ID: 1147741103

View in Genome Browser
Species Human (GRCh38)
Location 17:42671350-42671372
Sequence CTCCCACACCACGGCGGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147741103_1147741113 20 Left 1147741103 17:42671350-42671372 CCTCCCCCGCCGTGGTGTGGGAG 0: 1
1: 0
2: 1
3: 14
4: 146
Right 1147741113 17:42671393-42671415 ACCAGCCCCCGGACAGTGCACGG 0: 1
1: 0
2: 0
3: 10
4: 150
1147741103_1147741110 -4 Left 1147741103 17:42671350-42671372 CCTCCCCCGCCGTGGTGTGGGAG 0: 1
1: 0
2: 1
3: 14
4: 146
Right 1147741110 17:42671369-42671391 GGAGTCGATGGCCACAGCACAGG 0: 1
1: 0
2: 0
3: 7
4: 95
1147741103_1147741112 9 Left 1147741103 17:42671350-42671372 CCTCCCCCGCCGTGGTGTGGGAG 0: 1
1: 0
2: 1
3: 14
4: 146
Right 1147741112 17:42671382-42671404 ACAGCACAGGCACCAGCCCCCGG 0: 1
1: 0
2: 6
3: 54
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147741103 Original CRISPR CTCCCACACCACGGCGGGGG AGG (reversed) Exonic
901093204 1:6657354-6657376 CTCACACACCTCAGCGGAGGTGG - Intronic
903472788 1:23598903-23598925 CTCCCTGACCACGCTGGGGGAGG + Intronic
904002976 1:27349251-27349273 CTCCCACCCCGCGTCGGAGGTGG + Intronic
905213850 1:36393018-36393040 CTCCCACACCCCAGGGGAGGAGG + Intronic
910277526 1:85464986-85465008 CGCCCGCACCACGGCGTGGGTGG + Exonic
921060224 1:211578893-211578915 CCCCCACACCCAGGCGGCGGCGG + Intergenic
1067742748 10:48908242-48908264 CTCCCACACCACCAGGGGTGGGG + Intronic
1069346043 10:67471072-67471094 CTCCCAAAGCACGGGGGGGTGGG + Intronic
1069873130 10:71545246-71545268 CTCCCAGGCCACGGCAGGGGAGG + Intronic
1070257853 10:74826367-74826389 CTCCGGCACCACCCCGGGGGAGG - Intronic
1071695427 10:87864080-87864102 CTCCAACACGGCGGCGGCGGCGG + Exonic
1075249330 10:120851480-120851502 CGCCCACAACAAGGCGGCGGTGG + Exonic
1075748319 10:124743504-124743526 CTCCCGCACCCCGGGGGTGGCGG + Intronic
1076878708 10:133229927-133229949 CGCACACACCTCGACGGGGGCGG + Intergenic
1077324796 11:1959036-1959058 CTGCCAGTCCTCGGCGGGGGTGG + Intronic
1084165292 11:67372605-67372627 CTCCTTCCCCGCGGCGGGGGCGG + Intronic
1084937139 11:72592867-72592889 CTCCTACAGGACAGCGGGGGCGG + Intronic
1088531862 11:110819299-110819321 CTCCGATACCAGGGCTGGGGTGG + Intergenic
1090765213 11:129870471-129870493 CTCCCCCACCACAGTGGGGAGGG - Intronic
1202807776 11_KI270721v1_random:14213-14235 CTGCCAGTCCTCGGCGGGGGTGG + Intergenic
1091591613 12:1846054-1846076 CTCCCACACCAAGGTGGGAGTGG + Intronic
1091683049 12:2540552-2540574 CTCTCACACCACAGCAGTGGAGG - Intronic
1092502652 12:9064544-9064566 CTCCCACTCCGCGGCGGCGGCGG - Intergenic
1095452742 12:42349998-42350020 CTCCCACCCCCCAGAGGGGGTGG + Intronic
1097178954 12:57160012-57160034 CTCCCACCCCAAGGCCTGGGAGG - Intronic
1100444822 12:94650587-94650609 CCCCCACCCCGCGGCGGCGGCGG - Intergenic
1105415970 13:20211534-20211556 CACCAACACCATGGTGGGGGTGG - Intergenic
1105745675 13:23375354-23375376 CTCCCACATCGCGGCGCGGCAGG + Intronic
1106724399 13:32469579-32469601 CTCCCACAACTCAGTGGGGGTGG - Intronic
1109537653 13:63739588-63739610 CTCCCCCACCACTGCGATGGGGG + Intergenic
