ID: 1147745390

View in Genome Browser
Species Human (GRCh38)
Location 17:42691566-42691588
Sequence AAATCTAGGCCGCATGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 54}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147745384_1147745390 5 Left 1147745384 17:42691538-42691560 CCTCCCAGAGCTGACTCTCCAGT 0: 1
1: 0
2: 2
3: 19
4: 280
Right 1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 54
1147745380_1147745390 19 Left 1147745380 17:42691524-42691546 CCCCTTTTGTGTGCCCTCCCAGA 0: 1
1: 0
2: 1
3: 17
4: 213
Right 1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 54
1147745381_1147745390 18 Left 1147745381 17:42691525-42691547 CCCTTTTGTGTGCCCTCCCAGAG 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 54
1147745383_1147745390 6 Left 1147745383 17:42691537-42691559 CCCTCCCAGAGCTGACTCTCCAG 0: 1
1: 0
2: 2
3: 39
4: 401
Right 1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 54
1147745382_1147745390 17 Left 1147745382 17:42691526-42691548 CCTTTTGTGTGCCCTCCCAGAGC 0: 1
1: 0
2: 0
3: 23
4: 202
Right 1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 54
1147745386_1147745390 1 Left 1147745386 17:42691542-42691564 CCAGAGCTGACTCTCCAGTTTCC 0: 1
1: 0
2: 2
3: 19
4: 239
Right 1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 54
1147745385_1147745390 2 Left 1147745385 17:42691541-42691563 CCCAGAGCTGACTCTCCAGTTTC 0: 1
1: 0
2: 1
3: 18
4: 179
Right 1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147745390 Original CRISPR AAATCTAGGCCGCATGTCAC TGG Intronic
901911271 1:12460320-12460342 AAATCCAGGGCGCCTGCCACTGG - Exonic
915038041 1:152945001-152945023 AAATCAAACCCACATGTCACTGG - Intergenic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
1063884946 10:10567842-10567864 AGATCTAGGCAGCATACCACAGG + Intergenic
1065327961 10:24567325-24567347 ATATCCAGGCAGCCTGTCACTGG - Intergenic
1077864733 11:6212612-6212634 AAATCTAGGCAGAATGTTAGAGG - Intronic
1085468590 11:76741441-76741463 AAATCTAGGGCGCAAGGCTCTGG + Intergenic
1093181929 12:15976470-15976492 AAACCTAGCCCCCATGTCACTGG - Intronic
1102486796 12:113263990-113264012 AAATCTGAGCCCCATGTCAGTGG + Intronic
1102896426 12:116601927-116601949 AACTCTAGGCCGCATGGCACAGG - Intergenic
1104093462 12:125535387-125535409 AAATCTCAGCAGCATTTCACAGG - Intronic
1107405963 13:40113673-40113695 AAATCTATGCAGCTTATCACTGG + Intergenic
1107934863 13:45337448-45337470 AAATGTAGGCTGCATGTTAATGG - Intronic
1109340922 13:61057663-61057685 AAATCCAGGTCACAGGTCACAGG - Intergenic
1120503520 14:85325859-85325881 AAACCTAGGCAGCATGTCCCTGG - Intergenic
1122221774 14:100243736-100243758 AAATCGAGGCTGCAAGTCAGCGG + Intronic
1123781164 15:23630419-23630441 AAATCAAGACCGCATGACATTGG - Intergenic
1124454879 15:29832924-29832946 AAAGCTAGGCGGCCTCTCACAGG - Intronic
1127048364 15:55052201-55052223 AAATCTAGAGAGCTTGTCACTGG - Intergenic
