ID: 1147742140

View in Genome Browser
Species Human (GRCh38)
Location 17:42675649-42675671
Sequence GACTCCCGTGTGCTGTGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 161}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147742140_1147742156 28 Left 1147742140 17:42675649-42675671 CCGGGCCACAGCACACGGGAGTC 0: 1
1: 0
2: 3
3: 11
4: 161
Right 1147742156 17:42675700-42675722 GAGGAGACGTCAAGGGATGGAGG 0: 1
1: 0
2: 3
3: 26
4: 282
1147742140_1147742144 -2 Left 1147742140 17:42675649-42675671 CCGGGCCACAGCACACGGGAGTC 0: 1
1: 0
2: 3
3: 11
4: 161
Right 1147742144 17:42675670-42675692 TCTGGCCGCCAGTGTGCAGGAGG 0: 1
1: 0
2: 0
3: 18
4: 163
1147742140_1147742149 5 Left 1147742140 17:42675649-42675671 CCGGGCCACAGCACACGGGAGTC 0: 1
1: 0
2: 3
3: 11
4: 161
Right 1147742149 17:42675677-42675699 GCCAGTGTGCAGGAGGGATGGGG 0: 1
1: 0
2: 2
3: 59
4: 497
1147742140_1147742148 4 Left 1147742140 17:42675649-42675671 CCGGGCCACAGCACACGGGAGTC 0: 1
1: 0
2: 3
3: 11
4: 161
Right 1147742148 17:42675676-42675698 CGCCAGTGTGCAGGAGGGATGGG 0: 1
1: 0
2: 1
3: 14
4: 175
1147742140_1147742143 -5 Left 1147742140 17:42675649-42675671 CCGGGCCACAGCACACGGGAGTC 0: 1
1: 0
2: 3
3: 11
4: 161
Right 1147742143 17:42675667-42675689 GAGTCTGGCCGCCAGTGTGCAGG 0: 1
1: 0
2: 0
3: 17
4: 236
1147742140_1147742154 21 Left 1147742140 17:42675649-42675671 CCGGGCCACAGCACACGGGAGTC 0: 1
1: 0
2: 3
3: 11
4: 161
Right 1147742154 17:42675693-42675715 GATGGGGGAGGAGACGTCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 242
1147742140_1147742152 9 Left 1147742140 17:42675649-42675671 CCGGGCCACAGCACACGGGAGTC 0: 1
1: 0
2: 3
3: 11
4: 161
Right 1147742152 17:42675681-42675703 GTGTGCAGGAGGGATGGGGGAGG 0: 1
1: 1
2: 9
3: 164
4: 1966
1147742140_1147742153 20 Left 1147742140 17:42675649-42675671 CCGGGCCACAGCACACGGGAGTC 0: 1
1: 0
2: 3
3: 11
4: 161
Right 1147742153 17:42675692-42675714 GGATGGGGGAGGAGACGTCAAGG 0: 1
1: 0
2: 0
3: 32
4: 387
1147742140_1147742145 -1 Left 1147742140 17:42675649-42675671 CCGGGCCACAGCACACGGGAGTC 0: 1
1: 0
2: 3
3: 11
4: 161
Right 1147742145 17:42675671-42675693 CTGGCCGCCAGTGTGCAGGAGGG 0: 1
1: 0
2: 2
3: 26
4: 201
1147742140_1147742147 3 Left 1147742140 17:42675649-42675671 CCGGGCCACAGCACACGGGAGTC 0: 1
1: 0
2: 3
3: 11
4: 161
Right 1147742147 17:42675675-42675697 CCGCCAGTGTGCAGGAGGGATGG 0: 1
1: 0
2: 1
3: 21
4: 263
1147742140_1147742151 6 Left 1147742140 17:42675649-42675671 CCGGGCCACAGCACACGGGAGTC 0: 1
1: 0
2: 3
3: 11
4: 161
Right 1147742151 17:42675678-42675700 CCAGTGTGCAGGAGGGATGGGGG 0: 1
