ID: 1147723784

View in Genome Browser
Species Human (GRCh38)
Location 17:42554280-42554302
Sequence CGCGAGCAGCACCGCTGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 108}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147723784_1147723802 18 Left 1147723784 17:42554280-42554302 CCAGCGCAGCGGTGCTGCTCGCG 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1147723802 17:42554321-42554343 GTTGGGGCTGGGACTGGGGTTGG 0: 2
1: 3
2: 26
3: 454
4: 1693
1147723784_1147723807 30 Left 1147723784 17:42554280-42554302 CCAGCGCAGCGGTGCTGCTCGCG 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1147723807 17:42554333-42554355 ACTGGGGTTGGGGCTGGGACTGG 0: 1
1: 0
2: 36
3: 357
4: 1314
1147723784_1147723791 -10 Left 1147723784 17:42554280-42554302 CCAGCGCAGCGGTGCTGCTCGCG 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1147723791 17:42554293-42554315 GCTGCTCGCGGTCGGGGGCCGGG 0: 1
1: 0
2: 0
3: 30
4: 179
1147723784_1147723797 7 Left 1147723784 17:42554280-42554302 CCAGCGCAGCGGTGCTGCTCGCG 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1147723797 17:42554310-42554332 GCCGGGACGTGGTTGGGGCTGGG 0: 1
1: 0
2: 0
3: 24
4: 283
1147723784_1147723795 2 Left 1147723784 17:42554280-42554302 CCAGCGCAGCGGTGCTGCTCGCG 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1147723795 17:42554305-42554327 CGGGGGCCGGGACGTGGTTGGGG 0: 1
1: 0
2: 1
3: 28
4: 280
1147723784_1147723803 19 Left 1147723784 17:42554280-42554302 CCAGCGCAGCGGTGCTGCTCGCG 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1147723803 17:42554322-42554344 TTGGGGCTGGGACTGGGGTTGGG 0: 1
1: 3
2: 33
3: 414
4: 1367
1147723784_1147723805 24 Left 1147723784 17:42554280-42554302 CCAGCGCAGCGGTGCTGCTCGCG 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1147723805 17:42554327-42554349 GCTGGGACTGGGGTTGGGGCTGG 0: 2
1: 7
2: 235
3: 464
4: 2049
1147723784_1147723799 12 Left 1147723784 17:42554280-42554302 CCAGCGCAGCGGTGCTGCTCGCG 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1147723799 17:42554315-42554337 GACGTGGTTGGGGCTGGGACTGG 0: 1
1: 0
2: 1
3: 38
4: 461
1147723784_1147723804 20 Left 1147723784 17:42554280-42554302 CCAGCGCAGCGGTGCTGCTCGCG 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1147723804 17:42554323-42554345 TGGGGCTGGGACTGGGGTTGGGG 0: 2
1: 7
2: 207
3: 486
4: 2136
1147723784_1147723801 14 Left 1147723784 17:42554280-42554302 CCAGCGCAGCGGTGCTGCTCGCG 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1147723801 17:42554317-42554339 CGTGGTTGGGGCTGGGACTGGGG 0: 1
1: 0
2: 6
3: 108
4: 1072
1147723784_1147723794 1 Left 1147723784 17:42554280-42554302 CCAGCGCAGCGGTGCTGCTCGCG 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1147723794 17:42554304-42554326 TCGGGGGCCGGGACGTGGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 112
1147723784_1147723792 -4 Left 1147723784 17:42554280-42554302 CCAGCGCAGCGGTGCTGCTCGCG 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1147723792 17:42554299-42554321 CGCGGTCGGGGGCCGGGACGTGG 0: 1
1: 0
2: 1
3: 54
4: 533
