ID: 1147726034

View in Genome Browser
Species Human (GRCh38)
Location 17:42566748-42566770
Sequence TCCCCACGTTACCCTGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147726034_1147726043 18 Left 1147726034 17:42566748-42566770 CCGCCCTCAGGGTAACGTGGGGA No data
Right 1147726043 17:42566789-42566811 GCGCGTGCACACACTATCTGCGG No data
1147726034_1147726039 -10 Left 1147726034 17:42566748-42566770 CCGCCCTCAGGGTAACGTGGGGA No data
Right 1147726039 17:42566761-42566783 AACGTGGGGAGCCGGCCGGCCGG No data
1147726034_1147726044 21 Left 1147726034 17:42566748-42566770 CCGCCCTCAGGGTAACGTGGGGA No data
Right 1147726044 17:42566792-42566814 CGTGCACACACTATCTGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147726034 Original CRISPR TCCCCACGTTACCCTGAGGG CGG (reversed) Intergenic
No off target data available for this crispr