ID: 1147745383

View in Genome Browser
Species Human (GRCh38)
Location 17:42691537-42691559
Sequence CTGGAGAGTCAGCTCTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 401}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147745383_1147745387 -8 Left 1147745383 17:42691537-42691559 CCCTCCCAGAGCTGACTCTCCAG 0: 1
1: 0
2: 2
3: 39
4: 401
Right 1147745387 17:42691552-42691574 CTCTCCAGTTTCCAAAATCTAGG 0: 1
1: 0
2: 2
3: 20
4: 218
1147745383_1147745391 9 Left 1147745383 17:42691537-42691559 CCCTCCCAGAGCTGACTCTCCAG 0: 1
1: 0
2: 2
3: 39
4: 401
Right 1147745391 17:42691569-42691591 TCTAGGCCGCATGTCACTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 52
1147745383_1147745395 22 Left 1147745383 17:42691537-42691559 CCCTCCCAGAGCTGACTCTCCAG 0: 1
1: 0
2: 2
3: 39
4: 401
Right 1147745395 17:42691582-42691604 TCACTGGTGGTCTCTAGCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 132
1147745383_1147745393 20 Left 1147745383 17:42691537-42691559 CCCTCCCAGAGCTGACTCTCCAG 0: 1
1: 0
2: 2
3: 39
4: 401
Right 1147745393 17:42691580-42691602 TGTCACTGGTGGTCTCTAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 145
1147745383_1147745394 21 Left 1147745383 17:42691537-42691559 CCCTCCCAGAGCTGACTCTCCAG 0: 1
1: 0
2: 2
3: 39
4: 401
Right 1147745394 17:42691581-42691603 GTCACTGGTGGTCTCTAGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 125
1147745383_1147745390 6 Left 1147745383 17:42691537-42691559 CCCTCCCAGAGCTGACTCTCCAG 0: 1
1: 0
2: 2
3: 39
4: 401
Right 1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147745383 Original CRISPR CTGGAGAGTCAGCTCTGGGA GGG (reversed) Intronic