ID: 1147745393

View in Genome Browser
Species Human (GRCh38)
Location 17:42691580-42691602
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147745384_1147745393 19 Left 1147745384 17:42691538-42691560 CCTCCCAGAGCTGACTCTCCAGT 0: 1
1: 0
2: 2
3: 19
4: 280
Right 1147745393 17:42691580-42691602 TGTCACTGGTGGTCTCTAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 145
1147745389_1147745393 -6 Left 1147745389 17:42691563-42691585 CCAAAATCTAGGCCGCATGTCAC 0: 1
1: 0
2: 1
3: 3
4: 60
Right 1147745393 17:42691580-42691602 TGTCACTGGTGGTCTCTAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 145
1147745385_1147745393 16 Left 1147745385 17:42691541-42691563 CCCAGAGCTGACTCTCCAGTTTC 0: 1
1: 0
2: 1
3: 18
4: 179
Right 1147745393 17:42691580-42691602 TGTCACTGGTGGTCTCTAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 145
1147745386_1147745393 15 Left 1147745386 17:42691542-42691564 CCAGAGCTGACTCTCCAGTTTCC 0: 1
1: 0
2: 2
3: 19
4: 239
Right 1147745393 17:42691580-42691602 TGTCACTGGTGGTCTCTAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 145
1147745388_1147745393 1 Left 1147745388 17:42691556-42691578 CCAGTTTCCAAAATCTAGGCCGC 0: 1
1: 0
2: 1
3: 6
4: 48
Right 1147745393 17:42691580-42691602 TGTCACTGGTGGTCTCTAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 145
1147745383_1147745393 20 Left 1147745383 17:42691537-42691559 CCCTCCCAGAGCTGACTCTCCAG 0: 1
1: 0
2: 2
3: 39
4: 401
Right 1147745393 17:42691580-42691602 TGTCACTGGTGGTCTCTAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type