1: 0
2: 3
3: 49
4: 469
1147742140_1147742155 25 Left 1147742140 17:42675649-42675671 CCGGGCCACAGCACACGGGAGTC 0: 1
1: 0
2: 3
3: 11
4: 161
Right 1147742155 17:42675697-42675719 GGGGAGGAGACGTCAAGGGATGG 0: 1
1: 0
2: 3
3: 97
4: 1229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147742140 Original CRISPR GACTCCCGTGTGCTGTGGCC CGG (reversed) Intronic
900335442 1:2160813-2160835 GACTCGGGGGTGCTGTGGCCTGG + Intronic
900348424 1:2223051-2223073 CACTCCCTTGCGCTCTGGCCAGG + Intergenic
903176966 1:21587205-21587227 GCCTCCCATGTGCTGTGGTGTGG + Intergenic
903297288 1:22351797-22351819 GAGTCCCCTGTTCTGTGTCCTGG + Intergenic
903681537 1:25100769-25100791 GACTCCCCAGTCCAGTGGCCTGG + Intergenic
905659334 1:39709503-39709525 AACTCCCATGTGCTGTGGGAGGG + Intronic
907051846 1:51334930-51334952 GACTCCCCTGTGCTGGGGCTGGG - Intronic
907487821 1:54789355-54789377 GGCTCCCGTGAGCAGAGGCCTGG + Intronic
910676526 1:89821473-89821495 GGCTCCCGTTTGCTGCCGCCAGG + Intronic
915095123 1:153457226-153457248 AGCTCCCTTGTCCTGTGGCCTGG - Intergenic
915645194 1:157265541-157265563 GACTCCCGTGGGGTATTGCCAGG - Intergenic
917719767 1:177776353-177776375 GAGTGCTGTGTGCTGTGGGCTGG + Intergenic
918305297 1:183240462-183240484 GACTCCCCTTTGCTGGGGCTAGG - Intronic
920013777 1:202888998-202889020 GGCTCCCGGGTGCTGCAGCCAGG - Exonic
1062837086 10:642672-642694 GGCACCCGTGTGCGATGGCCTGG - Intronic
1064393380 10:14960080-14960102 AACTCCCGTCTGCTGTCGCTGGG - Intronic
1065493753 10:26308344-26308366 GTCTCCCACGTGGTGTGGCCGGG + Intergenic
1065784938 10:29204214-29204236 GATTCCCATGTCCTGTGCCCTGG + Intergenic
1067694122 10:48523408-48523430 GCCTCCCGGGGGCTGGGGCCCGG - Intronic
1069081188 10:64089840-64089862 GACTCCCGTATCCCCTGGCCAGG - Intergenic
1071481094 10:86065512-86065534 CACTCCCCTGCCCTGTGGCCAGG + Intronic
1073142042 10:101254544-101254566 GACTACCGTGTGCTGAGCACTGG - Intergenic
1073153567 10:101328629-101328651 GATTCCCATGTGCTGTGGGAGGG + Intergenic
1074944446 10:118267965-118267987 CACTCCAGTGTTTTGTGGCCTGG - Intergenic
1076475020 10:130745719-130745741 GTCTCCTGTGTGCAGTGGGCAGG + Intergenic
1076798645 10:132810734-132810756 GGCTCCCGTGGGCTGGTGCCAGG + Intronic
1076845511 10:133067752-133067774 CACTTCAGGGTGCTGTGGCCTGG + Intergenic
1076888746 10:133274102-133274124 GACACCAGTGTGCTGGAGCCAGG + Intronic
1083155381 11:60819700-60819722 GCCTCCTGTGTGATGAGGCCTGG - Intergenic
1084435221 11:69135549-69135571 GAGTACCGGGTGCTGTGGACGGG - Intergenic
1086453597 11:86940612-86940634 GACTCCCCTGTGCTGAGCGCAGG + Intronic