1128136025 15:65264130-65264152 AAATCTAGGCAGCATCTCCCTGG + Intronic
1131347953 15:91668622-91668644 AGATCTGGGCCACCTGTCACAGG - Intergenic
1147485344 17:40807221-40807243 AAATCTTGTCAGCATGTCCCTGG - Intergenic
1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG + Intronic
1148259016 17:46163029-46163051 ATATCTAGGCAGCATGTGATGGG - Intronic
1163757558 19:19115463-19115485 AAATCTGGGCTGGATGTCAGAGG - Intergenic
925295184 2:2771821-2771843 AAGACCAGGCAGCATGTCACGGG + Intergenic
928440700 2:31289602-31289624 AAATTCAGGCCACATGTCAAAGG + Intergenic
938873875 2:135511845-135511867 AAATCTATGCAGCATGTCTGGGG + Intronic
941359586 2:164535403-164535425 AAATCCAGGCAGAAGGTCACAGG - Intronic
941663604 2:168220855-168220877 AAATCTAGGCTGCATTGCAGGGG + Intronic
942082392 2:172412966-172412988 AAATCTTGGCAGCTTGGCACAGG + Intergenic
1170285679 20:14705855-14705877 AAATCTAGACTCCATCTCACAGG - Intronic
1171358564 20:24569244-24569266 AAATCCAGGCAGCGTGTGACAGG + Intronic
1173340326 20:42147531-42147553 AAATCTCTGCAGGATGTCACAGG - Intronic
1182426282 22:30274652-30274674 ATATCTAGGTGGCAGGTCACAGG - Intergenic
955270857 3:57497357-57497379 AAATCAAGGCAGCATGGTACTGG + Intronic
956262745 3:67362937-67362959 AAGCCTAGGCCCCATCTCACGGG - Intronic
959726552 3:109549393-109549415 AGATCTGAGCTGCATGTCACAGG + Intergenic
969517638 4:7656498-7656520 CATTCTAGGTCTCATGTCACAGG + Intronic
970416949 4:15867643-15867665 AAATCCAAGCCTCTTGTCACTGG - Intergenic
976969564 4:91089185-91089207 CAATCTAGGCGGTATGTGACAGG + Intronic
979158155 4:117424499-117424521 TAATCAAGGCAGCATGGCACTGG - Intergenic
980187183 4:129476649-129476671 AAATTTAGGCAGCATATCTCTGG + Intergenic
985294569 4:188421944-188421966 AACTCTAGGCCACAGGACACTGG + Intergenic
997792680 5:136775560-136775582 AAATCTAGGCCTCTTCTCATGGG - Intergenic
999654520 5:153799086-153799108 AAAGCTAGGCAGCTTGTCAGGGG - Intronic
1000263932 5:159616809-159616831 ATATCTTAGCCGCATGTCTCTGG + Intergenic
1002956361 6:1869315-1869337 AAATCAAGGGCGTAAGTCACAGG + Intronic
1004000472 6:11592684-11592706 AGGTCTGGGCCGAATGTCACAGG + Intergenic
1008084769 6:47232933-47232955 AAAGATAGGCTGCAAGTCACAGG + Exonic
1016335995 6:143005748-143005770 TAATCTATGCCACCTGTCACAGG - Intergenic
1032259545 7:130323782-130323804 AGATCTAGGCCTCATCTTACAGG + Exonic
1040341591 8:46443798-46443820 AAAACTAGGCCGCATGGCATGGG - Intergenic
1055921884 9:81469555-81469577 AAATCTAGGCGACCTGTCAGGGG + Intergenic
1058394267 9:104532350-104532372 AAATATAGGCCTCATATGACTGG + Intergenic
1058960420 9:109988070-109988092 TAACCTAGGCCACATGTCAAAGG - Intronic
1195411435 X:104570741-104570763 AAATCTAGGCTTCTTGGCACAGG - Intronic
1196475189 X:116076259-116076281 AATTCTATGCAGAATGTCACTGG - Intergenic
1197653853 X:129094606-129094628 AGATCTATGCCACTTGTCACTGG + Intergenic
1198969133 X:142261042-142261064 CAATCTAGGGGGCATGTGACAGG + Intergenic