ID: 1147731059

View in Genome Browser
Species Human (GRCh38)
Location 17:42602518-42602540
Sequence CCACTTAAGAAGCTTTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147731059_1147731062 12 Left 1147731059 17:42602518-42602540 CCCTGGAAAAGCTTCTTAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1147731062 17:42602553-42602575 TACCAAACTACTTGCTAGAAAGG 0: 1
1: 0
2: 0
3: 22
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147731059 Original CRISPR CCACTTAAGAAGCTTTTCCA GGG (reversed) Intronic
904912858 1:33948319-33948341 CCAATTAAGGAGCTTGTCCAGGG - Intronic
905763848 1:40583755-40583777 CCACTTTAGCATCTTTTACAAGG + Intergenic
906907241 1:49909082-49909104 GCAGTTAAGTACCTTTTCCAAGG - Intronic
908429760 1:64044500-64044522 GCACTTAAGAATATCTTCCATGG + Intronic
910492758 1:87790837-87790859 CCATTAAAAAAGCTTTTTCAAGG - Intergenic
910544005 1:88393745-88393767 CTAATTAAGGAGCTTTTGCATGG + Intergenic
912891299 1:113534580-113534602 CCAGTTAAGAAGCATGTACAAGG - Intronic
919062244 1:192648230-192648252 CTACTTAAGCATATTTTCCAAGG - Intronic
919610000 1:199733445-199733467 CCATGTAAGCAGATTTTCCAGGG - Intergenic
922716223 1:227874131-227874153 CCTCTTCAGAAGCTCTTGCAAGG - Intergenic
923441000 1:234020310-234020332 CCTCTTAAGAAGTTCATCCAAGG - Intronic
1063423738 10:5935186-5935208 CCACTCCAGAAGTTTCTCCAGGG - Intronic
1063559032 10:7109270-7109292 CCACTAAAAAAACTTATCCAGGG + Intergenic
1065789098 10:29243409-29243431 CCATTTAAAAAGCCTTTCCCTGG + Intergenic
1069120729 10:64566751-64566773 CCACTCTAGAACCTTTTCCCTGG + Intergenic
1069851678 10:71409434-71409456 CCACATAACAAGTTTTTCCTTGG - Intronic
1072829307 10:98640719-98640741 CCAGTTAAGGTTCTTTTCCAGGG - Intronic
1073873003 10:107887842-107887864 CCACTGAAGAGGCATTTCTATGG - Intergenic
1074227703 10:111503511-111503533 ACACTTTATAATCTTTTCCATGG - Intergenic
1074291065 10:112138329-112138351 TCTCTTAAAAAGCTTTTCCTGGG - Intergenic
1079292168 11:19198187-19198209 GAGCTTAAGTAGCTTTTCCAAGG + Intronic
1079325226 11:19485659-19485681 CCTTTCAAGAATCTTTTCCATGG - Intronic
1079340197 11:19605338-19605360 CCACTTAAGATCCTCTCCCAAGG + Intronic
1080336193 11:31199215-31199237 GTACTCAAGAGGCTTTTCCAGGG - Intronic
1083122343 11:60526894-60526916 TAAGTTAAGAAACTTTTCCAGGG - Intronic
1087282427 11:96226509-96226531 CCTCTAGAGCAGCTTTTCCAGGG - Intronic
1087518058 11:99191508-99191530 GCACTTAAGAAGATTCTCCAGGG - Intronic
1089247278 11:117131285-117131307 CCATTTAATAAGCCTTTTCAGGG - Intergenic
1089433327 11:118439815-118439837 CCACATAAAAAGCTTACCCATGG - Intronic
1091723794 12:2831954-2831976 GAACTTAAGAAGGTGTTCCAAGG - Intronic
