ID: 1147721667

View in Genome Browser
Species Human (GRCh38)
Location 17:42543373-42543395
Sequence CCAGCCCAGCTCAGCCATGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 444}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147721667_1147721671 2 Left 1147721667 17:42543373-42543395 CCCTCATGGCTGAGCTGGGCTGG 0: 1
1: 0
2: 1
3: 38
4: 444
Right 1147721671 17:42543398-42543420 AAAGGACCCAGTGCCAGATTTGG 0: 1
1: 0
2: 1
3: 19
4: 145
1147721667_1147721675 11 Left 1147721667 17:42543373-42543395 CCCTCATGGCTGAGCTGGGCTGG 0: 1
1: 0
2: 1
3: 38
4: 444
Right 1147721675 17:42543407-42543429 AGTGCCAGATTTGGCAGCCTGGG 0: 1
1: 1
2: 2
3: 13
4: 169
1147721667_1147721674 10 Left 1147721667 17:42543373-42543395 CCCTCATGGCTGAGCTGGGCTGG 0: 1
1: 0
2: 1
3: 38
4: 444
Right 1147721674 17:42543406-42543428 CAGTGCCAGATTTGGCAGCCTGG 0: 1
1: 0
2: 1
3: 8
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147721667 Original CRISPR CCAGCCCAGCTCAGCCATGA GGG (reversed) Exonic
900419030 1:2547607-2547629 CCAGCTCAGAGCAGCCCTGACGG - Intergenic
900470743 1:2853769-2853791 CCTGCCCCGCCCAGCCAGGAAGG + Intergenic
900529993 1:3148414-3148436 CCAGCCCAGCCCAGCCCTGCCGG - Intronic
900594002 1:3472259-3472281 CCAGCCAAGCCCAGCCTTGGTGG + Intronic
901414092 1:9105149-9105171 TCATCCCAGATCAGCCATGGCGG - Intronic
901632560 1:10655033-10655055 CCACCCCAGCTGGGCCAGGAAGG + Intronic
902362487 1:15949788-15949810 CCAGCACAGGTCGGCCTTGAAGG + Intronic
903374078 1:22854818-22854840 CCAGCCCAGCCCAGCCCAGAGGG + Intronic
903663948 1:24995560-24995582 ACAGTCCAGCTCTGCCCTGAAGG + Intergenic
903879442 1:26499179-26499201 CCAGCCCAGTGGAGCCATGGTGG + Intergenic
904609979 1:31720548-31720570 CCAGCCCGGCTCACCCAGGGAGG - Intergenic
904786117 1:32984322-32984344 ACAGCTCAGCTCAGCCAGAAGGG + Intergenic
905300156 1:36981404-36981426 CCAGCCAAGGTCAGGGATGATGG + Intronic
905410112 1:37762806-37762828 CCAGCCCAGCTCGGCCTGGGAGG + Exonic
905831303 1:41070604-41070626 CATCCCCAGCTCAGCCATGCAGG - Exonic
905849957 1:41266452-41266474 CCAGCCCAGCCCAGCCCAGCAGG - Intergenic
907522493 1:55033341-55033363 CCAGCCCAGCTCTTCCTTGCAGG + Intergenic
907906868 1:58790497-58790519 CCAGCCCAGCCAAGCCACAAGGG + Intergenic
907951529 1:59188411-59188433 ACAGCCCAGCTCACTCAAGATGG - Intergenic
908433377 1:64080814-64080836 ACAGTAGAGCTCAGCCATGAAGG + Intronic
909493195 1:76248034-76248056 CCAGCCAAGAGAAGCCATGAAGG - Intronic
912985927 1:114430441-114430463 CCAGCCCAGCCCAGGCAACATGG - Intronic
914837972 1:151223786-151223808 CAAGACCAGCCCAGCCATCATGG + Intronic
915107599 1:153544051-153544073 CCACCCTAGCTTAGCCTTGAGGG - Intronic
915475084 1:156148483-156148505 CCACCCCAGCTCAGATATGAAGG + Intronic
917447041 1:175115224-175115246 CCACTCCAGCTCAGTCCTGAGGG + Intronic
918342967 1:183582293-183582315 CCAGCCCAGCAGAGCCCTGCAGG - Intronic
919285828 1:195558473-195558495 CCAGACCAGCTTAGCCAACATGG - Intergenic
919785147 1:201254040-201254062 CCAGCCCAGCCCAGCCCTGCAGG + Intergenic
921809290 1:219493527-219493549 CAAGACCAGCCCAGCCAAGATGG - Intergenic
922346825 1:224703277-224703299 CCGGACCAGCTGAGCCACGATGG + Intronic
922482131 1:225946378-225946400 CCCACCCAGCTTGGCCATGATGG + Intergenic
922554152 1:226520352-226520374 CCAGCAGGGCTCAGCTATGAAGG - Intergenic
922567223 1:226608680-226608702 CCACCCCAGTCCAGCCATGAGGG + Exonic
922953617 1:229580277-229580299 CGAGACCAGCCCAGCCATCATGG - Intergenic
923489023 1:234466660-234466682 CGAGACCAGCCCAGCCAAGATGG + Intronic
923534826 1:234841018-234841040 CCAGCTCAGCTCAGCCACTGTGG - Intergenic
923850841 1:237792604-237792626 CCAGGCCAGGACAGCCCTGAAGG - Intronic
1062948173 10:1476354-1476376 TCAGCCCAGCTCTGCCCTGCAGG - Intronic
1063103604 10:2973387-2973409 CCAGGCCAGAGCAGCCATCAGGG + Intergenic
1064012839 10:11749050-11749072 CCTTCCCACTTCAGCCATGACGG + Intronic
1064718905 10:18207492-18207514 CCACCCCACCTTATCCATGAGGG - Intronic
1065547665 10:26838222-26838244 CCAGACCAGCTTGGCCAAGATGG - Intronic
1065779484 10:29153678-29153700 TCACCAGAGCTCAGCCATGATGG - Intergenic
1066682273 10:37945686-37945708 CAAGCCCAGCTTAGCCAATATGG - Intergenic
1070213108 10:74347348-74347370 CCAGCCAAGGGAAGCCATGAGGG + Intronic
1070689582 10:78514667-78514689 CCAGGCAGGCTCAGCCATGCAGG + Intergenic
1070689820 10:78516301-78516323 CAAGTCCAGCTCACCCATGCTGG - Intergenic
1070725147 10:78782618-78782640 CCAGCTGAGCTCAGCCGTGGAGG + Intergenic