1088146259 11:106683612-106683634 GAATGCTGTTTGCTGTGGCCAGG + Intronic
1089358387 11:117870511-117870533 GGCTGCCTGGTGCTGTGGCCTGG - Intronic
1090207745 11:124895320-124895342 GACTCCCTTCTGCCCTGGCCAGG - Intronic
1090794733 11:130125011-130125033 AACTCCCGTTTGCTGTGGCTTGG + Intronic
1091391393 12:128491-128513 GAATCCCGTGTTCCATGGCCTGG + Intronic
1101308788 12:103557422-103557444 AAGTCCCGTATGGTGTGGCCTGG - Intergenic
1101437379 12:104675924-104675946 GGGTCACGTGTGCTGTGGTCAGG + Intronic
1102410174 12:112710496-112710518 GAGGCCAGAGTGCTGTGGCCTGG - Intronic
1104622030 12:130321791-130321813 GAGTCCGGTTTGCTGTGGCTGGG + Intergenic
1113149953 13:107252277-107252299 GAGGCCCGTGTGCTGTGGCCGGG - Intronic
1115780764 14:36765575-36765597 GCTTCCAGTATGCTGTGGCCTGG + Intronic
1117257935 14:53999397-53999419 GAGTCCAGTGTGAAGTGGCCGGG - Intergenic
1117330024 14:54703159-54703181 TGCTGCTGTGTGCTGTGGCCTGG + Intronic
1118458475 14:65966491-65966513 GACTCCCGTCTGCTGTGACTTGG + Intronic
1119667989 14:76498613-76498635 GACTCCCGGGTGCAGTGGGGTGG + Intronic
1121635199 14:95449524-95449546 GACACCACTGAGCTGTGGCCTGG + Intronic
1123114838 14:105890011-105890033 GGCTCCTGTGGGCTGTGCCCTGG + Intergenic
1124606801 15:31175616-31175638 GACTCCCGGTTGCTGTGGAGGGG - Intergenic
1128665231 15:69532672-69532694 GACTCATCTGTCCTGTGGCCAGG + Intergenic
1128934151 15:71731221-71731243 GAATCCCTTGTCTTGTGGCCGGG + Intronic
1129233477 15:74209483-74209505 GACTCCCCTTAGCTGTGGTCAGG - Intronic
1130725157 15:86431836-86431858 GACTCCCGGTTGCTGTGACATGG + Intronic
1132665248 16:1078530-1078552 GACTCCAGGATGCTGCGGCCAGG + Intergenic
1133130040 16:3671378-3671400 GACTCCAGTGTGCTGGCTCCAGG - Intronic
1135723407 16:24835885-24835907 AACTCCCATGTGCTGTGGGAGGG - Intergenic
1139019761 16:62733264-62733286 CACTCCAGGGTGCTGTGGTCAGG - Intergenic
1141677182 16:85524032-85524054 GTCTCCCGGGTGGTGGGGCCAGG + Intergenic
1142171001 16:88622761-88622783 GGCTCCTGTGTGCTGAGACCAGG - Intronic
1142584978 17:966757-966779 GACTCCAGTGTGGTCTGTCCAGG - Intronic
1143032616 17:3976369-3976391 GACTCCTGTGTGCAGGGGCTGGG + Intergenic
1143684196 17:8500793-8500815 CCCTGCCGTGTGCTGTGGCCTGG - Intronic
1144741636 17:17586358-17586380 GGCTGCCATGTGCTGTGGTCAGG - Intronic
1145024211 17:19455610-19455632 GTCTCCTTTGTGCAGTGGCCAGG - Intergenic
1145786276 17:27595821-27595843 GTCTCCTCTGTGCTGTGGCTGGG + Intronic
1146470736 17:33122232-33122254 GACTCCAGTCTGCTGTGCCTGGG - Intronic
1147140542 17:38458390-38458412 GACTCCCTTCTGCTGTGGCCTGG + Intronic
