457809 4:26860794-26860816 CTCCCGCGCCGCCGCCGCCGCGG - Intronic
972396453 4:38663529-38663551 GCGCCGCGCCGCGCCGGCCGCGG + Intergenic
973137316 4:46724426-46724448 GCGCCCTGCCGCCGCCGCCGCGG - Intergenic
975166715 4:71186589-71186611 GAGCCGCGCCGCCTCCGCCGGGG - Intergenic
975870689 4:78776093-78776115 CCGTCGCGCCGCCGCCGCCCCGG - Intergenic
976390018 4:84497707-84497729 GCCCGCCGCCGCCGCCGCCCGGG - Exonic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
979547168 4:121951565-121951587 GAGCCGCAGCGCCGCCGCCGGGG - Exonic
980930412 4:139177932-139177954 GCGCGACGCCGGCCCCGCCCCGG + Intergenic
982712205 4:158768942-158768964 CCGCGCCGCCGCCGCCGCCGTGG + Intergenic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
983218176 4:165020267-165020289 GCGCCTCTGCCCCGCCGCCCCGG - Intergenic
983229133 4:165112485-165112507 GGGCCGCGCGCCCACCGCCCAGG + Intronic
984462995 4:180059167-180059189 GAGCGGAGCCGCCGCCGCCGCGG - Intergenic
984776216 4:183483368-183483390 CCGCCGCGCCACCGCTGCCCAGG - Intergenic
984823625 4:183905820-183905842 GAGCAGCGCTGCCGCCGCGCGGG + Exonic
985549015 5:523995-524017 GAGCCGCGCGGCGGCCGCCCGGG - Intronic
985660888 5:1155991-1156013 GCGCCGCGCGGCCCCATCCCCGG - Intergenic
985713721 5:1444701-1444723 CCGGCAAGCCGCCGCCGCCCTGG + Intronic
985896299 5:2751570-2751592 CCGCCACCCCGCCGCCGCCCCGG - Exonic
985897317 5:2756445-2756467 GCGCCCCGCCCCCTCCCCCCAGG + Intergenic
987374011 5:17217831-17217853 GCCCCGCGCCGCCGCGGACCCGG + Intronic
989576457 5:42992663-42992685 CAGCGCCGCCGCCGCCGCCCGGG - Intergenic
989584813 5:43066507-43066529 GCCCAGCGCCGGCGTCGCCCGGG + Intronic
990557778 5:56952294-56952316 GCCCCTCGCCGCCCCCGCGCCGG + Intronic
991435851 5:66596609-66596631 GCGCCGCGCCCCCGCCGCTCGGG + Exonic
993716558 5:91280653-91280675 GCCCCGGGCTGCGGCCGCCCAGG - Intergenic
993900934 5:93584153-93584175 CCGCGGCGCCGCCGCTGTCCCGG - Exonic
994353835 5:98773860-98773882 GCGCCCCGCTGCTGCCGCCGCGG + Intronic
995047913 5:107671135-107671157 GCACGGCTCCGCCACCGCCCGGG + Intergenic
995342257 5:111073033-111073055 GCTCCGGGACGCCGCCGCCGGGG + Intronic
996329354 5:122312059-122312081 GCTTCGGGCCGCGGCCGCCCAGG + Exonic
997975375 5:138438957-138438979 GGGGCGCGCCGCCGCCGCCGCGG + Intergenic
997975376 5:138438960-138438982 GCGCGCCGCCGCCGCCGCGGCGG + Intergenic
997990803 5:138543133-138543155 CCGCCGCGGAGCCGCCGCCGGGG - Exonic
998166675 5:139848292-139848314 GCGCGCCCCCGCCGCCGCCGCGG - Exonic
999768432 5:154757008-154757030 GCGCCGCGCCGGCGGCCCGCGGG + Intronic
1001065072 5:168529582-168529604 CCGCGCCGCCGCCGCCGCCTCGG - Exonic
1002190178 5:177473733-177473755 GCGCCGCCCCGGCCCGGCCCAGG + Intronic
1002559474 5:180071775-180071797 GCGCGCTCCCGCCGCCGCCCGGG - Exonic
1002645248 5:180649571-180649593 GCCCCGAGCCGCGGCCGCTCGGG - Exonic
1002666771 5:180831184-180831206 GCCCGCCGCCGCCGCCGCCTCGG + Intergenic
1002889038 6:1317657-1317679 GCACAGCGGCGCCGCCGTCCCGG + Intergenic