1070967764 10:80539908-80539930 CCAGCGCAGCCCAGCCCGGAAGG - Intronic
1071486195 10:86104234-86104256 CCAGCCCAGCTCAGAGCTCAGGG + Intronic
1071572893 10:86707803-86707825 CCAGCCCAACTCAAGCCTGAAGG + Intronic
1071990179 10:91093625-91093647 CCAGCCCATCACAGGCCTGAAGG - Intergenic
1073303389 10:102484610-102484632 CCAGGCCATCTCAGACAGGAAGG - Intronic
1074450551 10:113555927-113555949 CCAGCTGGGCTCAGCCATAATGG + Intronic
1075071230 10:119321146-119321168 CCAGCCCATCTGAGTCAGGAAGG + Intronic
1075616111 10:123891814-123891836 CCAGCCCAGCCCAGCCCCGCGGG - Exonic
1075703494 10:124484305-124484327 CCATACCTGCTCATCCATGACGG + Exonic
1076007024 10:126956025-126956047 CCATCCCAGCACAGCCTTGGAGG - Intronic
1076187801 10:128462476-128462498 CCAGCCCAGGTGATCCCTGAGGG + Intergenic
1076359128 10:129874611-129874633 TCAGCCCAGCTCTGACCTGAAGG + Intronic
1076765612 10:132631347-132631369 GCAGCCCAGCCCAGCCCCGAAGG + Intronic
1076820981 10:132939465-132939487 GCAGGCCAGCTCTGCCATGTAGG + Intronic
1077094827 11:794875-794897 CCAGCCAAGCTCATCAATGGCGG - Exonic
1078088482 11:8248948-8248970 CCAGCCCAGCTTTGGCCTGAAGG - Intronic
1078779384 11:14422548-14422570 CCAGCTGAGCTCAGGCAGGATGG + Intergenic
1079088195 11:17462051-17462073 CCAACCCAGCCTAGCCATGGGGG - Intronic
1081198736 11:40192383-40192405 CTAGCCAAGGGCAGCCATGAGGG + Intronic
1081427002 11:42936294-42936316 CCAGACCAGCCCAGCCAACATGG - Intergenic
1081444405 11:43116676-43116698 CCAGCCCACCTTAGCCAGGGAGG + Intergenic
1082614716 11:55344774-55344796 CAAGACCAGCCCAGCCACGATGG + Intergenic
1082825922 11:57578797-57578819 CCAGCCAAGCTCTGCCCTGAGGG - Intergenic
1083206079 11:61150184-61150206 CCAGGTCAGCTCAGACATGTGGG + Intronic
1083306481 11:61764598-61764620 CCAGCCCGGGTCAGCCGTGTGGG + Intronic
1083535103 11:63460061-63460083 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
1084000709 11:66294029-66294051 CAGGCCCACCTCAGCCAGGAGGG - Intronic
1084126878 11:67104970-67104992 CCAGACCAGCCCAGCCAACATGG - Intergenic
1084500133 11:69530443-69530465 CCAGGCCAAATCAGCCCTGAGGG + Intergenic
1084860987 11:72018129-72018151 CCAGACCACCTCAGCCCTGAGGG + Intronic
1085115050 11:73924116-73924138 CCAGCCCAGCTCAGCATTCTAGG + Intronic
1085305900 11:75485982-75486004 CCAGCCCAGCCCTGGGATGATGG + Intronic
1086466522 11:87059514-87059536 CGAGACCAGCTCAGCCAACATGG - Intronic
1086887087 11:92218583-92218605 CCAGACCAGCTTAGCCAACATGG + Intergenic
1087907024 11:103710081-103710103 CCCACCCAGCTCTGCCAGGAAGG + Intergenic
1088249739 11:107852215-107852237 CAAGACCAGCTCAGCCAACATGG + Intronic
1088726196 11:112637264-112637286 CCAGCCCAGCCCAGCCACCATGG - Intergenic
1089138879 11:116270777-116270799 CCTGCCCAGCTCTGCCAGGAGGG - Intergenic
1089329550 11:117680132-117680154 CCAGCCTAGCTCTGCCATCCAGG + Intronic
1089517592 11:119043496-119043518 CCAGACCAGCTTAGCCAACATGG + Intergenic
1089544099 11:119209415-119209437 CCAGACCAGCTCTGCCAACATGG + Intronic
1089608093 11:119653454-119653476 CCAACCCAGCCCTGCCCTGAGGG + Intronic
1090268199 11:125368028-125368050 CAGGCCCAGCTCAGCTGTGAGGG + Intronic
1090307428 11:125703360-125703382 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
1090725154 11:129518325-129518347 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
1090944696 11:131419592-131419614 CCTACCCAGCCCAGCCACGATGG - Intronic
1091108598 11:132944393-132944415 CCAGCCAAGTCCAGCCCTGACGG + Intronic
1092349259 12:7742310-7742332 CAAGCCCAGCCCAGCCAACATGG + Intronic
1092351290 12:7757965-7757987 CCAGACCAGCTCGGCCAACATGG + Intergenic
1092629010 12:10358755-10358777 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
1093664536 12:21795779-21795801 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
1095930871 12:47624070-47624092 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
1097412069 12:59267836-59267858 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
1097654497 12:62343621-62343643 CCAGCCAAGGGAAGCCATGAGGG - Intronic
1098898833 12:76091924-76091946 CCAGACCAGCTTAGCCAACATGG + Intergenic
1101617614 12:106353548-106353570 CCTGCCCAGGACAGCCATGTGGG - Intergenic
1101807596 12:108078068-108078090 GCAGCCCAGGGCAGCCATGCTGG - Intergenic
1102422811 12:112817393-112817415 ACACCCCAGCTCAGCCTTCAAGG + Intronic
1103562828 12:121800975-121800997 CCAGCCCGGCCCAGCCGCGACGG + Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1104067780 12:125319607-125319629 GAAGCCCAGCGCAGCCCTGAGGG - Intronic