1147723784_1147723806 25 Left 1147723784 17:42554280-42554302 CCAGCGCAGCGGTGCTGCTCGCG 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1147723806 17:42554328-42554350 CTGGGACTGGGGTTGGGGCTGGG 0: 1
1: 6
2: 188
3: 424
4: 1763
1147723784_1147723800 13 Left 1147723784 17:42554280-42554302 CCAGCGCAGCGGTGCTGCTCGCG 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1147723800 17:42554316-42554338 ACGTGGTTGGGGCTGGGACTGGG 0: 1
1: 0
2: 0
3: 36
4: 402
1147723784_1147723796 6 Left 1147723784 17:42554280-42554302 CCAGCGCAGCGGTGCTGCTCGCG 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1147723796 17:42554309-42554331 GGCCGGGACGTGGTTGGGGCTGG 0: 1
1: 0
2: 3
3: 37
4: 552
1147723784_1147723793 0 Left 1147723784 17:42554280-42554302 CCAGCGCAGCGGTGCTGCTCGCG 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1147723793 17:42554303-42554325 GTCGGGGGCCGGGACGTGGTTGG 0: 1
1: 0
2: 1
3: 18
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147723784 Original CRISPR CGCGAGCAGCACCGCTGCGC TGG (reversed) Intronic
900787028 1:4655616-4655638 CTGGAGCAGCACCGCGGCCCTGG + Intronic
903044224 1:20553625-20553647 CGCCAGCAGCATCTCCGCGCTGG + Exonic
905823676 1:41013869-41013891 CTCGAGCAGCCCCGCCACGCTGG + Intergenic
908291352 1:62670073-62670095 CGAGCGCAGCACCGGTGGGCCGG - Intronic
911153133 1:94614470-94614492 CGTCAGCAGCACCCCTGGGCAGG - Intergenic
912712268 1:111958482-111958504 CCCTAGCAGCACCTCTGCTCTGG - Intronic
916106989 1:161440250-161440272 CGCGGGCAGCCCCGCCGCGCCGG + Intergenic
916108550 1:161447664-161447686 CGCGGGCAGCCCCGCCGCGCCGG + Intergenic
916110138 1:161455045-161455067 CGCGGGCAGCCCCGCCGCGCCGG + Intergenic
916111723 1:161462455-161462477 CGCGGGCAGCCCCGCCGCGCCGG + Intergenic
916113310 1:161469836-161469858 CGCGGGCAGCCCCGCCGCGCCGG + Intergenic
922202687 1:223419684-223419706 CATGAGCAGTACAGCTGCGCTGG - Intergenic
923353189 1:233129290-233129312 CGAGGGCAGCACCGGTGGGCTGG - Intronic
923930064 1:238684807-238684829 CGAGCGCAGCACCGGTGGGCTGG + Intergenic
1065802615 10:29366362-29366384 CGAGCGCAGCACCGGTGGGCTGG - Intergenic
1066235452 10:33480645-33480667 CGAGAGCAGCACCGGTGGGCCGG + Intergenic
1069680796 10:70283896-70283918 TGCGGGCAGCAGCGCTGCGCGGG - Intergenic
1069949278 10:72008178-72008200 CGCGAGATGTACCGCTTCGCCGG + Exonic
1069992986 10:72326137-72326159 CGAGAGCAGCGCCGGTGGGCTGG - Intergenic
1076466709 10:130687741-130687763 CATGAGCAGCACCGCTGCACTGG - Intergenic
1077492712 11:2869603-2869625 TGCGCGCAGCACGGCTCCGCTGG - Intergenic
1083782325 11:64924933-64924955 CCCGAGCGGAACCGCTGCGAAGG + Exonic
1084276536 11:68054178-68054200 CCCGAGCAGCCCTGCTGCACAGG - Intronic
1085447232 11:76609206-76609228 CGAGTGCAGCACCGGTGGGCTGG + Intergenic
1085687703 11:78639034-78639056 CGAGCGCAGCACCGGTGGGCCGG - Intergenic
1086043048 11:82501342-82501364 CGAGTGCAGCACCGGTGGGCTGG - Intergenic
1093034509 12:14320277-14320299 CGAGCGCAGCACCGGTGGGCTGG - Intergenic
1101009003 12:100430485-100430507 CGAGAGCAGCGCCGGTGGGCTGG - Intergenic
1103601131 12:122055313-122055335 GGCCAGCAGCACCGCTCCGTCGG - Intronic
1105605144 13:21920842-21920864 CGAGCGCAGCGCCGCTGGGCCGG + Intergenic
1108435356 13:50396778-50396800 CGAGAGCAGCGCCGGTGGGCTGG - Intronic
