ID: 1147745390

View in Genome Browser
Species Human (GRCh38)
Location 17:42691566-42691588
Sequence AAATCTAGGCCGCATGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 54}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147745380_1147745390 19 Left 1147745380 17:42691524-42691546 CCCCTTTTGTGTGCCCTCCCAGA 0: 1
1: 0
2: 1
3: 17
4: 213
Right 1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 54
1147745381_1147745390 18 Left 1147745381 17:42691525-42691547 CCCTTTTGTGTGCCCTCCCAGAG 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 54
1147745385_1147745390 2 Left 1147745385 17:42691541-42691563 CCCAGAGCTGACTCTCCAGTTTC 0: 1
1: 0
2: 1
3: 18
4: 179
Right 1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 54
1147745386_1147745390 1 Left 1147745386 17:42691542-42691564 CCAGAGCTGACTCTCCAGTTTCC 0: 1
1: 0
2: 2
3: 19
4: 239
Right 1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 54
1147745384_1147745390 5 Left 1147745384 17:42691538-42691560 CCTCCCAGAGCTGACTCTCCAGT 0: 1
1: 0
2: 2
3: 19
4: 280
Right 1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 54
1147745382_1147745390 17 Left 1147745382 17:42691526-42691548 CCTTTTGTGTGCCCTCCCAGAGC 0: 1
1: 0
2: 0
3: 23
4: 202
Right 1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 54
1147745383_1147745390 6 Left 1147745383 17:42691537-42691559 CCCTCCCAGAGCTGACTCTCCAG 0: 1
1: 0
2: 2
3: 39
4: 401
Right 1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147745390 Original CRISPR AAATCTAGGCCGCATGTCAC TGG Intronic