1104087401 12:125488750-125488772 CCAGCCCAGCTCAGCCCAAATGG - Intronic
1104720496 12:131042690-131042712 GCAGCCCAGGTGAGCCAGGAGGG + Intronic
1105497578 13:20944291-20944313 CGAGACCAGCACAGCCAAGATGG + Intergenic
1107105857 13:36641765-36641787 CCAGTCCAGCTCAGAGATGCAGG - Intergenic
1107544050 13:41420510-41420532 CCAACCCAGCTCTTGCATGATGG - Intergenic
1108662646 13:52600461-52600483 CCAGCCCAGCCCAGCCCAGTCGG + Intergenic
1111030491 13:82591748-82591770 TCAGCCCATCTCAGCCAGGGAGG - Intergenic
1113942687 13:114026619-114026641 CGAGCCCCACTCAGCCATCATGG + Intronic
1115006522 14:28492121-28492143 CGAGCCCAGCAGAGCCATGGTGG - Intergenic
1115277045 14:31621017-31621039 CCACCGCAGCTCAGCAATGCTGG - Intronic
1115339022 14:32272642-32272664 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
1116781705 14:49244017-49244039 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
1117021370 14:51574142-51574164 CCAGCCCTGCCCAGCCCTTATGG + Intronic
1117172330 14:53113658-53113680 CCAGCCAAGGGAAGCCATGAGGG + Intronic
1117598530 14:57349159-57349181 TGAGCCCACCTCATCCATGAAGG + Intergenic
1118101236 14:62605659-62605681 CCAGACCAGCTCACCAAGGAAGG + Intergenic
1119158935 14:72437119-72437141 CCAGACCAGCTTGGCCATCATGG + Intronic
1119286213 14:73457720-73457742 CCATCCCAGCTCAGCTATGGGGG + Intronic
1120531563 14:85638396-85638418 CCAGCTCAGATCAGCTCTGATGG + Exonic
1120610488 14:86635660-86635682 CCAGGCCAGGCCAGGCATGATGG + Intergenic
1122114654 14:99521722-99521744 CCAGGCCAGGTCAGCCAGGTAGG + Intronic
1122366645 14:101198427-101198449 GCTGCCCAGCTCCTCCATGAGGG + Intergenic
1122886248 14:104711718-104711740 CCCGCCCACCTCAGCCAGGTGGG + Intronic
1123043998 14:105502684-105502706 CCAGCCCAGCACAGCCAGGCAGG - Intergenic
1123411703 15:20066325-20066347 CCAGCACAGTGCAGCCACGAAGG - Intergenic
1123785097 15:23663579-23663601 TCATCCCAGCCCAGCCTTGAGGG - Intergenic
1124486855 15:30125297-30125319 CCAGCCCAGAAGATCCATGAAGG - Intergenic
1124541937 15:30594274-30594296 CCAGCCCAGAAGATCCATGAAGG - Intergenic
1124548587 15:30656065-30656087 CCAGCCCAGAAGATCCATGAAGG - Intronic
1124756670 15:32413026-32413048 CCAGCCCAGAAGATCCATGAAGG + Intergenic
1126049357 15:44672523-44672545 TCAGCCCAGGTCAGCTCTGATGG + Intronic
1126964679 15:54038330-54038352 CCAGACCAGCCCAGCCAACATGG - Intronic
1127344673 15:58082472-58082494 CCAGACCAGCCCAGCCAACATGG + Intronic
1128154670 15:65385078-65385100 CCAGCCCAGCTCAGCCCGCTTGG + Exonic
1128719847 15:69940360-69940382 CCAGCCCAGTCCAGGCATGGAGG + Intergenic
1129764996 15:78159031-78159053 CCAGCCCAGCCTAGCCAACATGG - Intronic
1129879417 15:78996971-78996993 CCAGCCCAGCCCAGGTGTGAGGG - Intronic
1129896564 15:79112610-79112632 CCAACACAGGACAGCCATGAAGG - Intergenic
1130149751 15:81302389-81302411 CCAGAGCAGCTCAGGCAGGATGG - Intronic
1130220433 15:82014864-82014886 CCAACCCAGCCCAGCCATAAAGG + Intergenic
1131518429 15:93095148-93095170 CCAGCTCAGCACAGCTATAATGG - Intergenic
1132814077 16:1817666-1817688 CCCGCTCAGCTCAGCCAGGGTGG - Intronic
1134148883 16:11789878-11789900 CCAGACCAGCCCAGCCAACATGG + Intronic
1134868265 16:17628685-17628707 CCAGCCCAGCCCAGCCTTCCTGG + Intergenic
1135344905 16:21680650-21680672 CCAGCCCAGCCCGGCCAACATGG + Intronic
1136425593 16:30167967-30167989 CAAGACCAGCTCAGCCAACATGG + Intergenic
1138406592 16:56799980-56800002 CGAGACCAGCCCAGCCATCATGG + Intronic
1140197241 16:72865410-72865432 CCAGCACAGGGCCGCCATGAAGG - Intronic
1140686861 16:77442142-77442164 CCAGCCTAGCTCAGCCAGGGTGG - Intergenic
1140763546 16:78133841-78133863 CAAGCTCAGCTCAGCCTTGCAGG - Intronic
1141153322 16:81579612-81579634 CCAGCCCTGCTCCCCCCTGAAGG + Intronic
1141639772 16:85334366-85334388 CCAGCGCAGCTCCCCCATGCAGG - Intergenic
1142639813 17:1279425-1279447 CCAGCCCAGCCCAGCCCAGAGGG - Intergenic
1142885960 17:2912218-2912240 CCAGCCCAGCTCTGCCCAGAGGG - Intronic
1143202295 17:5121472-5121494 CCATCCCAGCTCAGCAAGGTAGG + Exonic
1144647182 17:16983090-16983112 CCAGGCCAGCCCAGCCATTAGGG - Intergenic
1144759371 17:17698647-17698669 CCAGGCCAGCTCAGCTGTGGAGG + Intronic
1144833782 17:18146020-18146042 CCAGCCCCGCTCAGCATTGTGGG - Exonic
1144838020 17:18167735-18167757 CCACCCCAGCTGAGGCAGGAGGG - Intronic
1145898406 17:28474150-28474172 CCAGCCCATCTCAGCCGCCATGG - Intronic
1145901048 17:28490755-28490777 CACGGCCACCTCAGCCATGATGG + Exonic
1146287274 17:31582322-31582344 ACAGCCCAGCACAGGCAGGAAGG + Intergenic