1110887259 13:80655166-80655188 CTCCCGCAGCCCGGCGGGGGCGG + Intergenic
1114393140 14:22331697-22331719 CTCCCACCCCACTGCTGGGAGGG - Intergenic
1115709923 14:36039474-36039496 CTCCCACACCAGGCCTTGGGAGG + Intergenic
1115754628 14:36519135-36519157 CTACCACATGACGGCGGCGGGGG - Exonic
1120476280 14:84991947-84991969 CTTCCACTCCACCGTGGGGGCGG - Intergenic
1122930926 14:104932790-104932812 CTTCAGCAGCACGGCGGGGGTGG + Exonic
1124158018 15:27245142-27245164 CTCCCACACCGCAGCAGAGGAGG - Intronic
1124439269 15:29674999-29675021 CGCCCAGGCCCCGGCGGGGGAGG - Intergenic
1127703505 15:61525078-61525100 CTCAGACACCACGGGGTGGGAGG + Intergenic
1129424658 15:75454791-75454813 CGCCCACCCCAAGGCGGCGGCGG - Intronic
1129862368 15:78872725-78872747 CTCCCCCACCCGGGGGGGGGGGG + Intronic
1130908605 15:88256352-88256374 CTCCCACCCGGCGGCGGCGGCGG - Exonic
1132872628 16:2122542-2122564 GTCCCACCCCACGGCGGGGATGG - Intronic
1134410558 16:14000274-14000296 TTCCCAGCCCCCGGCGGGGGAGG + Intergenic
1134551725 16:15141742-15141764 GTCCCACCCCACGGCGGGGATGG - Intergenic
1135130640 16:19851263-19851285 CACCCACAGCACTGAGGGGGAGG + Intronic
1135479832 16:22813718-22813740 CCCCCACACCCACGCGGGGGTGG - Intergenic
1137610647 16:49815002-49815024 CTCCCAAGCCACGTCGGGGAGGG + Intronic
1137831225 16:51545260-51545282 CTCCCCCACCACAGCTGCGGGGG - Intergenic
1138263989 16:55646235-55646257 CTCCCACACCATGTCAGGGATGG - Intergenic
1142216875 16:88834357-88834379 TTCCCAGACCACGCGGGGGGGGG - Intronic
1142216970 16:88834635-88834657 TTCCCAGACCACGCGGGGGGGGG - Intronic
1142836897 17:2593939-2593961 CTCCCATCCACCGGCGGGGGAGG - Exonic
1143269031 17:5662010-5662032 CTCCCACACCCAGGCAGGAGGGG + Intergenic
1147178570 17:38671568-38671590 CTCCCACAACACAGCTGGAGGGG + Intergenic
1147200633 17:38799388-38799410 CACCAGCACCACGGCGGTGGCGG - Exonic
1147741103 17:42671350-42671372 CTCCCACACCACGGCGGGGGAGG - Exonic
1148414963 17:47499287-47499309 CTCCCACACCACGTTTAGGGAGG + Intergenic
1149356564 17:55845605-55845627 CTCCCCCACCCCGCCGTGGGAGG + Intergenic
1151333290 17:73423881-73423903 CTCCCAGACCCCGGCAGAGGCGG - Intronic
1152633879 17:81422687-81422709 CTCCCACACCACATCAGGTGGGG - Intronic
1152729658 17:81963211-81963233 CACCCACACCCCGGCGGGGAAGG + Intergenic
1155053836 18:22169100-22169122 CACCCACACGAGGGAGGGGGAGG - Intergenic
1157597211 18:48871145-48871167 CTCCAACACCATGGCTGAGGGGG - Intergenic
1157614513 18:48978632-48978654 CTCCAACACCATGGCTGAGGGGG + Intergenic
1161036102 19:2085432-2085454 CTGCTACACCTCGGTGGGGGAGG - Intronic
1161048848 19:2151453-2151475 CTCCCAGGCCAGGGCGGCGGCGG + Exonic
1161081554 19:2312979-2313001 CTCCCACCCCACCGCCTGGGAGG + Intronic
1161320230 19:3637677-3637699 CTCCCACCCGACCACGGGGGTGG - Intronic
1162823264 19:13236200-13236222 CACAAACACCAGGGCGGGGGTGG + Intronic
1165326046 19:35115268-35115290 CCCCAACACCACCGTGGGGGCGG - Intergenic
1165359460 19:35326950-35326972 CACCAACACCACATCGGGGGAGG + Intronic
1165828749 19:38720132-38720154 CACCCACCCCAGGGCGGAGGAGG - Intronic
1166544487 19:43625955-43625977 CTCCCTCACCACAGCTTGGGAGG + Exonic