1108933307 13:55859244-55859266 GGCCAGCAGCACCTCTGCCCAGG + Intergenic
1109159861 13:58958359-58958381 CGAGAGCAGCGCCGATGGGCTGG + Intergenic
1110417496 13:75268632-75268654 CGAGCGCAGCACCGGTGGGCCGG - Intergenic
1113631791 13:111893335-111893357 CGCCAGCAGCGCAACTGCGCAGG - Intergenic
1119318435 14:73714442-73714464 CCCGAGCAGCTCCGCCGCGGGGG - Intergenic
1119418628 14:74493220-74493242 GGCGCTCAGCACCGCTGCCCAGG - Exonic
1123480665 15:20628673-20628695 CGCCGGCAGCACCGCTCCCCAGG - Intergenic
1123637344 15:22371694-22371716 CGCCGGCAGCACCGCTCCCCAGG + Intergenic
1123799152 15:23803097-23803119 CGAGAGCAGCGCCGGTGGGCTGG - Intergenic
1124652352 15:31483400-31483422 CGCTGGCAGCGCCGCTGCACCGG + Exonic
1125885532 15:43226727-43226749 CGAGAGCAGCACCGGTAGGCCGG + Intergenic
1130132876 15:81158806-81158828 CGAGCGCAGCACCGGTGGGCTGG - Intergenic
1132828918 16:1918219-1918241 CACGAGCAGCATCGGCGCGCGGG + Exonic
1135262110 16:20989818-20989840 CGAGCGCAGCACCGGTGGGCTGG + Intronic
1137300239 16:47142945-47142967 CCCGAGCAGCAGCGCTCCCCGGG + Intronic
1141688724 16:85584795-85584817 TGGGAGCAGCACGGCTGAGCAGG + Intergenic
1147723784 17:42554280-42554302 CGCGAGCAGCACCGCTGCGCTGG - Intronic
1148270757 17:46260151-46260173 CGCGGGCAGCAGCGCGGTGCGGG + Intergenic
1149655543 17:58308024-58308046 CGTAAGCAGCACAGCAGCGCAGG + Intronic
1150772295 17:68052056-68052078 CGAGCGCAGCACCGGTGGGCTGG - Intergenic
1150819103 17:68420634-68420656 CGAGAGCAGCTGAGCTGCGCTGG + Exonic
1162632692 19:11941472-11941494 CGAGCGCAGCACCGGTGGGCTGG + Intronic
1166436060 19:42767168-42767190 CGCGTGCACCAGCGCTGCCCTGG + Intronic
1166448922 19:42881156-42881178 CGCGTGCACCAGCGCTGCCCTGG + Intronic
1166453321 19:42919347-42919369 CGCGTGCACCAGCGCTGCCCTGG + Intronic
1166465599 19:43027931-43027953 CGCGTGCACCAGCGCTGCCCTGG + Intronic
1166471741 19:43084135-43084157 CGCGTGCACCAGCGCTGCCCTGG + Intronic
1166482877 19:43187951-43187973 CGCGTGCACCAGCGCTGCCCTGG + Intronic
1166485361 19:43207085-43207107 CGCGTGCACCATCGCTGCCCGGG + Intronic
1166492506 19:43271003-43271025 CGCGTGCACCAGCGCTGCCCTGG + Intergenic
929460889 2:42101478-42101500 CCCGAGCAGCACGGCGGAGCCGG - Intergenic
930641644 2:53859733-53859755 AGCGAGGAGCGCGGCTGCGCTGG - Intronic
930781038 2:55224960-55224982 TGCGAGCAGCACTGCAGCCCAGG + Intronic
932343025 2:70978654-70978676 CGCGGGCAGCACCGCTCGGCGGG + Exonic
932521782 2:72422011-72422033 CGAGCGCAGCACCGGTGGGCTGG - Intronic
934898505 2:98139187-98139209 CGAGAGCAGCTCCGGTGGGCCGG - Intronic
941164866 2:162074054-162074076 CGCGTCCTGCACCGCTGCTCCGG + Exonic
941366926 2:164621255-164621277 CGCGAGCAGGGCGGCTGCCCGGG - Exonic
949065291 2:241986751-241986773 CGCGAGCTGCCCAGCTGCCCGGG + Intergenic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1178351286 21:31874182-31874204 CACGAGCAGAACGGCCGCGCGGG - Intronic
1178983341 21:37283361-37283383 CGAGCGCAGCACCGGTGGGCTGG + Intergenic
1179893679 21:44350215-44350237 CCCGCGCAGCACCGCCGCCCTGG - Intronic
1181478127 22:23180922-23180944 CGCGCGCAGCCCGGCGGCGCAGG + Exonic
1183264501 22:36817082-36817104 GGCGCGCAGCACTGCAGCGCTGG - Intronic