1147459501 17:40559270-40559292 CCAACCAAGCTCAGTCTTGAGGG - Intronic
1147500847 17:40962122-40962144 CAAGCCTAGCTCAGCAAAGATGG - Intronic
1147721667 17:42543373-42543395 CCAGCCCAGCTCAGCCATGAGGG - Exonic
1148065706 17:44868066-44868088 ACAGCCCAGCTCAGGCATCCAGG - Intronic
1148203352 17:45764385-45764407 CCAGCTCTGCTCTGCCTTGAGGG + Intergenic
1148387345 17:47243765-47243787 CCATCCCAGCTCAGCAAACAAGG - Intergenic
1148426672 17:47603947-47603969 CCAGTACAGCTCTGCCATGCTGG + Exonic
1148683456 17:49487484-49487506 CCAGCCCAGCCCAGCCTACAGGG - Intergenic
1149576528 17:57717220-57717242 CTAGGTCAGCTCAGCCAGGAGGG + Intergenic
1150452501 17:65280482-65280504 CCATCCCAGCTCCACCAGGAAGG - Intergenic
1150561114 17:66295727-66295749 CCACCACAGCCCAGCCATAAGGG + Intergenic
1151548570 17:74808186-74808208 CCAGCCCAGTCCTGCCCTGAAGG + Intronic
1152478364 17:80533237-80533259 CCAGCCCACCTGGGCCCTGAAGG - Intergenic
1152569447 17:81115304-81115326 CCAGCCCAGCCCTGGCATGGGGG - Intronic
1152694359 17:81736276-81736298 CCAGCCCTGCTGAGCCAGGCTGG + Intergenic
1152721337 17:81925161-81925183 CCAGCTCTGCCCAGCCTTGAGGG - Intronic
1152945431 17:83195238-83195260 CCAGCCCAGCCCAGCCCCGCAGG - Intergenic
1153695750 18:7639585-7639607 CCAGACCAGCCCAGCCAACACGG - Intronic
1154105028 18:11515366-11515388 CCTGCCTAGCACAGCCCTGATGG + Intergenic
1156358049 18:36360035-36360057 CTGGCCCAGCTCAGCCCTGTGGG - Intronic
1157499387 18:48179300-48179322 CAAGCCTTGCTCAGCCATGCAGG - Intronic
1160372252 18:78383552-78383574 CCAGCCAAGCACGGACATGAAGG - Intergenic
1161055897 19:2190513-2190535 CCAGGCCAGCTCAGCTCTCAGGG - Intronic
1161069438 19:2252929-2252951 CCCGCCAAGCTCAGCCCCGAGGG - Exonic
1162304358 19:9862772-9862794 CCAGACCAGCTTAGCCAACATGG + Intronic
1162389123 19:10378498-10378520 CCACCCCAGCTAAGGCCTGAGGG + Intronic
1162514509 19:11139859-11139881 CAAGACCAGCTCAGCCAACATGG - Intronic
1162818664 19:13210230-13210252 CCAGCCCAGCTGAGCGCTGGTGG + Intronic
1163169006 19:15517807-15517829 CAACCCCAGCTCTGCCCTGATGG - Intronic
1163397166 19:17070363-17070385 CCAGCCTGTCTCAGCCCTGAAGG - Intronic
1163549254 19:17956402-17956424 CCAGCCCAGGTCAGCCCTTGTGG + Intronic
1163774490 19:19209983-19210005 CCAGCCCAGCCCAGCCAACATGG - Intergenic
1164681137 19:30134572-30134594 GCAGCCCAGCTCAGGGATAATGG + Intergenic
1165874574 19:38996972-38996994 CCAGCCTATGTCAGCAATGATGG - Intronic
1165897882 19:39154467-39154489 CTGGCCCAGCTCAGCCCTGGAGG - Intronic
1165900550 19:39167443-39167465 CCAGCCCAGCCCACCCCTGGTGG - Intronic
1166212351 19:41315097-41315119 CGAGACCAGCACAGCCAAGATGG + Intronic
1166538052 19:43588093-43588115 CCAGACCAGCTTAGCCAACATGG + Exonic
1166740147 19:45109648-45109670 CCAGCCCACCACAGCTATGGAGG + Intronic
1166930403 19:46298342-46298364 GCACCCGAGCTCAGCCAAGAGGG - Intronic
1168071037 19:53951947-53951969 AGATCCCAGCTCAGCCCTGATGG - Intergenic
1168116543 19:54224088-54224110 CCAGACCAGTTCAGACAGGAGGG + Intronic
1168119526 19:54243874-54243896 CCAGACCAGTTCAGACAGGAGGG + Intronic
1168168697 19:54572554-54572576 CCAGACCAGTTCAGACAGGAGGG - Intergenic
1168228389 19:55012872-55012894 CGAGACCAGCTCAGCCAACATGG - Intergenic
1168539640 19:57199452-57199474 CATTCCCAGCTCACCCATGATGG + Intronic
1168579829 19:57545810-57545832 CCAGACCAGCCCAGCCAACATGG + Intronic
925109865 2:1324192-1324214 CCATCCCAACTCAGCCATACTGG - Intronic
926740043 2:16103125-16103147 CCAGAGCAGCCCAGCCATAAAGG - Intergenic
927190268 2:20512431-20512453 CCACCCCAACTCCGCCATGGCGG + Intergenic
927215420 2:20665810-20665832 CCAGCGCAGCGCAGCCAGGCAGG + Intergenic
929456502 2:42069736-42069758 TCAGCCCAGCCCAGCCAGGCTGG + Intergenic
929828611 2:45329680-45329702 CCTGCCTGGCTCAGCCATGCAGG - Intergenic
929978137 2:46654543-46654565 CCAGGCCACATCAGCCCTGAGGG - Intergenic
930646493 2:53914678-53914700 CAAGACCAGCCCAGCCAAGATGG + Intronic
932218651 2:69983538-69983560 CCAGCCCAGCTCAGCCTAGCTGG - Intergenic
932302300 2:70675951-70675973 CAACCCCAACTCAGCCAAGATGG - Intronic
932332594 2:70906221-70906243 CCAACCCAGCTCATCCGGGAAGG + Intronic
932939023 2:76139951-76139973 CCAGCCAAGAGAAGCCATGAGGG - Intergenic
933317814 2:80736628-80736650 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
934568445 2:95353342-95353364 CCAGTTCAGCTCCCCCATGAAGG + Intronic
934661946 2:96147779-96147801 GAGGCCCAGCTTAGCCATGAAGG + Intergenic
934934935 2:98458613-98458635 ACAGAACAGCACAGCCATGAAGG - Intronic
