ID: 1147733447

View in Genome Browser
Species Human (GRCh38)
Location 17:42618607-42618629
Sequence ATCACCCATCACCCCAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147733442_1147733447 -4 Left 1147733442 17:42618588-42618610 CCCCCAAGGCTATTTCCAGATCA No data
Right 1147733447 17:42618607-42618629 ATCACCCATCACCCCAAACCAGG No data
1147733437_1147733447 27 Left 1147733437 17:42618557-42618579 CCTTCGGTGCTAACTTCAGAACC No data
Right 1147733447 17:42618607-42618629 ATCACCCATCACCCCAAACCAGG No data
1147733445_1147733447 -7 Left 1147733445 17:42618591-42618613 CCAAGGCTATTTCCAGATCACCC No data
Right 1147733447 17:42618607-42618629 ATCACCCATCACCCCAAACCAGG No data
1147733441_1147733447 -1 Left 1147733441 17:42618585-42618607 CCTCCCCCAAGGCTATTTCCAGA No data
Right 1147733447 17:42618607-42618629 ATCACCCATCACCCCAAACCAGG No data
1147733443_1147733447 -5 Left 1147733443 17:42618589-42618611 CCCCAAGGCTATTTCCAGATCAC No data
Right 1147733447 17:42618607-42618629 ATCACCCATCACCCCAAACCAGG No data
1147733440_1147733447 0 Left 1147733440 17:42618584-42618606 CCCTCCCCCAAGGCTATTTCCAG No data
Right 1147733447 17:42618607-42618629 ATCACCCATCACCCCAAACCAGG No data
1147733439_1147733447 6 Left 1147733439 17:42618578-42618600 CCAGATCCCTCCCCCAAGGCTAT No data
Right 1147733447 17:42618607-42618629 ATCACCCATCACCCCAAACCAGG No data
1147733444_1147733447 -6 Left 1147733444 17:42618590-42618612 CCCAAGGCTATTTCCAGATCACC No data
Right 1147733447 17:42618607-42618629 ATCACCCATCACCCCAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147733447 Original CRISPR ATCACCCATCACCCCAAACC AGG Intergenic
No off target data available for this crispr