ID: 1147723765

View in Genome Browser
Species Human (GRCh38)
Location 17:42554187-42554209
Sequence TTGTAGCCTCAGATGGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147723754_1147723765 12 Left 1147723754 17:42554152-42554174 CCCCGCTAGATTCGAATCCTGAC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1147723765 17:42554187-42554209 TTGTAGCCTCAGATGGATTTGGG 0: 1
1: 0
2: 2
3: 14
4: 141
1147723753_1147723765 19 Left 1147723753 17:42554145-42554167 CCAGGGACCCCGCTAGATTCGAA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1147723765 17:42554187-42554209 TTGTAGCCTCAGATGGATTTGGG 0: 1
1: 0
2: 2
3: 14
4: 141
1147723755_1147723765 11 Left 1147723755 17:42554153-42554175 CCCGCTAGATTCGAATCCTGACA 0: 1
1: 0
2: 1
3: 9
4: 69
Right 1147723765 17:42554187-42554209 TTGTAGCCTCAGATGGATTTGGG 0: 1
1: 0
2: 2
3: 14
4: 141
1147723756_1147723765 10 Left 1147723756 17:42554154-42554176 CCGCTAGATTCGAATCCTGACAC 0: 1
1: 0
2: 0
3: 9
4: 56
Right 1147723765 17:42554187-42554209 TTGTAGCCTCAGATGGATTTGGG 0: 1
1: 0
2: 2
3: 14
4: 141
1147723759_1147723765 -5 Left 1147723759 17:42554169-42554191 CCTGACACCAGGGCTCCCTTGTA 0: 1
1: 0
2: 0
3: 13
4: 150
Right 1147723765 17:42554187-42554209 TTGTAGCCTCAGATGGATTTGGG 0: 1
1: 0
2: 2
3: 14
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147723765 Original CRISPR TTGTAGCCTCAGATGGATTT GGG Intronic
900384144 1:2401692-2401714 TTGCAGCCGCAGATGGAGTGTGG + Intronic
902102919 1:14008195-14008217 TTTTATCCCCAGATGCATTTAGG - Intergenic
902114561 1:14110684-14110706 TTGTAGCCACAGATGGTTTGTGG - Intergenic
905787729 1:40771276-40771298 TTCTGCCCTCAGATGGAATTAGG + Intronic
906860375 1:49352869-49352891 TAGTAGCAGCAGATGGAGTTGGG + Intronic
908473527 1:64468173-64468195 TTGCAGCCAGACATGGATTTAGG + Intergenic
909866334 1:80677176-80677198 TTGTAGGCACAGGTGTATTTTGG - Intergenic
914688872 1:150007796-150007818 TTGTAGCCTCTGATAAATTCAGG - Intronic
914719328 1:150276501-150276523 TTCTACCCTCAGTAGGATTTGGG - Exonic
921172855 1:212564754-212564776 CTGTAGCGTCACATAGATTTGGG + Intergenic
922020258 1:221697296-221697318 TTGTAGCCTCTGATGGTTGCTGG + Intergenic
922332754 1:224591756-224591778 CTTTAGAGTCAGATGGATTTGGG + Intronic
1064082924 10:12323074-12323096 GTGTGGCCTCAAGTGGATTTGGG - Intergenic
1064283659 10:13973010-13973032 TTGTAACCTCAGTTTGAATTTGG + Intronic
1066633559 10:37479838-37479860 GTGTGGCCTCAAGTGGATTTGGG - Intergenic
1068836961 10:61566494-61566516 TTGTAGTCCCACCTGGATTTGGG + Intergenic
1069152444 10:64981155-64981177 TGGTAGCCTCAGATGTTTCTTGG - Intergenic
1069778072 10:70938304-70938326 CTGGATCCTCAGATCGATTTGGG - Intergenic
1070280174 10:75043012-75043034 TTGTAGCCTTTGCTGGATTAGGG + Intronic
1071687908 10:87781136-87781158 TTGTAACATTAGATGGCTTTAGG - Intronic
1075135906 10:119786075-119786097 TTTTAGCTTCAGATGGATGTAGG + Intronic
1076197235 10:128527655-128527677 GTGTAGCATCTGATGGATTCAGG + Intergenic
1078351449 11:10598082-10598104 CTATATCCTCAGATGGAATTTGG - Intronic
1079582103 11:22078503-22078525 TTGTAGCATTATATTGATTTGGG - Intergenic
1079786666 11:24681593-24681615 TTGTAGTCTTAAATGTATTTTGG + Intronic