1003049234 6:2765354-2765376 GCGAGGCGCCTCCGCCGCCGGGG + Intergenic
1003139303 6:3457224-3457246 ACGCGCGGCCGCCGCCGCCCGGG + Intergenic
1003545013 6:7051855-7051877 GCGCCGCGCAGCCCCCGGCCCGG + Intergenic
1003869657 6:10391395-10391417 GCACCGCGCTGCCTCCTCCCAGG + Intergenic
1004193874 6:13487274-13487296 CGGCCGCGCCGCCGCAGCCCGGG + Exonic
1004241329 6:13925002-13925024 GCCCTGGGCCGCCGCCGGCCAGG + Exonic
1004720429 6:18264162-18264184 CCGCTCCGCCGCCGCCGTCCAGG + Intronic
1006369162 6:33633683-33633705 ACGACGCGCCGCCGCCGCCAAGG - Intronic
1006759007 6:36442986-36443008 GCGGCGCGCGCCCCCCGCCCCGG - Exonic
1007154061 6:39725206-39725228 GCCCCGCCGCGCCGGCGCCCCGG + Intronic
1007444511 6:41895019-41895041 GCCTCCCGCCGCCCCCGCCCCGG + Intronic
1008092840 6:47309705-47309727 GCCCAGCGGCGCGGCCGCCCAGG + Exonic
1011128735 6:84033707-84033729 GCCCCGCGCCGCCTCCGCTGCGG + Intergenic
1011607373 6:89118093-89118115 GGGCGGCGCCGGCGCGGCCCAGG + Intergenic
1011734214 6:90296254-90296276 GCGCGGCGCGGCCGCCGGCTCGG + Intronic
1012939670 6:105403215-105403237 CGGCCGCGCCCGCGCCGCCCGGG + Intergenic
1013117468 6:107114441-107114463 GCTCCCGGCCGCCGCCGCCGCGG + Intronic
1013230565 6:108158019-108158041 GCGCCGCCCCCCCGCGCCCCCGG + Intronic
1013273255 6:108561081-108561103 GGGCGCCGCCGCCGCCGCCTGGG - Exonic
1015149080 6:130019254-130019276 GCGCCGCGGAGCCGCAGCCCAGG + Intronic
1015149246 6:130019924-130019946 GTGCCGCGCCGCGCCGGCCCGGG + Intronic
1015910241 6:138162051-138162073 GCGCCGGGCCGCCGCCCACAGGG - Exonic
1015965513 6:138692850-138692872 TCGGCGCCCCGCCGCTGCCCGGG - Intergenic
1016863960 6:148747768-148747790 ACCGCGCGCCGCCGCCGCCCCGG + Intronic
1016923217 6:149317067-149317089 GCGCGGCGCCGCCGGCCGCCCGG + Intronic
1016937257 6:149456618-149456640 CCCCCGCCCCGCCGCCCCCCAGG + Intronic
1016949447 6:149566256-149566278 GCGCCTCTCCGCGGCCGCCCGGG + Intergenic
1017164119 6:151391391-151391413 GCGCACCGCCTCCGCCTCCCGGG - Intronic
1017671832 6:156777195-156777217 CCGCCGAGCCGCCCCGGCCCCGG + Intergenic
1017738204 6:157381903-157381925 GGGCCGCGGCGCCGCGGCTCGGG + Exonic
1017877404 6:158536416-158536438 GCGCCCATCCGCCGCCGCCCCGG - Exonic
1017877650 6:158537224-158537246 CCGCCTCGCCGCCCCCGCTCGGG + Intronic
1018876502 6:167826800-167826822 GCGCGGCGCCGCCGCACCTCCGG - Intergenic
1019048913 6:169168429-169168451 GCCTGGCGCCGCCGCCGCCCTGG - Intergenic
1019111932 6:169724023-169724045 GCGCGGGCCCCCCGCCGCCCCGG + Exonic
1019197476 6:170290848-170290870 GCTCTGCGCCGCGGCTGCCCGGG + Intergenic
1019472877 7:1230425-1230447 CCGCGGCGCCGCCGCAGCCGAGG + Intergenic
1019711350 7:2519555-2519577 GCCCCGCACCCCCCCCGCCCCGG - Intronic
1019743772 7:2688417-2688439 GCCCGTAGCCGCCGCCGCCCGGG - Intronic
1019765099 7:2844178-2844200 GCCGCGCCCCGCCGGCGCCCGGG + Exonic
1020238524 7:6374696-6374718 GCGCCCTGCCGCCGCCGCCGCGG + Exonic