935280746 2:101515767-101515789 CGAGCCAAGCTGAGCCAGGAAGG + Intergenic
937138531 2:119577131-119577153 CCACCAGAGCTCAGCCATGCTGG - Intronic
937526070 2:122771993-122772015 CCAGCCAAGAGAAGCCATGAGGG + Intergenic
938116149 2:128604084-128604106 CCAGCCCAGCAGGACCATGATGG + Intergenic
938194817 2:129318348-129318370 CCAGCCTTGCTCAACCCTGAGGG + Intergenic
939236299 2:139498369-139498391 CAAGCCCAGCTCATACAAGAAGG - Intergenic
940400649 2:153244561-153244583 CCAGCCAAGGGAAGCCATGAAGG + Intergenic
940791537 2:158034496-158034518 CCAAACCAGCTCAGCCTTCAAGG + Intronic
941905524 2:170714463-170714485 CCTGCCGAGCTCAGCTTTGAGGG + Exonic
942939483 2:181599333-181599355 CGAGACCAGCTCAGCCAACATGG + Intronic
943094823 2:183416534-183416556 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
943617114 2:190105710-190105732 CCATCTCAGCTCAGCCCTCAGGG + Intronic
944038727 2:195330180-195330202 CCAGCCTCCCTGAGCCATGAAGG + Intergenic
944267841 2:197748163-197748185 CCAGCCAAGGGAAGCCATGAGGG + Intronic
944298835 2:198099165-198099187 TCAGCACGACTCAGCCATGACGG - Intronic
944798771 2:203215153-203215175 CCAGGCCATCTCAGCCAACATGG + Intronic
945127358 2:206527371-206527393 CCAGCCCCACCCAGCCAGGAAGG - Intronic
945482267 2:210357916-210357938 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
945594332 2:211773151-211773173 CTAGCCCAGCTGTGACATGACGG + Intronic
946024084 2:216661460-216661482 CCTGCCCAGCTCTGCCATCTTGG + Intronic
946114313 2:217448239-217448261 CCAGGCCAGTTCAGGCATGGTGG + Intronic
946235693 2:218323263-218323285 CCAGCCCTGCCAAGCCATGCTGG - Intronic
946270761 2:218591540-218591562 CAAGCCCAGCCTAGCCAAGACGG + Intronic
947419670 2:229930803-229930825 TCAGCCCAGCTCAGCTGTGCTGG + Intronic
947628050 2:231633409-231633431 CCAGAGCAGCTCAGCAGTGAGGG + Intergenic
947628196 2:231634514-231634536 CAAGCCCAGCTCAGGCTTGCAGG - Intergenic
948877019 2:240834923-240834945 TCCACCCAGCTCAGCCATGGAGG + Intergenic
1168898253 20:1338571-1338593 CCAGCCCAGGTGACCCAAGAGGG - Intronic
1168914563 20:1475689-1475711 CCTGCCCAAGCCAGCCATGAGGG + Exonic
1169211281 20:3767534-3767556 CCACCCCAGCCCTGCCATCACGG + Intronic
1169890473 20:10446209-10446231 CAAGCCCAGCCTGGCCATGATGG + Intronic
1172076627 20:32303362-32303384 CCAGACCAGCTTGGCCATCATGG + Intronic
1172274535 20:33672561-33672583 CCTGCCCAGCTCAGCCCTGCAGG + Intronic
1172275625 20:33677381-33677403 CCAGCCCAGCCCAGCCCAGTTGG + Intronic
1172530176 20:35625639-35625661 CCAGCCCAGCTCTGCCCTGAGGG + Intergenic
1172649656 20:36493665-36493687 CCAGCCCAGCCCAGCGAGGAGGG + Intronic
1172726538 20:37047777-37047799 CAAGACCAGCTTGGCCATGATGG + Intronic
1173000549 20:39102367-39102389 CCAGCCCATCCCAGGCCTGAAGG - Intergenic
1173745476 20:45433535-45433557 CCAGCCCAGCCCAGCCCAGCTGG + Intergenic
1174487492 20:50870596-50870618 TCAGCCACCCTCAGCCATGAGGG + Intronic
1174639850 20:52034516-52034538 CAAGACCAGCCCAGCCAAGATGG - Intergenic
1175258879 20:57662797-57662819 CCAGCCCACATCAGCCCTGGAGG + Intronic
1175301644 20:57947332-57947354 CCACCCCACCCCTGCCATGAAGG - Intergenic
1175462226 20:59160178-59160200 CCTCCCAAGGTCAGCCATGATGG - Intergenic
1175900446 20:62357914-62357936 CCAGCCCAGGTCAGGCCAGATGG + Intronic
1175906186 20:62380744-62380766 CCAGGCCAGCTCAGCCAAACTGG - Intergenic
1178293190 21:31386959-31386981 CCAGCCCAGCGGGGCCATGCCGG - Intronic
1178415195 21:32399008-32399030 CGAGACCAGCTCAGCCAACATGG + Intergenic
1178874588 21:36403893-36403915 CCATCCCAGCTGAGCCAGGGAGG + Intronic
1178989798 21:37343344-37343366 CGAGACCAGCCCAGCCATAATGG - Intergenic
1179349611 21:40595542-40595564 CCAGCCAAGCTCTGCCCTGAAGG + Intronic
1179430168 21:41316328-41316350 CCAGCCCAGCCCAGCCTAGCAGG - Intronic
1179472803 21:41622797-41622819 CCAATCCTGCTCAGCCAGGATGG + Intergenic
1180160421 21:45996678-45996700 CGCGCCCAGCTGAGCCAAGAAGG - Intronic
1180223846 21:46377233-46377255 CCTGCCCAGCACGGCCAGGAGGG - Intronic
1181102577 22:20551249-20551271 CCAGCCTAGCTGAGCACTGACGG + Intronic
1182419230 22:30240839-30240861 CCAGTCCAGCTCTGCCTTGCCGG - Exonic
1182783359 22:32885759-32885781 CCAGACCAGCCCAGCCAACATGG - Intronic
1183384806 22:37508781-37508803 CCTGACCAGCTCTGCCATGCTGG + Intronic
1184405393 22:44297975-44297997 CCAGCCCAGCCCAGCCCAGCTGG - Intronic
1184555803 22:45232596-45232618 CCATCCCAGCTCCCCCAGGACGG + Intronic
1185171897 22:49299154-49299176 TCAGGACAGCTCAGCCCTGAGGG + Intergenic