1147742140 17:42675649-42675671 GACTCCCGTGTGCTGTGGCCCGG - Intronic
1148664340 17:49362911-49362933 GCCTCGCCTGTCCTGTGGCCAGG + Intergenic
1151509981 17:74552361-74552383 GACTCACCTGCGCTGTGCCCTGG + Intergenic
1151633336 17:75326297-75326319 GAGTCCAGTGGGCTTTGGCCTGG - Intronic
1152427628 17:80226846-80226868 GGCTGCCCAGTGCTGTGGCCTGG + Intronic
1152532153 17:80924944-80924966 GACTCCCATGTGAAGTGGCCTGG - Intronic
1152701983 17:81823847-81823869 GTGTGCCGTGTGCTGGGGCCGGG - Intronic
1153931839 18:9885987-9886009 GGCTCCCCTGTGCTGAGGCTGGG - Exonic
1156503021 18:37571533-37571555 GCATCCTGTGTGATGTGGCCAGG + Intergenic
1160096183 18:75875741-75875763 GAGCCCCGTGTGGTGTGGGCAGG + Intergenic
1160833670 19:1114594-1114616 GAACCCCGTGCCCTGTGGCCAGG + Intronic
1161519691 19:4716922-4716944 GACACCCGTGTCCTGTGGGAAGG + Intronic
1162794877 19:13081840-13081862 GACTCACCTGTCCGGTGGCCTGG - Exonic
1163424227 19:17232321-17232343 GGGCCACGTGTGCTGTGGCCAGG - Exonic
1164257815 19:23544572-23544594 GACTCCTGTGTGCAGGGACCAGG + Intronic
1164282676 19:23782614-23782636 GACTCCTGTGTGCAGGGACCAGG - Intronic
1164293514 19:23888576-23888598 GACTCCTGTGTGCAGGGACCAGG - Intergenic
1164302220 19:23972343-23972365 GACTCCAGTGTCCTCTGCCCAGG + Intergenic
1165169053 19:33878233-33878255 GCCTCCCGTCTGCTGCTGCCTGG + Intergenic
1166359814 19:42248451-42248473 GACTCCTGAGGGCTGTGGGCAGG - Exonic
1167702526 19:51058527-51058549 GACTCCTGTGAGGTGAGGCCGGG - Exonic
1168137500 19:54361123-54361145 GACTTTCGTGTGCCGGGGCCCGG - Exonic
1168439648 19:56353000-56353022 GACTCCAGTGGGCAGGGGCCAGG - Intronic
925898299 2:8489926-8489948 GATTCCCCTGTGCTGTGTCTGGG - Intergenic
926103622 2:10136785-10136807 GACTCCCAGGGGCTATGGCCAGG - Intergenic
928389453 2:30897923-30897945 GACTCCCCTGTGGGGTTGCCTGG - Intergenic
930201270 2:48553975-48553997 GACTTCTGTGTGCTGTGAGCAGG + Intronic
931089351 2:58868959-58868981 GATTCCCATGTGCTGTGGGAGGG + Intergenic
931428184 2:62189888-62189910 GAATCCTGTGTGCTTTGCCCTGG - Intergenic
937022063 2:118666301-118666323 CACTCCCATGTGCTGGGGGCTGG - Intergenic
937974388 2:127573414-127573436 CACTTCCGTGTGCCCTGGCCTGG + Intronic
938098017 2:128475832-128475854 GACTCCTGTGTGCTCTGGCCTGG + Intergenic
940409851 2:153348822-153348844 GACTGCCGTGTGCTGGGGACCGG - Intergenic
948477556 2:238230124-238230146 CACGCCAGTGTGCTCTGGCCTGG - Intronic
948654081 2:239465995-239466017 CACCTCTGTGTGCTGTGGCCAGG + Intergenic
1170901332 20:20466096-20466118 GTCTCCCCAGTGCTGAGGCCTGG - Intronic
