ID: 1147745382

View in Genome Browser
Species Human (GRCh38)
Location 17:42691526-42691548
Sequence GCTCTGGGAGGGCACACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 202}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147745382_1147745387 3 Left 1147745382 17:42691526-42691548 CCTTTTGTGTGCCCTCCCAGAGC 0: 1
1: 0
2: 0
3: 23
4: 202
Right 1147745387 17:42691552-42691574 CTCTCCAGTTTCCAAAATCTAGG 0: 1
1: 0
2: 2
3: 20
4: 218
1147745382_1147745391 20 Left 1147745382 17:42691526-42691548 CCTTTTGTGTGCCCTCCCAGAGC 0: 1
1: 0
2: 0
3: 23
4: 202
Right 1147745391 17:42691569-42691591 TCTAGGCCGCATGTCACTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 52
1147745382_1147745390 17 Left 1147745382 17:42691526-42691548 CCTTTTGTGTGCCCTCCCAGAGC 0: 1
1: 0
2: 0
3: 23
4: 202
Right 1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147745382 Original CRISPR GCTCTGGGAGGGCACACAAA AGG (reversed) Intronic