1092306099 12:7302725-7302747 ACACTTAAGGATCTTATCCAAGG - Intergenic
1093721005 12:22442109-22442131 CTAATTAAAGAGCTTTTCCATGG + Intergenic
1094407812 12:30137185-30137207 CTACTTAAGAACATTTTCCTGGG + Intergenic
1095156336 12:38860068-38860090 CAAATTAAAAAGCTTTTCCATGG + Intronic
1096365120 12:51022515-51022537 ACACTTAAGTAGCTTTTCTCTGG + Intronic
1098486491 12:71027723-71027745 ATACTTAAGCAGATTTTCCAGGG - Intergenic
1098498304 12:71162603-71162625 CCACTTTGCCAGCTTTTCCAGGG + Intronic
1098525652 12:71483669-71483691 GAACTTAAGTAGCTTTCCCAAGG - Intronic
1098631228 12:72724564-72724586 CCACTGAAGAGGCATTTCTAAGG - Intergenic
1100472434 12:94905466-94905488 CCAATTAAGAATTTTTTCAAAGG - Intronic
1100990746 12:100248923-100248945 AAACTTAAGAAGCTTCTACATGG - Intronic
1102748631 12:115272342-115272364 TCAGTTAAGCATCTTTTCCAGGG + Intergenic
1103435692 12:120923722-120923744 CCACTTAGGAAAGGTTTCCATGG - Intergenic
1106323561 13:28665641-28665663 CCACTTAAGAAACAGTTTCAGGG - Intronic
1109656277 13:65395114-65395136 CCAGTTAACCAGCTTTCCCAGGG - Intergenic
1110614322 13:77524173-77524195 CCTCTTAAGAAGCCTTGTCATGG - Intergenic
1110949769 13:81471199-81471221 CAAGTTAAGAAGCTTCTGCATGG + Intergenic
1112186202 13:97130145-97130167 CCATTTACCAAGCTTCTCCAGGG - Intergenic
1115344728 14:32330164-32330186 CCACTTCAGAGGCTCTCCCAGGG - Intronic
1115957595 14:38798562-38798584 CCACTAAACAAGCTTTGGCATGG - Intergenic
1116888879 14:50248226-50248248 CCTCTTATGAAACTTGTCCAAGG + Intronic
1120011650 14:79422560-79422582 CCACATAAGAAGGTATTCTATGG + Intronic
1120271084 14:82313931-82313953 CCTCTTAAGTAGATTTTCCAGGG + Intergenic
1121902822 14:97709307-97709329 CTGCTTAACAAGCTTTACCAAGG - Intergenic
1125117654 15:36113988-36114010 CCTCTTAAGAAAAATTTCCAGGG + Intergenic
1125170575 15:36762294-36762316 CCCCTCAAGAAGCTTTTCTCAGG - Intronic
1125547845 15:40520620-40520642 CCAATTAAGAAAATTTTCAATGG + Intergenic
1126185446 15:45826929-45826951 CTTCTCAATAAGCTTTTCCAGGG + Intergenic
1127361191 15:58246494-58246516 CCACTTTAGAGTCTTTTCAATGG - Intronic
1127628389 15:60802481-60802503 CCCCTGCAGAAGCTTTGCCAAGG + Intronic
1129969613 15:79766560-79766582 CCACCTAAGACTCTTCTCCAAGG - Intergenic
1134296125 16:12947334-12947356 CCACTTAAGGCTCATTTCCAGGG + Intronic
1134418025 16:14061479-14061501 AGACTTAAGAAGCTTGTTCAAGG + Intergenic
1140311358 16:73851633-73851655 CCTCTAAAGAAGCTTTTTGAAGG - Intergenic
1140322343 16:73965429-73965451 GCACTTAAGTAACTTGTCCATGG + Intergenic
1141644797 16:85361651-85361673 CCACGTACGAGGCATTTCCAGGG - Intergenic
1141813454 16:86392384-86392406 GAAATTAAGAAGCTTTTCCAGGG - Intergenic