1175133842 20:56808545-56808567 GCCTCCCGGGTGCTGTTTCCGGG + Intergenic
1175705701 20:61174922-61174944 CACTCCCATGGGCTGAGGCCAGG + Intergenic
1175750175 20:61490778-61490800 GACAGCCGTGTGCTGTGAGCAGG - Intronic
1175755300 20:61525825-61525847 GTCTCCCAGCTGCTGTGGCCGGG + Intronic
1175886228 20:62292393-62292415 AAATCCCGTGTGCTGTGCCGTGG + Intronic
1176032190 20:63017925-63017947 AAGTTCCGAGTGCTGTGGCCAGG - Intergenic
1176088563 20:63309022-63309044 GACTCCCGCCTGCTGTGCCCTGG + Intronic
1176090122 20:63314956-63314978 GACACACGTGTCCTGGGGCCAGG - Intronic
1176090991 20:63318597-63318619 GACTCCCCTGTGGGGTGTCCTGG + Intronic
1176247429 20:64104160-64104182 GTCCCAGGTGTGCTGTGGCCAGG - Intergenic
1178398646 21:32265110-32265132 GGGTCCCGTGTGGTTTGGCCTGG + Intergenic
1179593739 21:42428451-42428473 GACTCCCCAGGGCTGTGGCCTGG + Intronic
1180917474 22:19499180-19499202 GTCAGCCCTGTGCTGTGGCCAGG + Intronic
1181457864 22:23070052-23070074 GACTCCGCTGCGCTGAGGCCTGG - Intronic
1181863811 22:25839907-25839929 GAAACCCGTGGGCTGTGGCGAGG + Intronic
1183245230 22:36688148-36688170 GTCTCCTGTGTGCTGGGCCCTGG - Intronic
1184915988 22:47569375-47569397 CCCTCCCGTATGCTGTAGCCAGG + Intergenic
1185153652 22:49180388-49180410 GGGTCCTGTGTGCTGTGGCTGGG - Intergenic
951414099 3:22401922-22401944 GACTCCCCTGTTGTGTGGGCAGG - Intergenic
953439539 3:42906143-42906165 GCCTCCCGGATGCTGGGGCCTGG + Intronic
954031977 3:47825958-47825980 GACTCCTGTGTCAAGTGGCCAGG - Intronic
954144172 3:48626138-48626160 GACTCCCTGGAGCTGGGGCCAGG + Intronic
954330561 3:49887791-49887813 GGCTCCTGTGCCCTGTGGCCTGG + Intronic
956772193 3:72536060-72536082 GATTGCTGTGTGCTGGGGCCAGG - Intergenic
957114060 3:76002366-76002388 AACTCCCGTGTGTTGTGGGAGGG + Intronic
963181146 3:142357778-142357800 GCCTCCCAAGTGCTGTGGCTGGG - Intronic
968010571 3:195271319-195271341 GACTCCAGCGTGCTGAGGGCTGG + Intergenic
969268296 4:6080496-6080518 AACTCCCGTGTGTTGTGGGAGGG + Intronic
971033497 4:22667086-22667108 CACTCCGGTGTGATGTGGCTGGG + Intergenic
977454651 4:97243337-97243359 GGCTCCCCTGTACTGTAGCCTGG - Intronic
980157935 4:129129396-129129418 GGCTCCTGTCTTCTGTGGCCCGG - Intergenic
983340355 4:166453636-166453658 AACTCCCATGTGCTGTGGGAGGG + Intergenic
985592673 5:773701-773723 GGCTCCCGTGGGGTTTGGCCAGG - Intergenic
985682932 5:1265857-1265879 CAATCCCCTGTGCTGAGGCCAGG + Intronic
985815426 5:2124790-2124812 GGCTCCTGTGTCCTGTGACCTGG - Intergenic
990981552 5:61606738-61606760 CTCTCCTGTGTGCTCTGGCCTGG - Intergenic
999676381 5:154007370-154007392 TACTCACATGTGGTGTGGCCTGG - Intronic