1167485991 19:49763235-49763257 CCCCCACACCATGGCGAGCGTGG - Exonic
1167577138 19:50323175-50323197 CACCCGCACCACGGCAGCGGGGG - Exonic
1167595864 19:50427863-50427885 GCCCCTCACCACGGGGGGGGGGG - Intronic
1168063838 19:53908579-53908601 CGCTGACATCACGGCGGGGGGGG + Intergenic
925981348 2:9179978-9180000 CTCCCACAACAGTGCTGGGGAGG - Intergenic
926406165 2:12555113-12555135 CTCCCACACCACTGCCAGGCAGG - Intergenic
928094121 2:28393566-28393588 CTCCCCCACCGCGGAGGGCGAGG - Exonic
930011415 2:46941026-46941048 CTCCGACTCCGCGGCGGGGGCGG + Intronic
935592776 2:104856381-104856403 CCCCCGCACCACGGCGGCGGCGG + Exonic
941095603 2:161237621-161237643 CTGCCTCGCCTCGGCGGGGGTGG - Intergenic
941384956 2:164841439-164841461 CGCCCAGAGCACGGCGGAGGAGG + Intronic
946401169 2:219469093-219469115 CTCCCACCCCAGGGCTGGGCTGG - Intronic
948884861 2:240877461-240877483 CTCCCGCACCACAGAGGGCGGGG + Intronic
948949042 2:241236966-241236988 CTCCCAGACCTTGGGGGGGGGGG + Intronic
1169910142 20:10641573-10641595 CGCCCACACCAGTGCAGGGGTGG + Exonic
1170392666 20:15892132-15892154 CTCCCAGAGCACAGCAGGGGTGG + Intronic
1172822576 20:37750856-37750878 CACACACACCATGGTGGGGGAGG - Intronic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1175466147 20:59192255-59192277 CTCCCACAACCAGGCGGTGGTGG + Exonic
1180064613 21:45405975-45405997 ACCCGACACCACGGCGGGCGCGG - Intronic
1180069175 21:45427580-45427602 CACCAGCACCACGGCGGGCGGGG + Intronic
1184456296 22:44611637-44611659 CTTCCACACCATGACAGGGGTGG + Intergenic
1184669058 22:46003362-46003384 CTCCCATTCCCAGGCGGGGGAGG - Intergenic
1185052892 22:48563000-48563022 CTCCCACACCAGAGCTGGGCTGG + Intronic
1185315379 22:50176754-50176776 CCCCCACACCACCGTGGTGGGGG + Intronic
950110715 3:10417055-10417077 TTCCCAGACGGCGGCGGGGGGGG + Intronic
950509813 3:13419624-13419646 TTCCCACGCCAGGGCGAGGGCGG + Intronic
950568736 3:13787235-13787257 CTCCCAGACCGTGGCTGGGGTGG + Intergenic
951593924 3:24296730-24296752 CTCCAGCACCAAGGAGGGGGAGG + Intronic
954210383 3:49093830-49093852 ACCCCACACAACGGCGGGCGGGG - Intronic
954377801 3:50204246-50204268 CTCCCAGCCCAGGGCAGGGGAGG + Intergenic
961485603 3:127213593-127213615 CTCCCATAGCCCGGTGGGGGTGG - Intergenic
965835913 3:172852691-172852713 CTCACACTCAACGGCGGGAGGGG + Intergenic
970333004 4:15003712-15003734 CTTCCACACCCGGGCGGCGGCGG + Exonic
972532932 4:39977165-39977187 CTCCCTCACCCCCGCGGGAGGGG + Intronic
973669156 4:53197104-53197126 ATCCCAAAGCATGGCGGGGGAGG + Intronic
975118542 4:70705082-70705104 CTCCGACTGCCCGGCGGGGGAGG - Intronic
983077499 4:163343918-163343940 CTCCTGCACCCCGGCGGTGGCGG - Intronic
983792487 4:171814153-171814175 CTCCCACACTAAGGAGGTGGGGG + Intronic
986150873 5:5129593-5129615 CTTCCACACCAGGGCCTGGGTGG + Intergenic
986503995 5:8430213-8430235 CTCCCACTCCACGGAGCAGGCGG - Intergenic
987310083 5:16673681-16673703 CTCCCACACCACCGCTGGGGAGG - Exonic
988688589 5:33549520-33549542 CTCCCACACCACAGAGCAGGAGG + Intronic
994947762 5:106417439-106417461 CTCCGACTGCCCGGCGGGGGAGG + Intergenic