1142212552 16:88815369-88815391 CCTCTCAAGAAGCCTTTCCCAGG + Intronic
1147731059 17:42602518-42602540 CCACTTAAGAAGCTTTTCCAGGG - Intronic
1147945714 17:44079044-44079066 CCCCTTAGGAAGCTTTTCCTTGG - Intronic
1152787638 17:82257913-82257935 CCAGTTAAAAAACTTTTCGACGG - Intronic
1156376774 18:36521744-36521766 CCACTAAAGAAGCTGAACCAAGG - Intronic
925451163 2:3970136-3970158 ACATTTAAGAAACTTCTCCAAGG + Intergenic
925891273 2:8436959-8436981 CCCCTCAAGAAGTTATTCCAAGG + Intergenic
928423025 2:31154469-31154491 CCAATTAAGGAGATTGTCCAAGG - Intronic
931220702 2:60285838-60285860 CCACTTCAGAAGCTTTTTATGGG + Intergenic
931330170 2:61272557-61272579 CCAGTTAGGAAGTTTTTCGATGG - Intronic
931860065 2:66345738-66345760 CCACTTAAGCCCCTCTTCCATGG + Intergenic
932273468 2:70432325-70432347 CCTCTCATGAAACTTTTCCATGG - Intergenic
934954600 2:98607238-98607260 CCACTTAAGAGGCATTTACCAGG + Intronic
936628410 2:114173920-114173942 GCAGTTAAGAAACTTGTCCAAGG - Intergenic
938364117 2:130720439-130720461 CGACTAAAGAGGCTTTTCAAAGG + Intergenic
940395394 2:153184352-153184374 CAACTTAAGAAGCTTTTGGGTGG + Intergenic
940543580 2:155053925-155053947 CCACATAAATACCTTTTCCAGGG + Intergenic
940702065 2:157057811-157057833 CAAGTTAAGAAACTTTCCCAGGG + Intergenic
942159697 2:173170801-173170823 TAACTTAAGCAACTTTTCCATGG + Intronic
943682976 2:190787089-190787111 GCAGTTAAGAAGCTTGCCCAAGG + Intergenic
944571132 2:201044537-201044559 TTACTTAAGTAGCTTTCCCAAGG - Intronic
949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG + Intergenic
1168868272 20:1107642-1107664 GAACTTAAGCAACTTTTCCAGGG - Intergenic
1170775638 20:19372618-19372640 ACACATAGGAAGCTTCTCCAAGG - Intronic
1170818865 20:19739293-19739315 CCACTGAAAAAGCATTTCCGTGG + Intergenic
1176943368 21:14950764-14950786 CCTTTTCAGAAGCTTCTCCAAGG - Intergenic
1180009711 21:45041249-45041271 CCACTTTCGAGGCTTCTCCAAGG + Intergenic
1182420383 22:30245935-30245957 CCCCCTTAGACGCTTTTCCAGGG + Intronic
949494693 3:4620473-4620495 CCAGTTACTAAGCCTTTCCAGGG + Intronic
949725934 3:7044654-7044676 CCATTTCAGAATCTTTTCTACGG + Intronic
950818593 3:15733269-15733291 CTACTGAAGAACCTTTTCGAAGG + Intronic
951054354 3:18129874-18129896 CAATTTAAGAAGCTCTTGCAAGG + Intronic
957501379 3:81062130-81062152 CCATTTAAGAAACTTTTCTCTGG + Intergenic
958885124 3:99717618-99717640 CGAATTAAGTAGCTTTTACAAGG + Intronic
958907513 3:99958393-99958415 CCACTGTAGCAGCTTTTTCATGG - Intronic
959519071 3:107305434-107305456 CCTCTTAAGAACATTGTCCATGG - Intergenic
960931492 3:122855300-122855322 CCATTTAAGAAGCTCTGACAGGG + Intronic
963274514 3:143316802-143316824 GCACTTAAGACGTTTTACCAGGG + Intronic