1079841708 11:25409703-25409725 TTGTATCCTCACATGAATTTTGG - Intergenic
1084371762 11:68750122-68750144 TAGCAGCCTCAGATGGGTTGGGG + Intronic
1084585082 11:70054860-70054882 TTTTAGGCTCAAATGCATTTAGG + Intergenic
1086162137 11:83733770-83733792 TTGTTGCTTTAAATGGATTTAGG + Intronic
1093610756 12:21152619-21152641 TGGTAGAGTGAGATGGATTTTGG + Intronic
1094483893 12:30908730-30908752 CTCTGGCTTCAGATGGATTTGGG - Intergenic
1095848709 12:46776593-46776615 TTGTAGCCTGAGTTGGACTATGG + Intronic
1096347633 12:50864273-50864295 TTGAAGCCTTAGATGAAGTTGGG - Intronic
1096539103 12:52294136-52294158 TTGTACCCTCATCTGGAATTTGG + Intronic
1097628295 12:62028582-62028604 TTGTAAGCTAAGATGGATTCTGG - Intronic
1099289945 12:80764145-80764167 TTGGAACCTCAGTTGGATTAAGG - Intergenic
1101411494 12:104472564-104472586 ATGGAGACTCAGAAGGATTTAGG + Intronic
1104248765 12:127069408-127069430 TGGTACACTCAGTTGGATTTTGG + Intergenic
1107150838 13:37108798-37108820 TTTTAGTCTCATATGAATTTTGG + Intergenic
1109136737 13:58661219-58661241 TGCTAGCCTCAGATCCATTTTGG - Intergenic
1110931105 13:81217805-81217827 TGGTAGCCTCAGCTGAATTAGGG - Intergenic
1112273446 13:97993334-97993356 TTTTAGAATCAGATGAATTTGGG + Intronic
1112567546 13:100564067-100564089 TTGAAGCTTCACATGCATTTTGG - Intronic
1117263334 14:54059647-54059669 CTATAGCCTCTGATGGATCTGGG - Intergenic
1127039817 15:54962352-54962374 TTGTGGCCTCAGCTATATTTGGG - Intergenic
1127748035 15:62001300-62001322 TATTGGCGTCAGATGGATTTGGG - Intronic
1127943069 15:63720475-63720497 TTTTAGCCTCAAATTAATTTTGG + Intronic
1130796973 15:87220019-87220041 TTCTGGCTTCAGATTGATTTGGG - Intergenic
1132289783 15:100691573-100691595 ATGTAGCATCAGGTGGATCTGGG + Intergenic
1133146837 16:3793890-3793912 TTGTAGAGTGAGTTGGATTTTGG - Intronic
1139370345 16:66464197-66464219 TTGAATCTTCAGATGAATTTGGG + Intronic
1139500534 16:67360712-67360734 TTAGAGCCTCAGATGGATGGAGG + Intronic
1141409514 16:83822930-83822952 CAGAAGCCTCAGATGAATTTTGG - Intergenic
1144588186 17:16501536-16501558 TTTTAGACTCAGAGGAATTTAGG + Intergenic
1145213509 17:21034190-21034212 CTGTACCCTTAGATTGATTTTGG - Intronic
1147722564 17:42547982-42548004 TGGCAGCCTCAGATGGGTTTGGG + Intergenic
1147723765 17:42554187-42554209 TTGTAGCCTCAGATGGATTTGGG + Intronic
1148138761 17:45313062-45313084 TTGTAGCCTCATTTGGAGTATGG + Intronic
1155141305 18:23047049-23047071 ATGTATCTTCAGTTGGATTTTGG + Intergenic
1159064086 18:63550352-63550374 TTTTGGCCCCAGATGCATTTAGG - Intergenic
1160167412 18:76526702-76526724 TTGAAGGCTCAGAGAGATTTAGG - Intergenic
926800611 2:16656877-16656899 TGGTTGCCTCAGATGTATTTTGG - Intronic
928437888 2:31267616-31267638 GAGTAGCCTCAGAAGGGTTTAGG + Exonic
935048987 2:99507832-99507854 ATGTAGCCTCTGATTGATCTAGG + Intergenic
935226249 2:101055488-101055510 TTGTAGCCTTAAATGGATATTGG + Intronic
938663741 2:133512812-133512834 TTGAAGCGTCAGAGGGAATTTGG - Intronic
939259102 2:139783947-139783969 TTTTATCCTTAGATGGAGTTGGG + Intergenic
939796292 2:146648135-146648157 TTGAAGCCACAGATGGATTCGGG - Intergenic
940908324 2:159188521-159188543 CTGTGGCCTCAGGAGGATTTAGG + Intronic
