ID: 1147745386

View in Genome Browser
Species Human (GRCh38)
Location 17:42691542-42691564
Sequence GGAAACTGGAGAGTCAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 239}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147745386_1147745395 17 Left 1147745386 17:42691542-42691564 CCAGAGCTGACTCTCCAGTTTCC 0: 1
1: 0
2: 2
3: 19
4: 239
Right 1147745395 17:42691582-42691604 TCACTGGTGGTCTCTAGCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 132
1147745386_1147745390 1 Left 1147745386 17:42691542-42691564 CCAGAGCTGACTCTCCAGTTTCC 0: 1
1: 0
2: 2
3: 19
4: 239
Right 1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 54
1147745386_1147745393 15 Left 1147745386 17:42691542-42691564 CCAGAGCTGACTCTCCAGTTTCC 0: 1
1: 0
2: 2
3: 19
4: 239
Right 1147745393 17:42691580-42691602 TGTCACTGGTGGTCTCTAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 145
1147745386_1147745391 4 Left 1147745386 17:42691542-42691564 CCAGAGCTGACTCTCCAGTTTCC 0: 1
1: 0
2: 2
3: 19
4: 239
Right 1147745391 17:42691569-42691591 TCTAGGCCGCATGTCACTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 52
1147745386_1147745394 16 Left 1147745386 17:42691542-42691564 CCAGAGCTGACTCTCCAGTTTCC 0: 1
1: 0
2: 2
3: 19
4: 239
Right 1147745394 17:42691581-42691603 GTCACTGGTGGTCTCTAGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147745386 Original CRISPR GGAAACTGGAGAGTCAGCTC TGG (reversed) Intronic