1185254953 22:49827063-49827085 CCCGCCGAGCTCTGCCAAGACGG - Intronic
950174298 3:10861844-10861866 CCCTCCCAGCTAACCCATGATGG - Intronic
950184189 3:10934967-10934989 TCAGCCCTGCTAGGCCATGAGGG - Intronic
950337144 3:12204688-12204710 CAAGACCAGCTCAGCCAACATGG - Intergenic
950403677 3:12790745-12790767 TCAGACCAGCTCAGCCAACATGG - Intergenic
953311643 3:41886307-41886329 CCAGCCCAGATGATCCATGAAGG + Intronic
953387945 3:42517300-42517322 CCAGCCCAGCTCAGGTCCGAAGG - Intronic
953874844 3:46660812-46660834 CCTGGGCAGCTCAGCCATGCAGG + Intergenic
953984464 3:47430793-47430815 CCAGCCCAGCTGAGGGATGAGGG + Intronic
954044567 3:47918318-47918340 CCAGACCAGCCCAGCCAACATGG - Intronic
954362272 3:50128387-50128409 CCAGCCCAGCTCTGCCAAGCAGG + Intergenic
954457716 3:50608968-50608990 TCAGCCCACTTCAGCCAGGAGGG - Intronic
954630404 3:52044916-52044938 CCAGGACAGCACAGCCCTGACGG - Intergenic
954653059 3:52177051-52177073 TCACCCCAGCTGAGGCATGAGGG + Intergenic
954799434 3:53178662-53178684 CCTGCCCCACTCAGCTATGAAGG + Intronic
955454033 3:59100734-59100756 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
956654620 3:71536966-71536988 CCTGCCCACCTGAGCCATGGAGG + Intronic
960157494 3:114310893-114310915 CCTGTCCAGCTCAGCACTGATGG - Intergenic
961034834 3:123635018-123635040 CCCACCCAGCCCAGCCATCAGGG - Intronic
961436594 3:126923108-126923130 GCAGCTCATCTCAGCCATGTGGG + Intronic
961666409 3:128495825-128495847 CCAGCCCAGCTCCGCCCAGTAGG - Intergenic
961818891 3:129565221-129565243 TCAGGCCAGCTCTGCCAGGAGGG - Intronic
962867748 3:139461730-139461752 CCAGCCAAGCACTGCCATGGAGG - Intronic
964298091 3:155256112-155256134 CCAGACCAGCCCAGCCAACATGG - Intergenic
964646066 3:158959651-158959673 CTAGCCCAGCTCAGCCATTCAGG - Intergenic
965622010 3:170651373-170651395 CCAGCCAAGGGAAGCCATGAGGG - Intronic
966251016 3:177865639-177865661 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
966850754 3:184163753-184163775 CCAGCCCAGCACAGGGATGCAGG - Intronic
966881635 3:184354112-184354134 CCAGCCGAGCTCAGGCAGGTAGG + Exonic
967085402 3:186090789-186090811 CCAGCCCTGCTCAGCATTTAGGG - Intronic
967715522 3:192757972-192757994 CCAGCCAAGGGAAGCCATGAGGG + Intronic
967874043 3:194254273-194254295 CCAGCCGAGCTGAGCCTTGCTGG - Intergenic
968290214 3:197533256-197533278 CCAGCCCCTCCCAGCCAGGAAGG - Intronic
968562901 4:1294461-1294483 CCAACCTAGCCCAGCCATTACGG - Intronic
968589234 4:1449498-1449520 CCAGCCCAGATCAGCCTGCAGGG - Intergenic
968658693 4:1789820-1789842 CCGGCCCAGCCCAGCCCTGGCGG - Intergenic
968752883 4:2399367-2399389 CCAGCCCAGCTCCGCAAAGAGGG - Intronic
968830898 4:2932624-2932646 CGAGCCCAGGTCAGCAACGATGG + Exonic
968869803 4:3235988-3236010 CCAGCCCAGCTCAGCCACATGGG - Intronic
968971665 4:3798844-3798866 CCAGCACAGCTCAGACCTTAGGG + Intergenic
968980446 4:3846186-3846208 CCAGCACATTTCAGCCATGGTGG - Intergenic
969239120 4:5888011-5888033 CCAGCCCCGCCCCGCCATGCGGG + Intronic
969259603 4:6025117-6025139 ACACCCCAGCTGAGCCCTGAGGG + Intergenic
969598629 4:8162818-8162840 CTCACCCAGCTCAGCCATGCAGG - Intergenic
970214587 4:13745594-13745616 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
970679311 4:18489094-18489116 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
970762621 4:19509505-19509527 CAAGACCAGCTTAGCCAAGATGG - Intergenic
971338398 4:25745192-25745214 CAAGCCCAGCTTAGCCAACATGG + Intergenic
971387581 4:26155324-26155346 GCTCCCCACCTCAGCCATGAAGG - Intergenic
972600189 4:40565356-40565378 CCAGCCCAGCAGAGGCATCAAGG - Intronic
972631582 4:40846647-40846669 CCTGCCCAGCAGCGCCATGATGG + Intronic
975695095 4:77004760-77004782 CAAGACCAGCTCAGCCAACATGG + Intronic
977136323 4:93309332-93309354 CCAGACCAGCTTAGCCAACATGG + Intronic
980160041 4:129149973-129149995 ACAGCCAGGCTCAGTCATGAAGG + Intergenic
982170249 4:152655238-152655260 CCAGCCAGTCTCAGCCAAGAAGG - Intronic
982232836 4:153224345-153224367 CCTGCCCAACTCAGCCCTAAGGG - Intronic
982607086 4:157528597-157528619 CGAGCCATGCTCAGCCATGCTGG + Intergenic
982743739 4:159084825-159084847 CCAGGCCTGGTCAGCCATGAGGG - Intergenic
983485967 4:168331574-168331596 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
984582398 4:181525208-181525230 CCAGATCAGCTCAGCCAACATGG + Intergenic
985194090 4:187408656-187408678 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
985520537 5:372175-372197 CCAGCCCACCCCAGCCCTGGGGG - Intronic
986298261 5:6457148-6457170 CCAGCACTGTACAGCCATGATGG + Intronic