965426270 3:168527635-168527657 CCACTTAATGAGCATTTTCAAGG + Intergenic
966351651 3:179037893-179037915 GCCCTCAAGAAGCTTTTCTAGGG + Intronic
967067480 3:185932431-185932453 TCACTAGAGCAGCTTTTCCAGGG - Intronic
970232866 4:13928666-13928688 CCACTTACGAAGCTTCTGCAAGG - Intergenic
970453386 4:16195266-16195288 CTCCCTAAGAAGCTTATCCAAGG + Intronic
971504371 4:27350070-27350092 CCAGCAAAGAAACTTTTCCAAGG - Intergenic
972910206 4:43806368-43806390 GAAGTTAAGGAGCTTTTCCAAGG - Intergenic
978636848 4:110820006-110820028 CAACTTAAGTAATTTTTCCAAGG + Intergenic
979633011 4:122924286-122924308 CCATTTAAGAAGCTTGGCAATGG - Intronic
980249571 4:130296888-130296910 ACACTTAAGAACCCTTTACAGGG + Intergenic
981017119 4:139985709-139985731 CCTCTGAAGGAGCCTTTCCATGG - Intronic
983614344 4:169685172-169685194 CCACAGAAGAAACTATTCCAAGG - Intronic
983660800 4:170129060-170129082 CCACATAAGCTGCTTTTCCATGG + Intergenic
994106758 5:95958577-95958599 CCCCTTAAAAAGTGTTTCCATGG + Intronic
995777552 5:115740512-115740534 CAAGTTAAAAAGCTTTTGCACGG - Intergenic
995943139 5:117609053-117609075 TAACTTAAGCAACTTTTCCAAGG + Intergenic
999563588 5:152833023-152833045 CCACTAAAAAAGCTATTCAAAGG - Intergenic
1001340914 5:170844647-170844669 CCACAGAAAAAGCTTCTCCATGG - Intergenic
1002343551 5:178532594-178532616 GCATTTAAGAGACTTTTCCAAGG + Intronic
1005784993 6:29235953-29235975 CCACTTCAACAGCTTTTCAAAGG - Intergenic
1006689496 6:35869009-35869031 CCACCCAACAAGCATTTCCAAGG + Exonic
1008070280 6:47092481-47092503 CCACCTAACAAGCTGTTTCAGGG + Intergenic
1008359076 6:50593363-50593385 CAACTTGAGAAACTCTTCCAAGG - Intergenic
1010270184 6:73908928-73908950 CCACATAAGAAGCTGGTCCCTGG - Intergenic
1014070083 6:117171161-117171183 GCAACTAAGAGGCTTTTCCATGG + Intergenic
1016228352 6:141771128-141771150 ATACTTAAGAAGCCTTCCCAAGG - Intergenic
1016344770 6:143101385-143101407 CCATTTTAGAAGAATTTCCAAGG + Intronic
1020984820 7:15120242-15120264 CCACTAAAAATGCTTTCCCAAGG + Intergenic
1020988576 7:15167676-15167698 CCACTTTAGAAGCCTCTCTAAGG + Intergenic
1022826416 7:34018972-34018994 GCACTGAAGAAGATTTTACAAGG - Intronic
1024394070 7:48846199-48846221 CCACCTAAGAAGCTAATCAATGG - Intergenic
1024401167 7:48926215-48926237 CCACCTAAGAAGCTAATCAATGG + Intergenic
1025709644 7:63896063-63896085 GCTCTTAAGAAGCTTTTTAAGGG - Intergenic
1025812787 7:64885739-64885761 CATCTTTAGAAGCTTTTCCGTGG - Intronic
1026138127 7:67681400-67681422 CCAGTTGAGCAGCTTTGCCATGG + Intergenic
1027909532 7:84231615-84231637 CCACATCAGCAGCTTTCCCATGG - Intronic
1028299143 7:89175072-89175094 CAACTTAAAAAGCTTCTGCATGG - Intronic
1030736139 7:113050945-113050967 CAGCTTAAGAAGCTTTTCCTGGG + Intergenic