1002596680 5:180328392-180328414 GACGCACCTGGGCTGTGGCCAGG - Intronic
1005594878 6:27369282-27369304 GACACCAGTGTGCTGTGGAGGGG - Intergenic
1006436323 6:34027746-34027768 GATTTCCCTGTGCTGGGGCCTGG - Intronic
1007409158 6:41651781-41651803 GCCCTCCGTGTGCTGGGGCCAGG - Intronic
1012051139 6:94345208-94345230 GGCTGCTGTGTGCTGTGGCTGGG + Intergenic
1013290817 6:108717401-108717423 GGCTTCGGTGTGCTGAGGCCGGG + Intergenic
1017690390 6:156958118-156958140 GACTGCCGTGTGCAGTGGGATGG - Intronic
1017765171 6:157601068-157601090 GAGCCCCGTGCGCTGCGGCCAGG - Intronic
1019101935 6:169638622-169638644 GAATGCCGTGTGCTGGAGCCAGG - Exonic
1019270427 7:144050-144072 GACGCCTGAGTGCTGTGACCAGG + Intergenic
1019623324 7:2003042-2003064 CTTTCCTGTGTGCTGTGGCCTGG - Intronic
1019738341 7:2661182-2661204 TACTCCTGCATGCTGTGGCCTGG + Intronic
1019907689 7:4077131-4077153 GACTGCCGTGGGCACTGGCCTGG + Exonic
1021609170 7:22441247-22441269 GGCTGCTGTGAGCTGTGGCCAGG - Intronic
1023872800 7:44271899-44271921 GACTTCTGTGTGCTGAGGACTGG + Intronic
1029696665 7:102218067-102218089 CACACCCCTGTGCTGTGGCCAGG + Intronic
1035157846 7:156928778-156928800 GTCTCCGGAGGGCTGTGGCCTGG - Intergenic
1036499589 8:9301018-9301040 AACTCCCATGTGCTGTGGGATGG - Intergenic
1040065438 8:43140787-43140809 GACTTCGGGGTGCTGCGGCCGGG + Intronic
1040095436 8:43437864-43437886 GACTCCAGTGTGATGTATCCAGG - Intergenic
1040850774 8:51898865-51898887 GAGTCCCGCGTGCTAGGGCCGGG - Intronic
1044280503 8:90349942-90349964 CACTCCCGTGGACTGTGGCCTGG + Intergenic
1048143242 8:131816332-131816354 GACTCCACTGTCCTGTGGACTGG + Intergenic
1049157378 8:141075321-141075343 GACTCCAGGCTGCTGCGGCCAGG - Intergenic
1049508716 8:143017421-143017443 GCCTCCAGTAGGCTGTGGCCCGG - Intergenic
1056553927 9:87673723-87673745 GACTCCCATGTGATGTCACCAGG - Intronic
1058056275 9:100452303-100452325 AACTCCCTTGTTCTGTGGACAGG - Intronic
1060934476 9:127507260-127507282 GACTCCGGGGTGCTGGGGCTGGG + Exonic
1061893774 9:133636402-133636424 GCCTCCCGCATGCTGGGGCCGGG - Exonic
1062418379 9:136465882-136465904 GACTCCCGTGTTCAGATGCCAGG + Intronic
1062466876 9:136685509-136685531 GAGGCCCGTGGCCTGTGGCCTGG + Intronic
1062592028 9:137278535-137278557 GAGTCCCGTGGGGTGCGGCCCGG - Intronic
1186073949 X:5855621-5855643 AACTCCTGTGTCCTGTGCCCAGG - Intronic
1186291723 X:8107675-8107697 GGCTCCCTTGTGTTGTAGCCTGG + Intergenic
1191024936 X:55904142-55904164 GACTCTGGTGTCCTGAGGCCTGG + Intergenic
1197167226 X:123391754-123391776 GACTCCCAAGTGCTTTGTCCTGG + Intronic