ID: 1147720448

View in Genome Browser
Species Human (GRCh38)
Location 17:42536503-42536525
Sequence GCGCGGCTCCACGGGCGTGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147720441_1147720448 10 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720448 17:42536503-42536525 GCGCGGCTCCACGGGCGTGGCGG 0: 1
1: 0
2: 0
3: 13
4: 106
1147720433_1147720448 30 Left 1147720433 17:42536450-42536472 CCGGGCTTGGACACCTACAGCCT 0: 1
1: 0
2: 0
3: 22
4: 183
Right 1147720448 17:42536503-42536525 GCGCGGCTCCACGGGCGTGGCGG 0: 1
1: 0
2: 0
3: 13
4: 106
1147720439_1147720448 17 Left 1147720439 17:42536463-42536485 CCTACAGCCTGGGCGGCGGCGGC 0: 1
1: 0
2: 2
3: 28
4: 325
Right 1147720448 17:42536503-42536525 GCGCGGCTCCACGGGCGTGGCGG 0: 1
1: 0
2: 0
3: 13
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147720448 Original CRISPR GCGCGGCTCCACGGGCGTGG CGG Exonic