1022100248 7:27165146-27165168 GTCCGGCGCCGCCGCCGCCACGG + Exonic
1022113790 7:27246284-27246306 GCCCCGGGCTGCCGCCGCCTCGG + Exonic
1022363357 7:29685001-29685023 CCGCCGCGGCGCCGCCGGGCTGG + Intergenic
1022814999 7:33905212-33905234 CTGCCGCTCAGCCGCCGCCCGGG - Intronic
1023064845 7:36367029-36367051 CCGCCGCGCCCCCGCCACCGAGG - Intronic
1024075090 7:45814035-45814057 TCGCCCCACCGCGGCCGCCCGGG - Intergenic
1024472140 7:49775344-49775366 GGGGCGCGCCGCCGCCAGCCGGG - Exonic
1025777298 7:64570383-64570405 GCTTCTCGCCGCCGCCGCCCTGG - Intergenic
1027001770 7:74658612-74658634 GCGCGGCCCCGCCCCCGCGCCGG - Intronic
1027051585 7:75024713-75024735 GCTCCTCCCTGCCGCCGCCCGGG + Exonic
1028477286 7:91265666-91265688 CCGACGCGCCGGCGCCCCCCGGG - Exonic
1029149683 7:98470911-98470933 TCGCCGCGCCCCCGCCCCCCAGG + Intergenic
1029461071 7:100694134-100694156 GCCGCGCGCCGCCCACGCCCCGG - Intergenic
1029711119 7:102300568-102300590 TGGCCCCGCCGCAGCCGCCCCGG + Exonic
1030121222 7:106112335-106112357 GCCCCGCCCCACGGCCGCCCGGG - Intronic
1031051885 7:116953446-116953468 TCGCGCCGCCGCCGCCGCCGCGG - Exonic
1031532028 7:122886796-122886818 GCGCGCCGCCGCTGCTGCCCGGG + Intergenic
1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG + Exonic
1032391236 7:131556596-131556618 CAGCCGCGCAGACGCCGCCCAGG - Exonic
1033137608 7:138798110-138798132 GCGCCTCCCCGCTGCCACCCGGG + Exonic
1033288591 7:140062661-140062683 GGGCGGCGCAGCCGCGGCCCCGG - Exonic
1033477131 7:141702033-141702055 GGGCGCCCCCGCCGCCGCCCCGG + Exonic
1034147403 7:148884731-148884753 GCCCCGCCCCTCCCCCGCCCGGG - Intergenic
1034228007 7:149497741-149497763 GGGCCGCGGCGCCGGCTCCCAGG - Exonic
1034349727 7:150408062-150408084 GCGCCGCACCCGCGCCGCCCCGG + Intronic
1035023067 7:155809978-155810000 TCTCCGCGCCCCCGCCGCCGGGG + Intronic
1035168168 7:157003706-157003728 GGGCCGGGCCTCCGCCGCCTGGG - Intronic
1035266104 7:157691014-157691036 GAGCCGCGCCGCCGCCGGCCGGG - Intronic
1035553015 8:544655-544677 GGCCGCCGCCGCCGCCGCCCAGG - Exonic
1035752065 8:2002950-2002972 GCGCCTCGAAGCCGCCGCCCTGG - Exonic
1036723729 8:11201069-11201091 CCGCAGCGCCGCCGCCGACGGGG - Exonic
1037788953 8:21919890-21919912 GGCCCGCGCCGCCGCCACTCGGG + Intronic
1037807530 8:22066896-22066918 GCGCGGCGCCGCCCCGGGCCGGG + Intronic
1037815450 8:22109477-22109499 GCGCGGCGCCGCGGCCTGCCCGG + Intergenic
1037876561 8:22551643-22551665 GCGCCGCCTCCCCGCCGGCCAGG + Intronic
1038429852 8:27491318-27491340 GCCCAGCGCCGCCGCCGCAGTGG + Intronic
1038789717 8:30657890-30657912 CAGGCGCGCCGCCGCCTCCCGGG - Intronic
1039453828 8:37695594-37695616 GCCGCGCGCCGCCGCTGCCTCGG - Intergenic
1039493589 8:37965338-37965360 GCCCTGCGCCGCCGCCCGCCCGG - Exonic
1039554649 8:38467627-38467649 GGGCCTCGCCGCCTTCGCCCCGG + Intronic
1039996958 8:42541956-42541978 CCGCCGAGCCCCCGCCGCCCCGG - Intronic
1040055950 8:43056716-43056738 GTCTCGCGCCGGCGCCGCCCTGG - Intronic