986661011 5:10060248-10060270 CCAGCCAAGCTCTACCATGAAGG + Intergenic
987072854 5:14354148-14354170 CCAGCCCTGCTCAGACAGTAGGG - Intronic
987203475 5:15601028-15601050 CCAAGCCATCTCAGCCATAAAGG - Intronic
988930938 5:36035085-36035107 CCAAGCCTGCTCAGCCAAGAAGG + Exonic
989391742 5:40907608-40907630 CAAGACCAGCCTAGCCATGATGG - Intergenic
989992701 5:50786743-50786765 CGAGCCCAGCTCAGCAAAGAAGG - Intronic
992074949 5:73183763-73183785 TGATCCCACCTCAGCCATGAGGG + Intergenic
992789483 5:80200891-80200913 CCAGACCAGCCCAGCCAACATGG + Intronic
993265406 5:85721204-85721226 CTAGCCAAGTGCAGCCATGAGGG + Intergenic
993402208 5:87467510-87467532 CCAGCCAATCTCAGCCAAGCTGG + Intergenic
994770324 5:103973512-103973534 CCAGCCAATCTCAGCCAAGCTGG - Intergenic
996139976 5:119895105-119895127 CCAGACCACCTCAGCAGTGATGG - Intergenic
996265165 5:121531179-121531201 CAAGACCAGCCCAGCCAAGATGG + Intergenic
996568196 5:124904143-124904165 AGAGCCCAGCTCATCCATCATGG - Intergenic
997243770 5:132328629-132328651 ACACCCCAGCACAGCCCTGAAGG - Intronic
997472544 5:134124857-134124879 CCAAACCAGCTCAGACATGGTGG - Intronic
998108108 5:139481377-139481399 CCAGCCCAGCTCAGCCAGAGAGG + Intronic
998402172 5:141853658-141853680 CCCGCCCTGGTCGGCCATGAGGG + Exonic
999140255 5:149356767-149356789 CGAGACCAGCTCGGCCATCATGG - Intergenic
999308042 5:150533266-150533288 CCAGGCCAGCTCAGCCCGAAAGG - Intronic
1000547998 5:162625626-162625648 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
1000589984 5:163146638-163146660 CTAGCCCAGGGAAGCCATGAGGG + Intergenic
1000820256 5:165973883-165973905 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
1002012943 5:176298431-176298453 CGAGGCCAGCTCAGCCAACATGG + Intronic
1002214896 5:177624302-177624324 CGAGGCCAGCTCAGCCAACATGG - Intergenic
1002816758 6:688276-688298 CCAGCTCAGCTGGGCCATCAAGG - Intronic
1002882842 6:1268047-1268069 CCGGCCCAGCTAAGCCTTGAAGG - Intergenic
1002923651 6:1592193-1592215 TCATCACAGCTCAGCCATCATGG + Intergenic
1003604632 6:7548064-7548086 CCAGCCCAGCCTAGCCAATATGG + Intronic
1004686302 6:17948759-17948781 CCAGCCCAGCCCAGCCAACATGG - Intronic
1005499034 6:26413817-26413839 CCTGCCCAGCTCAGAGCTGAGGG + Exonic
1005791181 6:29302463-29302485 GCAACCGTGCTCAGCCATGAGGG + Intergenic
1005900160 6:30210394-30210416 CCAGTCCAGCGCATCCTTGAAGG + Intronic
1006595310 6:35188850-35188872 TCAGCCAAGCTCAGACAGGATGG + Intergenic
1006634795 6:35454260-35454282 CCAGACCAGCCCAGCCAATATGG - Intronic
1006641583 6:35492228-35492250 TCAGCCCAGCTCAGGTTTGAGGG - Intronic
1007089632 6:39174220-39174242 CCAGACCAGCTTGGCCAAGATGG + Intergenic
1007389930 6:41545328-41545350 CCAACCCAGCTCAGTGATGCCGG - Intergenic
1008486926 6:52046640-52046662 CCAGCCCAGCTGAGGAATGTTGG + Intronic
1009959571 6:70501702-70501724 CAAGCCAAGCAAAGCCATGAGGG - Intronic
1010289979 6:74124326-74124348 CCAGCCTTGTGCAGCCATGAAGG + Intergenic
1014129155 6:117811207-117811229 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
1014845889 6:126276524-126276546 CCAGCCCTGCTCCTCCTTGAGGG + Intergenic
1015690120 6:135912916-135912938 CCAGCCCAGGGCAGACAGGATGG - Intronic
1016145316 6:140664738-140664760 CCAGTCCAGCCCGGCCAAGATGG + Intergenic
1016581830 6:145636719-145636741 CCAGACCAGCCCAGCCAACATGG + Intronic
1017006980 6:150035105-150035127 CCAGCCCAGGTCAGCCCAGGAGG - Intergenic
1017621498 6:156303993-156304015 CCAGACCAGCTTAGCCAACATGG - Intergenic
1017872230 6:158496207-158496229 CAAGGCCAGCTCAGCCAGGGGGG + Intronic
1019203734 6:170341705-170341727 CCAGCCAAGGGAAGCCATGAGGG - Intronic
1019541016 7:1551034-1551056 CCAGCCCAGGTGAGCCGGGAAGG + Intronic
1019541084 7:1551236-1551258 CCAGCCCAGGTGAGCCGGGAAGG + Intronic
1019628291 7:2032582-2032604 TCAGCCCAGCACAGCTCTGAAGG - Intronic
1019999405 7:4746799-4746821 CCAGCCCAGATCAGCCAGGCAGG - Intronic
1023023204 7:36029080-36029102 CAAGCCCAGCCCAGCCAACATGG + Intergenic
1023233749 7:38062747-38062769 CGAGCCCATCTTAGCCAAGATGG + Intergenic
1023905482 7:44518867-44518889 CCAGCCCAGCCCAGCAATTCGGG + Intronic
1024334206 7:48188776-48188798 TCAGCACAGCTGAGCCACGATGG - Intronic
1024412310 7:49059357-49059379 CAAGACCAGCCCAGCCAAGATGG + Intergenic
1026628396 7:72016745-72016767 CCTGCCCATCTCTGCCATCACGG + Intronic
1026679685 7:72456234-72456256 CCCACCAAGCCCAGCCATGAAGG - Intergenic
1026891679 7:73986132-73986154 CCAGACCAGCTGAGCCAGGGTGG + Intergenic
