ID: 1147720451

View in Genome Browser
Species Human (GRCh38)
Location 17:42536513-42536535
Sequence ACGGGCGTGGCGGCCGCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147720441_1147720451 20 Left 1147720441 17:42536470-42536492 CCTGGGCGGCGGCGGCGCGGCGC 0: 1
1: 3
2: 13
3: 114
4: 648
Right 1147720451 17:42536513-42536535 ACGGGCGTGGCGGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 24
4: 236
1147720439_1147720451 27 Left 1147720439 17:42536463-42536485 CCTACAGCCTGGGCGGCGGCGGC 0: 1
1: 0
2: 2
3: 28
4: 325
Right 1147720451 17:42536513-42536535 ACGGGCGTGGCGGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 24
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147720451 Original CRISPR ACGGGCGTGGCGGCCGCCGC GGG Exonic