ID: 1147720446

View in Genome Browser
Species Human (GRCh38)
Location 17:42536495-42536517
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147720439_1147720446 9 Left 1147720439 17:42536463-42536485 CCTACAGCCTGGGCGGCGGCGGC 0: 1
1: 0
2: 2
3: 28
4: 325
Right 1147720446 17:42536495-42536517 GTGCGGGTGCGCGGCTCCACGGG 0: 1
1: 0
2: 1
3: 2
4: 68
1147720441_1147720446 2 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720446 17:42536495-42536517 GTGCGGGTGCGCGGCTCCACGGG 0: 1
1: 0
2: 1
3: 2
4: 68
1147720433_1147720446 22 Left 1147720433 17:42536450-42536472 CCGGGCTTGGACACCTACAGCCT 0: 1
1: 0
2: 0
3: 22
4: 183
Right 1147720446 17:42536495-42536517 GTGCGGGTGCGCGGCTCCACGGG 0: 1
1: 0
2: 1
3: 2
4: 68
1147720432_1147720446 27 Left 1147720432 17:42536445-42536467 CCAAGCCGGGCTTGGACACCTAC 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1147720446 17:42536495-42536517 GTGCGGGTGCGCGGCTCCACGGG 0: 1
1: 0
2: 1
3: 2
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type