941855353 2:170225674-170225696 TTTTAGAGTCAGATAGATTTGGG + Intronic
945097635 2:206234523-206234545 TTTTATACTCAGATGGATATAGG + Intergenic
945377992 2:209101822-209101844 TTGTAGAAACAGATGAATTTAGG + Intergenic
946608463 2:221432367-221432389 TTGTAGCCACATTTGGATTCAGG - Intronic
948201337 2:236131465-236131487 GTGTATCCACAGATGGGTTTAGG + Exonic
1169390687 20:5188362-5188384 TCGTAGCCTCAGATGGTTTTGGG - Intronic
1170119204 20:12893815-12893837 TTGGAGCCTCAGAGGGGCTTAGG + Intergenic
1173220887 20:41132179-41132201 TTGGAGCCACAGATAGATTTGGG + Intergenic
1173426372 20:42946955-42946977 TTGTACCCTCAGATGACATTTGG - Intronic
1175237168 20:57522769-57522791 TTGCAGCCCCAGAGGGATATGGG - Intronic
1175838227 20:62010149-62010171 TTGTAGCCTCAGCTCGTTCTGGG - Exonic
1176518001 21:7800693-7800715 TTGTAGCCTGAGAGGGTTCTTGG + Intergenic
1176668557 21:9710514-9710536 TTGTGGACTCACATGGATCTTGG + Intergenic
1178652029 21:34430706-34430728 TTGTAGCCTGAGAGGGTTCTTGG + Intergenic
1179589306 21:42395513-42395535 TTGTAGCATCAGGTGCATCTTGG + Intronic
1183171424 22:36191084-36191106 TTTTAGACTCTGATGGATATGGG + Exonic
1184243311 22:43222805-43222827 TTGGGGCCTCAGAGGGATTGTGG + Intronic
950701744 3:14755256-14755278 TTTTTGCCACAGAGGGATTTTGG + Intronic
951227365 3:20136024-20136046 CTCTAGCCTCATATGGATTAGGG + Intronic
955922781 3:63974910-63974932 TTGTAGCATCAGATGTGTTTGGG + Intronic
957562338 3:81838536-81838558 TTTTTGCTTCTGATGGATTTGGG + Intergenic
958134836 3:89475573-89475595 TCATAACCTAAGATGGATTTAGG + Intronic
959352290 3:105281090-105281112 TTGGAGGCTCAGAAGGATGTGGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960182537 3:114598057-114598079 TTGTGGCCTCACATGGAAGTTGG - Intronic
963694620 3:148550094-148550116 TTGTAGTTTTAGATGAATTTTGG - Intergenic
963721270 3:148864906-148864928 TTGGAGACTGAGATGAATTTGGG - Intergenic
965518655 3:169650320-169650342 TAGTAGCATCAGTTGGCTTTAGG + Intronic
966914147 3:184575665-184575687 TTGTAGCTGCAGCTGGAGTTAGG + Intronic
969211120 4:5687979-5688001 ATGCAGCCTCAGATGGACCTGGG - Intronic
970307621 4:14749680-14749702 TTGTAACCTCATAGGGTTTTTGG - Intergenic
971701020 4:29976572-29976594 TTGTAGATTCAGATGTATTTAGG - Intergenic
973076176 4:45929085-45929107 TTGTGGCCTCAGAAAGAATTTGG + Intergenic
975519409 4:75283287-75283309 CTGTAGCATTAGAAGGATTTAGG + Intergenic
975644196 4:76529676-76529698 TAGAAACCTCAGATGGGTTTGGG - Intronic
977528154 4:98168832-98168854 TTGCAGCCTGAGATGAATTTTGG - Intergenic
978531384 4:109717827-109717849 TTGTAGGCAGAAATGGATTTTGG - Intronic
978695765 4:111576016-111576038 TTGTTGCCTCAGGTGGTTGTGGG - Intergenic
981674137 4:147321594-147321616 TTGTGGCCTTATATGTATTTAGG - Intergenic
982048698 4:151476526-151476548 ATTTAGGCTCAGATGGTTTTAGG - Intronic
982277543 4:153651924-153651946 TTTTAGCATCAGATGGACTCGGG - Intergenic
983164308 4:164456603-164456625 TTGAATCTTCAGATGGCTTTGGG - Intergenic
983415928 4:167454325-167454347 TTGTAGGCTCAGAGAGAATTTGG - Intergenic
985406225 4:189641013-189641035 TTGTGGACTCACATGGATCTTGG - Intergenic
990102523 5:52210140-52210162 TTGTAGCCTCAGATGAAAAGAGG - Intergenic