1041167369 8:55102743-55102765 AGCCCGCCCCGCCGCCGCCCGGG - Exonic
1042040220 8:64581387-64581409 CCCCGCCGCCGCCGCCGCCCAGG - Exonic
1042278364 8:67028658-67028680 GCGCCCGGCCGCCGCCTCACAGG - Intronic
1042837796 8:73093209-73093231 GCGCCGCCCCTCCCCAGCCCTGG + Exonic
1042916178 8:73878382-73878404 GCCCCCCGCCGCCCCTGCCCCGG + Intronic
1042962630 8:74320626-74320648 GCGCAGCGCTGGCGCCGGCCAGG + Intronic
1043464035 8:80487185-80487207 GACCCCCGCCGCCGCCGCCTCGG - Exonic
1043464082 8:80487386-80487408 CCGCCCCGCTGCCGTCGCCCAGG - Exonic
1043502855 8:80873970-80873992 GCGCCGCGCTGCAGCCTGCCGGG - Intronic
1044335976 8:90985232-90985254 GCCCCCCGCCGCCGCCACCGCGG - Exonic
1044999848 8:97869535-97869557 AAGCCGCGCTGCAGCCGCCCCGG + Intronic
1045305023 8:100951328-100951350 CCGCCGCGCCACCGCCTCCCGGG + Intronic
1047024506 8:120811594-120811616 GCTGCGCGCCGCCCGCGCCCGGG + Exonic
1047687066 8:127315671-127315693 GCGCCGCTGCGCTGCGGCCCGGG + Intergenic
1047961659 8:130016076-130016098 GCGCAGCGGGGCCGCCGCCCGGG - Intronic
1048152083 8:131904053-131904075 TCAGCGCGCCGCCGCCGTCCCGG - Intergenic
1048214351 8:132481160-132481182 GAGGCGGGGCGCCGCCGCCCGGG - Intergenic
1049405268 8:142449580-142449602 GCGCCGCCCCGCCCCCGGCTCGG + Exonic
1049532244 8:143160351-143160373 CCCCCGCGCGGCCCCCGCCCCGG - Intronic
1049682093 8:143923860-143923882 GCGCCGCGCCTCCTCCACCTTGG + Exonic
1049762199 8:144336653-144336675 GCCCGGCGCCGCCGCCCCCGGGG - Intergenic
1049867885 8:144950656-144950678 GCGCGGCTCCGCCCCCGCCCGGG + Intronic
1050090763 9:2015485-2015507 GCACCACGCCGCCTTCGCCCGGG + Intronic
1050230921 9:3525589-3525611 CCGCTGCGGCGCCGCCGCCGAGG - Intronic
1051418619 9:16870135-16870157 GCGCTGGGGCGCAGCCGCCCGGG - Intronic
1053239945 9:36487408-36487430 GCCCCCCACCGCCGCCGCCCCGG - Intronic
1053306157 9:36986140-36986162 CCGCCGCGCCCGCGCCCCCCGGG + Intronic
1053306211 9:36986348-36986370 GGGCCCCGCCGCGGCCGCGCCGG + Intronic
1053435157 9:38069284-38069306 GCGCCGCCGCCCCGCCCCCCCGG + Intergenic
1054308897 9:63450848-63450870 GCCCCCCCCCGCCGCCGCCACGG - Intergenic
1054340742 9:63859670-63859692 GCTCCGCCCCCCCCCCGCCCCGG - Intergenic
1054905893 9:70413482-70413504 GCCCCGCGCCCCCGCCCCCTTGG - Exonic
1055611691 9:78031331-78031353 CCGCCGAGCCCCCGCCGCCCGGG + Exonic
1056350238 9:85741963-85741985 GCGCCGCGCTGACGTTGCCCGGG - Intronic
1057146776 9:92764219-92764241 CCGCCCCGCCGGGGCCGCCCAGG + Intronic
1057245507 9:93451602-93451624 GCCCGGCGCGGACGCCGCCCAGG - Intronic
1057436877 9:95048623-95048645 AGTCCGCGCTGCCGCCGCCCAGG + Intronic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1057773086 9:97984207-97984229 GCGCCGGGCCGCGCCCGCCCAGG - Intronic
1057773162 9:97984464-97984486 GTGCCGCGGCGGCGGCGCCCGGG + Intronic
1057934022 9:99221804-99221826 GCTCAGCGCCGCCCACGCCCAGG + Exonic
1058366862 9:104219345-104219367 CCGCCGCGCCTCAGCCTCCCTGG - Intergenic
