ID: 1147744497

View in Genome Browser
Species Human (GRCh38)
Location 17:42687015-42687037
Sequence GATCCGGGAATGGCGCCGCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 20}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147744497_1147744505 0 Left 1147744497 17:42687015-42687037 CCGTGCGGCGCCATTCCCGGATC 0: 1
1: 0
2: 1
3: 2
4: 20
Right 1147744505 17:42687038-42687060 ACCTTCGAGGCCAGTGGGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 113
1147744497_1147744508 2 Left 1147744497 17:42687015-42687037 CCGTGCGGCGCCATTCCCGGATC 0: 1
1: 0
2: 1
3: 2
4: 20
Right 1147744508 17:42687040-42687062 CTTCGAGGCCAGTGGGCAGGGGG 0: 1
1: 0
2: 1
3: 22
4: 232
1147744497_1147744513 12 Left 1147744497 17:42687015-42687037 CCGTGCGGCGCCATTCCCGGATC 0: 1
1: 0
2: 1
3: 2
4: 20
Right 1147744513 17:42687050-42687072 AGTGGGCAGGGGGGTCTGGGAGG 0: 1
1: 0
2: 5
3: 92
4: 805
1147744497_1147744511 9 Left 1147744497 17:42687015-42687037 CCGTGCGGCGCCATTCCCGGATC 0: 1
1: 0
2: 1
3: 2
4: 20
Right 1147744511 17:42687047-42687069 GCCAGTGGGCAGGGGGGTCTGGG 0: 1
1: 0
2: 10
3: 39
4: 466
1147744497_1147744504 -1 Left 1147744497 17:42687015-42687037 CCGTGCGGCGCCATTCCCGGATC 0: 1
1: 0
2: 1
3: 2
4: 20
Right 1147744504 17:42687037-42687059 CACCTTCGAGGCCAGTGGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 122
1147744497_1147744514 17 Left 1147744497 17:42687015-42687037 CCGTGCGGCGCCATTCCCGGATC 0: 1
1: 0
2: 1
3: 2
4: 20
Right 1147744514 17:42687055-42687077 GCAGGGGGGTCTGGGAGGACAGG 0: 1
1: 0
2: 3
3: 61
4: 666
1147744497_1147744503 -5 Left 1147744497 17:42687015-42687037 CCGTGCGGCGCCATTCCCGGATC 0: 1
1: 0
2: 1
3: 2
4: 20
Right 1147744503 17:42687033-42687055 GGATCACCTTCGAGGCCAGTGGG 0: 1
1: 0
2: 0
3: 4
4: 50
1147744497_1147744502 -6 Left 1147744497 17:42687015-42687037 CCGTGCGGCGCCATTCCCGGATC 0: 1
1: 0
2: 1
3: 2
4: 20
Right 1147744502 17:42687032-42687054 CGGATCACCTTCGAGGCCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1147744497_1147744510 8 Left 1147744497 17:42687015-42687037 CCGTGCGGCGCCATTCCCGGATC 0: 1
1: 0
2: 1
3: 2
4: 20
Right 1147744510 17:42687046-42687068 GGCCAGTGGGCAGGGGGGTCTGG 0: 1
1: 0
2: 4
3: 70
4: 621
1147744497_1147744509 3 Left 1147744497 17:42687015-42687037 CCGTGCGGCGCCATTCCCGGATC 0: 1
1: 0
2: 1
3: 2
4: 20
Right 1147744509 17:42687041-42687063 TTCGAGGCCAGTGGGCAGGGGGG 0: 1
1: 0
2: 1
3: 22
4: 258
1147744497_1147744507 1 Left 1147744497 17:42687015-42687037 CCGTGCGGCGCCATTCCCGGATC 0: 1
1: 0
2: 1
3: 2
4: 20
Right 1147744507 17:42687039-42687061 CCTTCGAGGCCAGTGGGCAGGGG 0: 1
1: 0
2: 1
3: 46
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147744497 Original CRISPR GATCCGGGAATGGCGCCGCA CGG (reversed) Exonic
900400832 1:2472272-2472294 GCCCCTGGACTGGCGCCGCACGG - Intronic
910163558 1:84299093-84299115 GAGCCGGGAATGGCGTCTCAGGG - Intronic
915909680 1:159906550-159906572 GAGCCGGGCATGGTGGCGCATGG + Intergenic
918462779 1:184793408-184793430 TAGCCGGGAATGGTGCCGCATGG + Exonic
1089873852 11:121701221-121701243 GATCCTCCAATGGCGCCTCACGG + Intergenic
1100615764 12:96230713-96230735 AATCCGGGATTGGCGCCCCCAGG - Intronic
1110207636 13:72935129-72935151 TATCCGGGAATGGTGGCACATGG - Intronic
1131133189 15:89912942-89912964 GATCCGGGAATGGCGCGGCCCGG + Exonic
1135281670 16:21158538-21158560 GATCCGGCAAAGGCGCGCCAAGG - Exonic
1135565610 16:23509241-23509263 AATCCGGGAAAGGGGCTGCACGG - Intronic
1147744497 17:42687015-42687037 GATCCGGGAATGGCGCCGCACGG - Exonic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1154218433 18:12432359-12432381 GTGCCGGGAAGGGCGGCGCAGGG - Intergenic
1165246505 19:34500985-34501007 GACCCGGGGCTGGAGCCGCACGG - Exonic
946219827 2:218217083-218217105 GAAGCGGAAATGGCGCCGCGGGG + Intronic
948711533 2:239828554-239828576 GAACTGTGAATGGCACCGCAGGG + Intergenic
1178671134 21:34592573-34592595 GCTCCGGGAAGGGGGCCTCAGGG - Intronic
1181696249 22:24594196-24594218 GAGCCGGGATTGGGGCTGCAGGG - Intronic
995066907 5:107872827-107872849 GATGAGGGAATGGCGGCACAGGG + Intronic
1018938280 6:168289245-168289267 GATCCTGGAGTTGCGACGCAGGG - Intergenic
1019608287 7:1921182-1921204 GAGCAGGGAAGGGCGCCTCAGGG - Intronic
1024589667 7:50870354-50870376 GGTCCAGGAATGGCCCCCCATGG - Intergenic
1028939646 7:96507000-96507022 GATCAGGGAATGGTGCCAAAAGG + Intronic
1035766739 8:2112472-2112494 GATCAGGGAATAGCGACACAGGG + Intronic