1183507893 22:38219660-38219682 CGCAAACAGCAACGCTGGGCAGG + Exonic
1184101509 22:42343753-42343775 CGCGGGCGGCGCCGCTGCGGTGG + Intergenic
1184226022 22:43129217-43129239 CGCCAGCAGCACCTGTTCGCAGG - Exonic
952156004 3:30644275-30644297 GGCGAGCATCACCGCTCAGCTGG - Intronic
954392476 3:50274891-50274913 CAGGAGCAGCCCCTCTGCGCTGG - Exonic
957556285 3:81767563-81767585 CGAGCGCAGCACCGGTGGGCCGG + Intergenic
963440415 3:145333562-145333584 CGAGCGCAGCTCCGCTGGGCTGG - Intergenic
964117960 3:153155903-153155925 CGAGTGCAGCACCGGTGGGCCGG + Intergenic
964974184 3:162599882-162599904 CGAGCGCAGCACCGGTGGGCCGG - Intergenic
969362548 4:6673953-6673975 CGCGCGCAGGACCGCTGAGGCGG + Intergenic
974484776 4:62492072-62492094 CGAGCGCAGCACCGGTGGGCTGG + Intergenic
974804396 4:66860353-66860375 CGAGTGCAGCACCGGTGGGCTGG - Intergenic
975755881 4:77570848-77570870 CGAGCGCAGCACCGGTGGGCTGG - Intronic
975870650 4:78775985-78776007 CGCGGGCAGCGCGCCTGCGCGGG + Intergenic
978999566 4:115200370-115200392 CGAGAGCAGCACCGGTGGGCTGG + Intergenic
980227993 4:130012965-130012987 CGAGCGCAGCACCGGTGGGCCGG - Intergenic
981573197 4:146175811-146175833 GGTGAGCCGCACCGCTGCGCGGG + Exonic
984662259 4:182386735-182386757 CGAGAGCAGCGCCGGTGGGCTGG - Intronic
985678974 5:1246226-1246248 CCCAAGCAGCAGCGCTGCCCGGG - Intergenic
991567554 5:68020578-68020600 CGAGAGCAGCGCCGGTGGGCTGG + Intergenic
992802979 5:80310160-80310182 CGAGCGCAGCACGGGTGCGCTGG + Intergenic
993770301 5:91917461-91917483 CGAGTGCAGCGCCGCTGGGCCGG - Intergenic
995106251 5:108381042-108381064 TGCAAGCAGCCCCGCTGCGGCGG - Exonic
998266730 5:140672578-140672600 CGCGAGCAGCAGCGCGCTGCGGG + Exonic
999140454 5:149358073-149358095 GGCGAGCAGCGGGGCTGCGCGGG - Exonic
1001143399 5:169163911-169163933 CGCAAGCATCACCTCTGCCCAGG - Intronic
1003862805 6:10337596-10337618 CGAGTGCAGCACCGGTGGGCCGG - Intergenic
1004200279 6:13541726-13541748 CGAGTGCAGCGCCGCTGGGCCGG - Intergenic
1004224407 6:13772674-13772696 CGAGAGCAGCGCCGGTGGGCTGG - Intergenic
1004866040 6:19854602-19854624 CGAGCGCAGCACCGGTGGGCTGG + Intergenic
1004906920 6:20244946-20244968 CGAGAGCAGCGCCGGTGGGCTGG + Intergenic
1005707432 6:28469528-28469550 CGAGCGCAGCACCGGTGAGCTGG + Intergenic
1009431908 6:63573571-63573593 CGCGAGCTGCACCCCTGCCCGGG + Intronic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1016217210 6:141618397-141618419 CGAGCGCAGCACCGGTGGGCCGG - Intergenic
1018068036 6:160137288-160137310 CGGGAGCAGCTCCGCTACCCAGG + Intronic
1019232958 6:170584307-170584329 CGCGAGCAGCCGTGCTGTGCCGG - Exonic
1020001173 7:4756825-4756847 CGGGAGCAGCACCGAGGCACAGG - Intronic
1032248083 7:130230207-130230229 CGAGCGCAGCACCGGTGGGCTGG - Intergenic
1036788531 8:11703330-11703352 GGCTCGCAGCCCCGCTGCGCTGG + Intronic
1036789525 8:11708748-11708770 CGCGAGCAGTACGGGCGCGCCGG + Exonic
1039069101 8:33634008-33634030 CGAGCGCAGCACCGGTGGGCTGG + Intergenic
1042737509 8:72005300-72005322 GGCGAGCAGCACCGAAGCGCGGG + Intronic
1049453907 8:142677363-142677385 GGCCAGCAGCACCCCTGAGCTGG + Intronic
1052075458 9:24135253-24135275 CGAGCGCAGCACCGGTGGGCCGG - Intergenic
1197331173 X:125155653-125155675 CGAGCGCAGCACCGGTGGGCCGG + Intergenic