997386595 5:133478236-133478258 TTGTGGCCCCATTTGGATTTAGG + Intronic
1001018537 5:168163252-168163274 TTGGAGCCACAGCTGGGTTTGGG - Intronic
1002563298 5:180096808-180096830 TTGCAGCCTCAGAGGGAGATGGG - Intergenic
1002979763 6:2125007-2125029 TTCCAGAATCAGATGGATTTGGG + Intronic
1006604995 6:35249723-35249745 TTGTAGCCCCAGCTGGCTTGTGG + Exonic
1007997442 6:46323130-46323152 TTGTAAACTCAGCTGGATTTAGG + Intronic
1010574170 6:77511517-77511539 TAGCTGCCTCAGATGGTTTTTGG + Intergenic
1014258778 6:119191780-119191802 TTGTAGCTTCAAGTAGATTTTGG - Intronic
1015937103 6:138415224-138415246 TTTTAGGCTGAGATGGAGTTAGG - Exonic
1018324399 6:162649559-162649581 TTGTAGATTCAGAGAGATTTGGG + Intronic
1018789246 6:167133671-167133693 TTGTATCTACAGATCGATTTGGG + Intronic
1020612126 7:10411564-10411586 GTGTAACATCAGATGGAATTTGG + Intergenic
1021439923 7:20666237-20666259 AGGTTGCCTCAGTTGGATTTGGG - Intronic
1021440641 7:20670446-20670468 AGGTTGCCTCAGTTGGATTTGGG - Intronic
1021716498 7:23467711-23467733 TTTTAGCCTCTGAAGCATTTTGG - Intronic
1024014590 7:45300650-45300672 TTGTGGTCTCATATGAATTTGGG - Intergenic
1026713060 7:72760231-72760253 TTGTAGTTTCAGATGAATTTAGG - Intronic
1026910590 7:74089628-74089650 TTGTTGACTCTGATGGAATTGGG + Intronic
1031004030 7:116452079-116452101 TGGAAGCCTGACATGGATTTAGG - Intronic
1031076495 7:117218416-117218438 TTGTAGCATCAGATGACATTAGG - Intronic
1031579479 7:123453785-123453807 TTGTTGTCTCAGTTGCATTTAGG - Intronic
1034471940 7:151259571-151259593 TTGTAACCTCAGCTGGCATTTGG - Intronic
1034841616 7:154402976-154402998 TCTTAGTCTCAGAGGGATTTAGG + Intronic
1038346413 8:26736261-26736283 TTGTAGATTTAGATAGATTTAGG + Intergenic
1041311208 8:56518781-56518803 GAGAAGCCTCAGATGGCTTTAGG - Intergenic
1041675142 8:60530706-60530728 TTGTAATCACTGATGGATTTGGG + Intronic
1041929737 8:63273509-63273531 TTGTAGCCTCTGATGTCATTGGG + Intergenic
1042637055 8:70889017-70889039 TTGAAGCCGCAGATTGCTTTTGG + Intergenic
1047174116 8:122524300-122524322 TAGTAGCCTGAGCTGGAATTTGG - Intergenic
1049915594 9:314947-314969 TTGTAGACTCAGAATGAATTAGG - Intronic
1050410760 9:5362839-5362861 CGGAAGCCTCAGATGGGTTTGGG + Intronic
1052397937 9:27963784-27963806 TTATAGCCTCAGATGTATTTTGG - Intronic
1056488593 9:87083693-87083715 TTCTACCCTCAGATTGAATTAGG - Intergenic
1059439065 9:114292679-114292701 TTGTAGCAGCAGATGTAGTTGGG - Intronic
1061992850 9:134169609-134169631 TTGCAGGCTCACATGGCTTTAGG + Intergenic
1203657309 Un_KI270753v1:10427-10449 TTGTGGACTCACATGGATCTTGG - Intergenic
1187219618 X:17310856-17310878 TTATTCACTCAGATGGATTTTGG + Intergenic
1187519451 X:20000755-20000777 TTATATCCTCAGCAGGATTTGGG - Intergenic
1189554366 X:42126788-42126810 CTGTAGCATCAGAAGGATTCTGG + Intergenic
1191010691 X:55754749-55754771 TTGTAACCCCAGAGGTATTTGGG + Intronic
1194150836 X:90323563-90323585 TAGCAGCCTGAGATGTATTTGGG + Intergenic
1196334398 X:114514295-114514317 TTGTAGCATCAAATGGCTTTGGG - Intergenic
1197444155 X:126528079-126528101 TTGTTGCCTCTGATGGAATAGGG + Intergenic
1200497204 Y:3900324-3900346 TAGCAGCCTGAGATGTATTTGGG + Intergenic