1027790330 7:82633312-82633334 CCAGCCCAGGGAAGCCATTAGGG + Intergenic
1028998425 7:97127015-97127037 CCAGCCAAGGGAAGCCATGAGGG - Intronic
1029613563 7:101641836-101641858 CAAGACCAGCTCAGCCAACATGG + Intergenic
1030297985 7:107947889-107947911 CCACCCCAGCTCAGCCACTGTGG + Intronic
1032080768 7:128857371-128857393 GCAGCCCAGCCCAGCCTGGAGGG + Intronic
1032091485 7:128913789-128913811 GCAGCCCAGCCCAGCCTGGAGGG - Intergenic
1033842688 7:145394502-145394524 CCACCCCAGCTCTGCTATGTAGG + Intergenic
1034168880 7:149047389-149047411 CCAGGCCAGCTTAGCCAACATGG - Intergenic
1034433064 7:151050538-151050560 CAAGCCCAGCTGATCGATGATGG - Exonic
1035675932 8:1455497-1455519 TCAGCCCTGCTCAGGCGTGAAGG - Intergenic
1036530829 8:9584978-9585000 ACAGCCCATCTCAGCCAGAAGGG + Intronic
1037709683 8:21345758-21345780 CCAGCCCTGCTCTGCAAGGATGG + Intergenic
1037730138 8:21517288-21517310 CCAGCCCAGCTGAGGCTTCAGGG - Intergenic
1037786218 8:21904865-21904887 CCAGCCCAGCCCGGCCAACATGG + Intergenic
1038129984 8:24719233-24719255 CCAGTCTAGTTCAGCCAAGATGG + Intergenic
1038495532 8:27999462-27999484 CCAGCACAGCTCACCCTTCAAGG + Intergenic
1038584272 8:28775536-28775558 CCAACCCAGCCCAGCCAATATGG - Intronic
1039108853 8:34019840-34019862 CAAGACCAGCCCAGCCAAGATGG - Intergenic
1039188642 8:34946630-34946652 CCTTCCAAGCTCAGCCATTAAGG + Intergenic
1039442287 8:37603369-37603391 CCAGGGCAGCTCAGCCAGGCAGG + Intergenic
1040312349 8:46243302-46243324 CCTGCCCAGCGCAGCCCTGGGGG - Intergenic
1040323807 8:46331173-46331195 CCGGCCCAGGACAGCCATGGGGG - Intergenic
1040336486 8:46418657-46418679 CCCGCCCAGGACAGCCCTGAGGG - Intergenic
1040341557 8:46443669-46443691 CCAGCCCAGGACAGCCCTGGGGG + Intergenic
1040341979 8:46445696-46445718 CCTGCCCAGGACAGCCCTGAGGG + Intergenic
1040751003 8:50707998-50708020 CGAGACCAGCCCAGCCAAGATGG + Intronic
1041154987 8:54976803-54976825 CTAGCCCAGGGAAGCCATGAGGG + Intergenic
1041806429 8:61854572-61854594 CCAGCCCACACCAGCCAGGAAGG + Intergenic
1044164751 8:88967882-88967904 CGAGCCCAGCAAAGCCATGTGGG + Intergenic
1045327504 8:101127649-101127671 CCTGGCCAACTCAGCCAAGAGGG - Intergenic
1049338647 8:142100175-142100197 CCACCTCCTCTCAGCCATGATGG - Intergenic
1049750993 8:144283915-144283937 CGAGACCAGCTCAGCCAACATGG + Intronic
1049785613 8:144449300-144449322 CCAGCCCTGCTCAGCCACCACGG + Intergenic
1050766892 9:9145663-9145685 GTAGCCCAGCTTAGACATGAGGG - Intronic
1052763656 9:32618457-32618479 TCAGCTCAGCTCATCCAGGATGG - Intergenic
1053286756 9:36854781-36854803 CCAGCTCAGGCCAGCCACGAGGG + Intronic
1053905177 9:42835415-42835437 CCAGACCAGCTTAGTCAAGATGG + Intergenic
1057290163 9:93801330-93801352 CCAGGCCAGCCAAGCCACGATGG + Intergenic
1058265735 9:102897345-102897367 CCAGCCTAGGGAAGCCATGAGGG + Intergenic
1059233426 9:112742261-112742283 CCAGACCAGCTTAGCCAACATGG - Intergenic
1059341853 9:113601752-113601774 CCATCCCTGTTCAGCCATGATGG - Intergenic
1059488387 9:114645214-114645236 CCAGGTCATCTCAGCCATGTGGG - Intronic
1059668715 9:116473700-116473722 CCAGCCCAGCTGGGCCAACATGG + Intronic
1060549511 9:124478317-124478339 CCTGCCCAGCTCAGCTCTGCTGG + Exonic
1060562916 9:124561709-124561731 CCAGACCAGCTTGGCCATCATGG + Intronic
1061900936 9:133671656-133671678 CCAGCCCAGCTCCCCCACAAAGG + Exonic
1062265212 9:135683759-135683781 CCACCCCAGGCCAGCCCTGAGGG + Intergenic
1062403733 9:136383703-136383725 CAAGCCCGGTTCACCCATGATGG + Intronic
1185644385 X:1606912-1606934 CCAGACCAGCCCAGCCAACACGG + Intergenic
1186509514 X:10119992-10120014 CCAGCACAGCTGATACATGATGG - Intronic
1186774923 X:12854973-12854995 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
1190963787 X:55278325-55278347 CCAGCCAAGGGAAGCCATGAGGG - Intronic
1190966478 X:55305922-55305944 CCAGCCAAGGGAAGCCATGAGGG - Intergenic
1191591271 X:62888027-62888049 CCAGCCAAGGTAAGCCATGAGGG + Intergenic
1191909013 X:66127440-66127462 CCAGCCAAGAGAAGCCATGAGGG - Intergenic
1192529654 X:71873377-71873399 CCAGCCAAGCCCAGCCAAGGGGG + Intergenic
1192971242 X:76233566-76233588 CCAGCCAAGGGTAGCCATGAGGG + Intergenic
1193071826 X:77314601-77314623 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
1193404418 X:81083853-81083875 CCAGCCAAGGGAAGCCATGAGGG + Intergenic
1195140036 X:101950087-101950109 CCAGCCAAGGGAAGCCATGAAGG + Intergenic
1196463866 X:115953371-115953393 CCAGCCTAGGTCAGACAGGAGGG + Intergenic
1196790611 X:119461089-119461111 CAAGACCAGCCCAGCCAAGATGG + Intergenic