1058861257 9:109119700-109119722 GCACCGCGGCGCCGCAGCACAGG + Exonic
1058885781 9:109320501-109320523 CTGCCGCTGCGCCGCCGCCCGGG + Exonic
1059176686 9:112175023-112175045 GCACCGCGCCGGCCCGGCCCAGG + Intronic
1059230681 9:112718309-112718331 GCCCCGCCCCTCCCCCGCCCCGG - Intergenic
1059234497 9:112750689-112750711 CCGAGGCGCCGCGGCCGCCCGGG - Intergenic
1059483634 9:114611309-114611331 GCTCCGCTCCGCCGCGGGCCCGG + Exonic
1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG + Exonic
1060583438 9:124771291-124771313 GCGCCGCGCCCCCTCAGCACTGG + Intronic
1060811771 9:126614365-126614387 GCTCTCCGCCGCCGCGGCCCTGG - Intergenic
1060812687 9:126618955-126618977 ACGCCGCGGCCCCGCCGCCGAGG - Intronic
1060945779 9:127568788-127568810 GCGCCGCGCCACGCGCGCCCAGG - Intronic
1061196658 9:129110563-129110585 AGTCCGCGCCGCCGCCGCCGCGG + Exonic
1061231614 9:129319046-129319068 GCCCCCCGTCGCCCCCGCCCTGG + Intergenic
1061489814 9:130938727-130938749 GCCCCGCGCCGGGGCGGCCCGGG + Exonic
1061666102 9:132161856-132161878 GCGCCGGGCAGCCCCCGGCCCGG - Intronic
1061808470 9:133149181-133149203 GCGCCGCGCTCCGGCCGCTCGGG + Intronic
1061975941 9:134068098-134068120 GGCCCGCGCCGGGGCCGCCCAGG + Intronic
1062314821 9:135961443-135961465 GCGCCTCGCTCCCGCCGCCGGGG + Intergenic
1062341385 9:136095213-136095235 GCGGCGCGCCGCAGCTGCCCAGG - Exonic
1062341417 9:136095316-136095338 CCGCCGCCCCGCCCCCGCCGCGG - Intergenic
1062372206 9:136245771-136245793 GCTGCGCGCCACCGCCGCCCCGG + Exonic
1062406671 9:136400012-136400034 GCGCTGCCCCGCCCCCGTCCCGG + Intergenic
1062497953 9:136840475-136840497 GCCCCGGGCGGCCGCCACCCTGG + Exonic
1062556352 9:137114868-137114890 GCGCCCCGCGGCCGCTGCCCAGG + Intronic
1062579178 9:137222010-137222032 GCCGCGCGCCGCCGCCGCAGAGG + Intergenic
1203469880 Un_GL000220v1:111682-111704 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203477701 Un_GL000220v1:155654-155676 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1185469416 X:373717-373739 GCGCCCCGCCGGCCCCGGCCCGG - Intronic
1186350115 X:8731935-8731957 CCGCCGCGCAGCAGCCGCGCCGG + Exonic
1187225825 X:17375093-17375115 GCGCTGCGCCCCCCTCGCCCCGG + Intergenic
1187915600 X:24149968-24149990 GCGCGCCTCCGCCGCCGCTCGGG - Intronic
1189335732 X:40169819-40169841 GTGCAGCGCCGTCCCCGCCCTGG - Intronic
1190285316 X:48957499-48957521 CCAACGAGCCGCCGCCGCCCGGG - Exonic
1195716870 X:107826438-107826460 GCGCCCCCTCGCCGCGGCCCTGG + Intronic
1198424092 X:136497436-136497458 CGGCCGCGCCGCCGCCCACCTGG - Exonic
1198534502 X:137573756-137573778 TGGCCTCGCCGCCTCCGCCCCGG - Intronic
1199595850 X:149505251-149505273 GCGCAACACAGCCGCCGCCCGGG + Intronic
1200129006 X:153830923-153830945 GCGCCCCTCCCCCGCCGCCGTGG - Intergenic
1200292504 X:154886395-154886417 GGCCGGCGCCGCCGCCGCCCAGG - Exonic
1200339348 X:155382135-155382157 GGCCGGCGCCGCCGCCGCCCAGG - Exonic
1200347122 X:155458558-155458580 GGCCGGCGCCGCCGCCGCCCAGG + Exonic