1030947602 7:115743487-115743509 CCACTGAAGAAATTTTTGCATGG + Intergenic
1031355996 7:120787253-120787275 CCACTTGAGAAGATTGTCAAGGG - Intergenic
1032433113 7:131879134-131879156 ACACTGAAGATGCTTGTCCAGGG - Intergenic
1032503936 7:132421730-132421752 CCAATTAATAATGTTTTCCAGGG + Intronic
1038219870 8:25597177-25597199 CAACTTGAGAAGCATTTCCAGGG - Intergenic
1038713362 8:29969966-29969988 GAGCTTAAGGAGCTTTTCCAAGG - Intergenic
1039575135 8:38617231-38617253 GCACTTAAGATGCTTTTACATGG - Intergenic
1041338873 8:56820654-56820676 CCACTTCACAAGCCTTGCCAAGG + Intergenic
1042713846 8:71749864-71749886 CCACTTAAGAAGCTCTTACTGGG - Intergenic
1042869102 8:73381216-73381238 CCACTTTAAAAGCCTTTCAATGG - Intergenic
1043136750 8:76536794-76536816 GCCCTTAAGAGGCCTTTCCATGG - Intergenic
1045478998 8:102577676-102577698 CCACTTGAAAAGGTTTTCCACGG + Intergenic
1046422944 8:114008340-114008362 CCACTCAAAAAGCTTTTGCGAGG - Intergenic
1046939719 8:119918892-119918914 CCACTTCATAAGGTATTCCATGG - Intronic
1047863346 8:128993347-128993369 CAAATTAAGATGCTTTTTCAAGG - Intergenic
1049087918 8:140492540-140492562 CAACTTCAGAAACTTCTCCAAGG + Intergenic
1050650379 9:7769297-7769319 CTATTTAAAAAGCTTTCCCATGG - Intergenic
1051403757 9:16711416-16711438 CCACTTAAAAAGTTTTTGAAAGG + Intronic
1055318061 9:75053951-75053973 CCCCATGAGCAGCTTTTCCATGG - Intergenic
1056166353 9:83944793-83944815 CTACTGAAGAAGCTTCTCAAAGG - Exonic
1057350134 9:94289487-94289509 CCACTTAAAAAGCTATACAATGG + Intronic
1058137585 9:101323885-101323907 CCCCCTAATATGCTTTTCCAAGG - Intronic
1061528787 9:131193319-131193341 GAACTTAAGAGGCTTTTCTAAGG - Intronic
1185857402 X:3548821-3548843 CCACTTAACAAGGTTTTCCCTGG - Intergenic
1186939650 X:14491562-14491584 TGTCTTAACAAGCTTTTCCAGGG - Intergenic
1187260994 X:17685131-17685153 CCACTAATGGAGCTCTTCCAGGG - Intronic
1187963931 X:24592388-24592410 CTACAAAAGAAGGTTTTCCAAGG - Intronic
1188324207 X:28780041-28780063 ACAATTAATAAGCATTTCCATGG + Intronic
1188435538 X:30154204-30154226 TCAGTTTAGAAACTTTTCCATGG - Intergenic
1189975879 X:46461013-46461035 TCACTTCAGAGGCTATTCCAAGG + Intronic
1189983188 X:46530688-46530710 TCACTTCAGAGGCTATTCCAAGG - Intronic
1191214479 X:57920883-57920905 CCAGTAAAGAAGATTTTCCCAGG - Intergenic
1191902144 X:66052608-66052630 CCATTTTGGAAGCTATTCCAAGG + Intergenic
1192274133 X:69612854-69612876 CCACTTATGAAACATTTCCTGGG - Intergenic
1192888817 X:75366290-75366312 CTAAATAAGAAGGTTTTCCATGG - Intergenic
1194582046 X:95685919-95685941 CCTCTTCAGAAGCCTTTCAAGGG + Intergenic
1195756426 X:108203430-108203452 AAACTTAGGGAGCTTTTCCATGG - Intronic