998821270 5:146059995-146060017 CTCCACCACCACGGCTGAGGGGG - Exonic
999737935 5:154526663-154526685 CTTCCACAACACGGTGGGGCAGG - Intergenic
1002571531 5:180142338-180142360 CTTACACACCACTGCGGGGAGGG + Intronic
1003220507 6:4156935-4156957 CTTCCACACCACGGCGCGGCAGG + Intergenic
1004220606 6:13743313-13743335 CCCTCACACCCCGGCGGGGCCGG - Intergenic
1006152570 6:31997188-31997210 CTCCCACACCACTGAGGAGAGGG + Exonic
1006158876 6:32029925-32029947 CTCCCACACCACTGAGGAGAGGG + Exonic
1007274597 6:40663943-40663965 GTCCCACACCCAGGCAGGGGTGG - Intergenic
1007689212 6:43687833-43687855 CTGCCCCACCACTGCGGCGGCGG - Intergenic
1012937574 6:105384163-105384185 CCCCCAGACCACGGCTGGGCAGG + Intronic
1013415056 6:109917545-109917567 CTGCCCCACCAAGGCAGGGGTGG - Intergenic
1013793439 6:113859542-113859564 CCTCCCCACAACGGCGGGGGTGG + Intronic
1014143017 6:117965614-117965636 TTCCCACCCCACAGCTGGGGTGG + Intronic
1014242390 6:119032462-119032484 CTTCCAGACCAGGGAGGGGGTGG + Intronic
1017010083 6:150057689-150057711 CTCCCACAGCCTGGCGCGGGGGG + Intergenic
1017324585 6:153130975-153130997 CGCCCATGCCCCGGCGGGGGCGG - Intronic
1019342723 7:516167-516189 CTCCCACAGCACAGCTGGGCGGG - Intronic
1021186914 7:17575651-17575673 CTCCCACACCAAGCCAAGGGAGG + Intergenic
1027128275 7:75572797-75572819 CTCCCACTCCATGGAGTGGGTGG + Intronic
1029630564 7:101747784-101747806 GTCCCACAACCCGGTGGGGGAGG - Intergenic
1029832926 7:103280057-103280079 CTCCCGCTCCCGGGCGGGGGAGG + Intergenic
1029977834 7:104850789-104850811 CTCTCAAACCTTGGCGGGGGTGG - Intronic
1032174352 7:129611690-129611712 CTCCCCCTCCTCGGCGGCGGCGG + Intergenic
1034555171 7:151845740-151845762 TTCCCAAAACACTGCGGGGGCGG + Intronic
1034562537 7:151890506-151890528 CTCCCACCTCACTGCGTGGGCGG + Intergenic
1040106704 8:43545878-43545900 CTCCCACCCCACGGTAGGTGGGG - Intergenic
1040106764 8:43546102-43546124 CTCCCACATCAGGGTGGGTGGGG - Intergenic
1044260551 8:90114844-90114866 CTCCCACCCCCCAGCGGGAGGGG + Intergenic
1049582778 8:143420407-143420429 CTCTGCCACCATGGCGGGGGTGG + Intronic
1049705388 8:144039847-144039869 CCTCCAGACCACGGCGAGGGTGG - Intronic
1051449374 9:17178497-17178519 ATCCCACAGCAGGGCGGGGGCGG + Intronic
1052888840 9:33677023-33677045 CTCCAACACGGCGGCGGCGGCGG - Intergenic
1056456486 9:86765940-86765962 CTCCCACTCCAGGCCGGGCGGGG - Intergenic
1058885566 9:109319808-109319830 CACCCACACCAGGGGGGGCGGGG + Intronic
1060892071 9:127195309-127195331 CTCCCAGAACAGGGCAGGGGAGG - Intronic
1061754313 9:132802252-132802274 CTCCCACACCACACCGGGGAAGG - Intronic
1061961248 9:133990438-133990460 TTCCCAAACCACAGCTGGGGAGG + Intronic
1062078104 9:134603098-134603120 CACCAACACCACGGCCAGGGCGG + Intergenic
1062153264 9:135032328-135032350 GTCCCCGACCAGGGCGGGGGAGG - Intergenic
1062341412 9:136095308-136095330 CGGCCGCACCGCGGCGGGGGCGG + Intergenic
1189491585 X:41474788-41474810 CTCCCACCCCACGGGAGGAGAGG - Exonic
1190879605 X:54483246-54483268 CTCCCACACCCGCGCGGTGGGGG + Intronic
1197870431 X:131058431-131058453 CCCACTCACCACGGCGGGGGCGG - Exonic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic