ID: 1147745443

View in Genome Browser
Species Human (GRCh38)
Location 17:42691783-42691805
Sequence CTAGAAAAGCAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 475}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147745443_1147745450 12 Left 1147745443 17:42691783-42691805 CCTTCCTCCATCTGCTTTTCTAG 0: 1
1: 0
2: 2
3: 40
4: 475
Right 1147745450 17:42691818-42691840 ACACCATTTCCTTCCACACCGGG 0: 1
1: 0
2: 1
3: 51
4: 671
1147745443_1147745449 11 Left 1147745443 17:42691783-42691805 CCTTCCTCCATCTGCTTTTCTAG 0: 1
1: 0
2: 2
3: 40
4: 475
Right 1147745449 17:42691817-42691839 AACACCATTTCCTTCCACACCGG 0: 1
1: 0
2: 1
3: 17
4: 238
1147745443_1147745451 13 Left 1147745443 17:42691783-42691805 CCTTCCTCCATCTGCTTTTCTAG 0: 1
1: 0
2: 2
3: 40
4: 475
Right 1147745451 17:42691819-42691841 CACCATTTCCTTCCACACCGGGG 0: 1
1: 0
2: 0
3: 7
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147745443 Original CRISPR CTAGAAAAGCAGATGGAGGA AGG (reversed) Intronic
900344109 1:2203070-2203092 GGAGAAAAGCAGAAGGGGGATGG - Intronic
901152559 1:7113487-7113509 CTAGGAATGGAGAGGGAGGAAGG + Intronic
903020992 1:20394179-20394201 CTACAAAAGGAGAAAGAGGATGG + Intergenic
903191946 1:21661872-21661894 CCAGAAAATCAGATTGAGAAGGG - Intronic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904295747 1:29518784-29518806 GGAGAAAAGGAGAAGGAGGAAGG - Intergenic
905269707 1:36779528-36779550 CTAGAAGACCAGATGTTGGAGGG - Intergenic
905308977 1:37036665-37036687 CTAGAAACGCGAAGGGAGGAAGG + Intergenic
905512907 1:38536935-38536957 TTAGAAAGCCAGATTGAGGACGG + Intergenic
905680234 1:39865259-39865281 TCAGTAAAGTAGATGGAGGAAGG - Intronic
906484254 1:46222123-46222145 CTGGAAAAGGAGAGGGAGCAAGG + Intergenic
906633973 1:47395965-47395987 AAAAAAAAGCAAATGGAGGAGGG - Intergenic
906650911 1:47511962-47511984 ATAGAAGAGTAGATGGATGAAGG - Intergenic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
907058187 1:51391844-51391866 CAAGAAAAGCAGGTTTAGGAAGG + Intronic
909454748 1:75837682-75837704 TTAGAAAAGAAGATGGCGGCCGG - Intronic
909996860 1:82290491-82290513 GAAGAACAGCAGTTGGAGGAGGG - Intergenic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
912314459 1:108654402-108654424 CTCTAAAGGGAGATGGAGGAGGG + Intronic
912429337 1:109620866-109620888 GTAGAAAAGAAGATGGGGAAGGG - Exonic
912447989 1:109751953-109751975 CTAGAAAAGGAGGTGGTGGTTGG - Intronic
913124611 1:115773385-115773407 TGAGAGAAGGAGATGGAGGATGG + Intergenic
913459183 1:119065347-119065369 CAAGAAAATAAAATGGAGGAGGG + Intronic
913530296 1:119729275-119729297 TTACAAAAGAGGATGGAGGAGGG - Intronic
914196204 1:145449295-145449317 ATAGACCAGCAGATGCAGGAAGG - Intergenic
915191922 1:154158021-154158043 CTAGAAAAGTGGATGGCTGATGG - Intronic
915744035 1:158142417-158142439 CCTGAAAAGCTGATGGATGAGGG - Intergenic
916392140 1:164342412-164342434 CTGGCAAAGCAGTGGGAGGAGGG - Intergenic
916556738 1:165899962-165899984 CTGGAAAAGCAAATGGGGAATGG - Intronic
916779268 1:168007474-168007496 GTTGAAAAGCAGATGGGGGTTGG - Intronic
917906236 1:179589138-179589160 CCAGAAAAGCAGCAGCAGGAGGG + Intergenic
918305858 1:183245557-183245579 AGAGAAAAGAACATGGAGGAAGG + Intergenic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918709206 1:187705718-187705740 CTGGAACAGCAGATGGGTGAGGG - Intergenic
918936434 1:190928270-190928292 TTAGAAAAGCAGAGAGATGATGG - Intergenic
919417486 1:197329439-197329461 GTAGTAAAGCTGATGGAGCATGG + Intronic
919553475 1:199022998-199023020 CTAGAAAGGGAAATGGAAGAGGG - Intergenic
920672808 1:208017309-208017331 GAAGAAAACCAGATGGGGGATGG + Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920819579 1:209367898-209367920 CTAGATGACCAGATGGAGAATGG + Intergenic
921568063 1:216744732-216744754 CTAGAAGAACAGATGGAAGATGG - Intronic
921879846 1:220243572-220243594 CTGAAAAAGTAGATGGAAGATGG - Intronic
923212917 1:231821995-231822017 CTTGAAAAGCAGTTGTAGGCCGG - Intronic
923306828 1:232696268-232696290 GTAGGAAAGCAGATGAAGTAGGG + Intergenic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
923557089 1:235009810-235009832 AGAGAAGAGCAGATGGAGGGTGG + Intergenic
924401122 1:243683514-243683536 CTAGAAAAGAAAATCAAGGAAGG + Intronic
924600665 1:245485972-245485994 TAAGAATAGCAGCTGGAGGACGG - Intronic
1063316183 10:5008648-5008670 GGAGGAAAGCAGATGGAAGATGG + Intronic
1063409817 10:5828662-5828684 ATAGAAACTGAGATGGAGGACGG + Intronic
1066995655 10:42560416-42560438 GTTGGAAAGCAGATGGGGGAGGG - Intergenic
1067098118 10:43315593-43315615 CTACCAAAGCAGATTGAGGGGGG - Intergenic
1067432835 10:46255171-46255193 CAAGGAAAGCAGATGGGGGCAGG + Intergenic
1067778943 10:49184756-49184778 CTAGAAAACCAGCTGCAGGTGGG + Intronic
1069126071 10:64635714-64635736 TTAGAAAAGCTCATGTAGGAGGG + Intergenic
1069562572 10:69441226-69441248 CTATAAAAGAACATGGTGGAAGG - Intergenic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1070418363 10:76211086-76211108 CTAGAAAAGCAGATGAGTAAGGG - Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070610457 10:77928647-77928669 CTAGAAAGCTAGTTGGAGGAAGG + Intergenic
1071119405 10:82260611-82260633 CTAGAGAAGCAGAGTGAGAATGG + Intronic
1071994655 10:91135820-91135842 CTAGAAAAGTACAGAGAGGATGG - Intergenic
1072908221 10:99474978-99475000 CAAGAAAAGGAGAGGGAAGAGGG + Intergenic
1073101266 10:101007933-101007955 GGAGAAAAGGTGATGGAGGAAGG + Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073775308 10:106778776-106778798 CTAGAAAATCAGAGTGGGGAAGG - Intronic
1073984604 10:109193784-109193806 CAAGACAAGCAGATGGATGGTGG - Intergenic
1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG + Intergenic
1074355797 10:112781982-112782004 CTAGGAAAGGAGATGCTGGAAGG - Intronic
1074951081 10:118336936-118336958 CTACATAAGTAGTTGGAGGAAGG + Intronic
1075212138 10:120500417-120500439 ATAGAAAAGCAGGTGGATGAGGG - Intronic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075722740 10:124596986-124597008 GGAACAAAGCAGATGGAGGAAGG + Intronic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1076879422 10:133232495-133232517 CCAGAAAAGCATGTGCAGGAGGG - Intergenic
1077768390 11:5187403-5187425 ATAGAAAAAGAGATGGAGAAAGG + Intergenic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1078932761 11:15925325-15925347 CCAGAAAACAAGATGGAGGAAGG - Intergenic
1081715418 11:45246518-45246540 ACAGAAAAGGAGATGCAGGAGGG + Intronic
1081975891 11:47234565-47234587 CTACAAAACCAGATGCTGGAGGG - Exonic
1082879211 11:58021834-58021856 CTAGAGAAGCAGTGGGAGGCAGG + Intergenic
1083575637 11:63789092-63789114 CTAGAAAAGAAGAAAGAGGCTGG + Intergenic
1083830875 11:65232826-65232848 AAAGAGAAGAAGATGGAGGAAGG - Intergenic
1084342566 11:68515982-68516004 GCAGAACAGGAGATGGAGGACGG - Intronic
1085270148 11:75265370-75265392 AGAGAAAAGCAGAGGGAGGGAGG - Exonic
1086571632 11:88291504-88291526 CAAGAAAAGAAGAGGGAGGGAGG + Intergenic
1086572104 11:88296966-88296988 TTAGAAAAGCACTTGGAAGAAGG + Intronic
1086596103 11:88573006-88573028 CTAGAAATGCAGATGAAACATGG + Intronic
1086987516 11:93266534-93266556 TTAGAACAGCAGAAAGAGGATGG + Intergenic
1087512419 11:99114462-99114484 GAAGAAAAGGAGAAGGAGGAAGG - Intronic
1089166512 11:116481617-116481639 CTATGAAAGCAGATGGCGTAAGG - Intergenic
1089173158 11:116529394-116529416 CCAGAAAAGCAGTAGGAGGCTGG + Intergenic
1089580048 11:119476057-119476079 GTAGATAAGTAGATGGATGATGG + Intergenic
1089590453 11:119537056-119537078 TCAGGACAGCAGATGGAGGATGG + Intergenic
1090268704 11:125370924-125370946 CTAGAACCACAGATGAAGGAAGG + Intronic
1090418838 11:126559428-126559450 GTAGAGAATCAGCTGGAGGAGGG - Intronic
1091071721 11:132571059-132571081 CTAGAAGAGTAGGTGGAAGAAGG + Intronic
1091504162 12:1050078-1050100 CTGGAAAAGCAAATGGATGTGGG + Intronic
1091545528 12:1499184-1499206 CCAGAAAAGCAGGTGAAGGGAGG - Intergenic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1093088353 12:14891985-14892007 ACAAAAAAGCAGATGGTGGAGGG + Intronic
1093636363 12:21474708-21474730 CCATAAAAGCAGATGTTGGAGGG - Intronic
1094812413 12:34151473-34151495 CTAGAAAAGGAGATGGGAGGAGG - Intergenic
1094813058 12:34160867-34160889 CTCTGAAATCAGATGGAGGAAGG + Intergenic
1095323162 12:40854794-40854816 TCAGAAGAGCAGATGGCGGAAGG + Intronic
1095719746 12:45387438-45387460 GGGGAAAAGCAGATGAAGGATGG + Intronic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1096626819 12:52900881-52900903 CTAGAGAAGGAGGTGGAAGAGGG - Intronic
1096842834 12:54389969-54389991 AGAGAAAAAGAGATGGAGGAAGG + Intronic
1097033639 12:56107362-56107384 CTAGAGAAGCAAAAGGAGAAAGG + Intronic
1097203819 12:57303145-57303167 TTAGAAAAGAAGCTAGAGGAAGG + Intronic
1097319053 12:58205305-58205327 CTAGAAGAGCAAATGGATGCTGG - Intergenic
1098064600 12:66600541-66600563 AAAGAAAAGCAGAAGTAGGAGGG - Intronic
1098652422 12:72990106-72990128 CTAGAACAGGAGTAGGAGGAAGG - Intergenic
1098995571 12:77115704-77115726 CTAGAAATGCAGTTGTAAGAGGG - Intergenic
1099536733 12:83855023-83855045 CAAGATAGGCAGATGTAGGAAGG + Intergenic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1100596720 12:96078334-96078356 CTGGAAAATGTGATGGAGGAGGG + Intergenic
1101967508 12:109291529-109291551 CTGGCCAAGCAGATGGAGGGAGG - Intronic
1102042559 12:109810011-109810033 CTACAGAGGCAGATGGCGGAAGG + Intronic
1103428580 12:120861349-120861371 CTAGAAAAACAGAAAAAGGAAGG + Intronic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1106070687 13:26407911-26407933 CTAGAAAAGAAACTGCAGGATGG + Intergenic
1106286706 13:28324335-28324357 CTAGAAAAGCCCAGGAAGGATGG - Intronic
1106545259 13:30725575-30725597 CTAGAAAACCAACTGGTGGAAGG + Intronic
1107171698 13:37350041-37350063 ATATAAAAGCAGATGTAGGCCGG - Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108417424 13:50212404-50212426 TTAGAAAAGCAGAGAGGGGAGGG + Intronic
1110164059 13:72416399-72416421 GTAGATAAGATGATGGAGGAAGG - Intergenic
1110591597 13:77269041-77269063 GGAGAAAAGCAAATGAAGGATGG - Intronic
1111252130 13:85615418-85615440 AAAAAAAAGAAGATGGAGGAAGG - Intergenic
1112661175 13:101510154-101510176 CTAGAGGAGGGGATGGAGGAAGG - Intronic
1114975320 14:28089551-28089573 GTAGAAAATCAGAAGGAGAAAGG + Intergenic
1115550310 14:34499169-34499191 CAAGAAAACCAGTTGGAAGATGG + Intergenic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1115791773 14:36887630-36887652 CCAGAAAGGCAGCTGAAGGAGGG + Intronic
1116789014 14:49319580-49319602 CTAGAAAAGCAGATGGACCTGGG - Intergenic
1117873051 14:60220813-60220835 CTACAAGAGCAGAGTGAGGAGGG - Intergenic
1118131015 14:62963611-62963633 ATAGAAAAAGAGATGGAAGAAGG - Intronic
1118245287 14:64104350-64104372 CAAGAAAAGGAGATGGAGGAGGG - Intronic
1118840037 14:69502979-69503001 CTAGAAGATCAGATGGGGCAGGG + Intronic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1119442096 14:74635372-74635394 CTAGAGAAGCAGATGGGGGTGGG - Intergenic
1121508136 14:94492032-94492054 CCAGCAAAGGAGATTGAGGAGGG + Intronic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1124879511 15:33628299-33628321 CAAGAAAGGAAGAGGGAGGAGGG + Intronic
1125432135 15:39606035-39606057 CTAGATTAGCAGAGGGAGGGTGG - Intronic
1126417393 15:48432058-48432080 CCAGAAAAGGAAATGAAGGAGGG - Intronic
1126888430 15:53177435-53177457 CAAGAACAGCAGATGAAGGCTGG - Intergenic
1127653948 15:61037793-61037815 CTATAATAGAAGATGGAAGAAGG + Intronic
1127814864 15:62599006-62599028 CTGGAATAGCACATTGAGGATGG + Intronic
1128396081 15:67227619-67227641 CAAGAAAAGCAGGCTGAGGAAGG + Intronic
1128483052 15:68055477-68055499 CTACACAAGCAGTTGGGGGAGGG + Intronic
1128635749 15:69301298-69301320 CTGGAAAAGCACATGGGGGCTGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1131940387 15:97558417-97558439 CTAGATTTGAAGATGGAGGAAGG - Intergenic
1132149332 15:99448179-99448201 CTAGAGAAGCAGAGGCAGGGAGG + Intergenic
1132949242 16:2551285-2551307 ACAGAAAACCAGGTGGAGGAAGG - Intronic
1132965346 16:2650843-2650865 ACAGAAAACCAGGTGGAGGAAGG + Intergenic
1133404150 16:5509688-5509710 CCAGGAGAGCTGATGGAGGAGGG + Intergenic
1133929698 16:10222304-10222326 CTAGAATTGCAGATGGAAGAAGG + Intergenic
1134325025 16:13199692-13199714 GTAGAAAAGTTGATGGAAGATGG + Intronic
1135527551 16:23225672-23225694 CCATAAAAGCAGGTGGAGGCAGG + Intergenic
1137002540 16:35242181-35242203 CTAGAAAAGCTGATGGGACAGGG + Intergenic
1137016442 16:35380346-35380368 CTAGAAAAGCTGATGGGACAGGG + Intergenic
1137882263 16:52062381-52062403 CTGGCAATGCAGATGGAAGAAGG - Intronic
1138426684 16:56938787-56938809 CTATAGATTCAGATGGAGGATGG + Intronic
1139719497 16:68841193-68841215 CTAGAACTGCAGATGGGGGCCGG - Intergenic
1139875244 16:70140834-70140856 ATAGAAAAGAAAATGGGGGAGGG + Intronic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1141581569 16:85003076-85003098 CTAGAAAAGCAGAGTAACGAAGG + Intronic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1143476615 17:7206964-7206986 CCAGAAGAGGAGATGGAGGAAGG + Intronic
1143753138 17:9045660-9045682 CCAGAAAAGGAGATGGGGGCAGG + Intronic
1143916196 17:10295180-10295202 CTAGAAGAGCAGAGGGAAGGAGG - Intergenic
1144463421 17:15477438-15477460 CTATTACAGCAGAAGGAGGAAGG - Intronic
1145287470 17:21516992-21517014 CTTGAAAAGCAGGTCGTGGAGGG - Intergenic
1145390159 17:22449397-22449419 CTTGAAAAGCAGGTAGTGGAGGG + Intergenic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148002341 17:44397236-44397258 GGAAAAAAGCAGAGGGAGGAGGG + Intronic
1148011961 17:44489666-44489688 CTAGAAAAACAAAAAGAGGAAGG + Intronic
1148047677 17:44753934-44753956 CTAGAAGAGCAGCAGAAGGAAGG + Intergenic
1148537696 17:48454581-48454603 GTAGAAAAGCAAAAGGATGAAGG + Intergenic
1148561599 17:48609894-48609916 CTAGAGAGGCAGGTGGAGGGAGG - Intronic
1148681201 17:49474556-49474578 CTAGGAAAGAACAAGGAGGAAGG - Intronic
1149190833 17:54059499-54059521 GTAGATAAGTAGATGAAGGAAGG + Intergenic
1149734087 17:58975878-58975900 CTAAAAAGGAATATGGAGGAGGG + Intronic
1150315757 17:64167441-64167463 CTAGAACAGCATCTGGAGCAAGG - Intronic
1150572417 17:66398710-66398732 CGAGAAAGGCAGATGGATGATGG + Intronic
1152322916 17:79618321-79618343 CAAGACAAGGAGATGGAAGACGG - Intergenic
1152878139 17:82800049-82800071 GAAGACAAGGAGATGGAGGAAGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155996692 18:32338102-32338124 CAAAAAATGCAGACGGAGGAAGG + Intronic
1156364899 18:36416716-36416738 CCTGCAAAGCATATGGAGGAAGG - Intronic
1156883008 18:42103136-42103158 CAAGAAGGGCAGATGGAGGCCGG + Intergenic
1157111507 18:44824819-44824841 CTAGGGAAGCAGATGAAGAAAGG + Intronic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157800640 18:50617796-50617818 ATAGAAAATGAGATGGAAGAGGG - Intronic
1159362821 18:67427352-67427374 GTAGGAATGCAGAAGGAGGAAGG - Intergenic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1162880115 19:13652520-13652542 GTAGAACAAAAGATGGAGGAAGG - Intergenic
1162901399 19:13797011-13797033 CTAGAAACCCAGGTGGAGTAGGG + Intronic
1163162120 19:15470938-15470960 CTCGAAAAGAAGAAGGAGGCCGG - Intronic
1163200082 19:15760611-15760633 TCAGACCAGCAGATGGAGGAGGG + Intergenic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167709396 19:51100609-51100631 AAAGAAAAGAAAATGGAGGAAGG + Intronic
1168110151 19:54187719-54187741 AAAGAAAAGCAGATGAAGGCCGG + Intronic
1168431188 19:56282209-56282231 CTAGAAATTCAGCTGGAGAAGGG + Intronic
1168722064 19:58559597-58559619 CTGGAAAAGGGGATGGAGGCGGG + Intergenic
925313960 2:2907205-2907227 CTGGAAGAGGGGATGGAGGAAGG - Intergenic
926159680 2:10478661-10478683 AAAGAAAAGCAAATGAAGGACGG - Intergenic
926969684 2:18454086-18454108 CTAGAAAAGCACGTGCATGAAGG + Intergenic
928309443 2:30197341-30197363 AAAGAAAAGAAAATGGAGGAAGG + Intergenic
928541185 2:32284925-32284947 CTAGAAAAGCAACTGGGGGAGGG + Intronic
928635616 2:33242969-33242991 CTGGAAAAGAAGATTCAGGAAGG - Intronic
928950889 2:36812152-36812174 CGAGAAAAGAAACTGGAGGAGGG + Intronic
929120648 2:38481372-38481394 CAAGAAAAACAGATAGAGGAAGG + Intergenic
929782251 2:44964758-44964780 CCAGAAAGGCAGATGAGGGAAGG - Intergenic
930589336 2:53308746-53308768 CAAGAAAAGGGGATGGAGGTGGG - Intergenic
931255512 2:60568832-60568854 CTAGAAATGCATAATGAGGATGG - Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932965554 2:76470963-76470985 CAAGAAAAGCAGATAAAAGAAGG + Intergenic
933638639 2:84735045-84735067 CTGAAAGAGCAGATGGAGGGAGG - Intronic
933933123 2:87175678-87175700 CTAGAAAAGCAGTAGCAGAATGG - Intergenic
933998168 2:87685169-87685191 ATAGGAAAGCAGAAGGAAGAAGG + Intergenic
934601945 2:95664336-95664358 CTATAAAAGCAGAAGTCGGATGG + Intergenic
934792149 2:97070478-97070500 GTAGGAAAGCAGAAGGAAGAAGG - Intergenic
934814473 2:97313231-97313253 GTAGGAAAGCAGAAGGAAGAAGG + Intergenic
934823220 2:97395252-97395274 GTAGGAAAGCAGAAGGAAGAAGG - Intergenic
935871008 2:107449725-107449747 CTAGTAAAGAAGATAGAGCAGGG - Intergenic
936295684 2:111265704-111265726 ATAGGAAAGCAGAAGGAAGAAGG - Intergenic
936359990 2:111789769-111789791 CTAGAAAAGCAGTAGCAGAATGG + Intronic
937086443 2:119174894-119174916 CTAGAACGGCAGAGGGAGGAGGG + Intergenic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938924022 2:136022917-136022939 CAAGACAAGCAGATGAAGAAAGG - Intergenic
939345622 2:140963658-140963680 CTAGAAAAGCAAAAGCAGGCTGG + Intronic
939355455 2:141095827-141095849 CATGAATATCAGATGGAGGAGGG - Intronic
939395124 2:141619145-141619167 CAAGAAAAGCAGGTTGAGGTGGG - Intronic
939967367 2:148623682-148623704 CAAGAAAAGGAGAAGAAGGATGG - Intergenic
940257817 2:151749831-151749853 GAAGAAAAGCAGATGCAGAAAGG - Intergenic
940363579 2:152821236-152821258 CTACAAATGCAGATGGATGTTGG - Intergenic
940471356 2:154104524-154104546 CTGGAAAAGGAGGTGAAGGAGGG - Intronic
940639401 2:156331587-156331609 CCAGAAAGGCAGATTGTGGAAGG - Intronic
940713340 2:157189265-157189287 GTAGAAAAGCACATTGAGTAAGG + Intergenic
940968191 2:159863740-159863762 CTACACAAGCATATGGAGGCAGG - Intronic
941713644 2:168741407-168741429 CTAGAAAACCAGTTAGAGCAGGG + Intronic
941754613 2:169171639-169171661 CCAGAGAAGTAGAGGGAGGAAGG - Intronic
941918568 2:170828149-170828171 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918704 2:170828733-170828755 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942396175 2:175551989-175552011 CTAGCAAAGCAGATGGGGGAGGG + Intergenic
942770166 2:179507634-179507656 CTAGATAACCAGATATAGGAGGG + Intronic
944396019 2:199267038-199267060 CTGGCAAAGCAGATGGGGAAGGG + Intergenic
944566977 2:201001198-201001220 CTAGATAATCAAATGTAGGAGGG - Intronic
945036630 2:205709092-205709114 CTAAGACAGCAGATGGAGGACGG + Intronic
946095459 2:217270596-217270618 CAAGCAAAGCAGATGGCTGAGGG + Intergenic
946503072 2:220270331-220270353 CTAGAATAGCATTTGGAGCAAGG + Intergenic
947074837 2:226331224-226331246 CAAGAAAAGCTGAAGGAGAAAGG + Intergenic
948096212 2:235336060-235336082 AGAGAAAAGGAGAAGGAGGAGGG - Intergenic
948260470 2:236600677-236600699 ACATAAAAGGAGATGGAGGAAGG + Intergenic
948328590 2:237147244-237147266 CAAGAAAAGCAGAGAGAGAAAGG + Intergenic
948855061 2:240726312-240726334 CATTAAAAGCACATGGAGGATGG + Intronic
949043992 2:241862311-241862333 TGAGAAAAGGAGATGGGGGAGGG - Intergenic
1169218564 20:3807391-3807413 TGAGAAAGGGAGATGGAGGAGGG + Intergenic
1169298699 20:4423187-4423209 CTAAAAAAGGAGTTGGAGGTGGG + Intergenic
1169789297 20:9392684-9392706 CTAGAAAAGAAGATGGCGTATGG + Intronic
1169941492 20:10942600-10942622 ATTGAAGAGCAGAGGGAGGAAGG - Intergenic
1170370597 20:15643938-15643960 CTAGACAAGAGGATGGAGGTGGG + Intronic
1171001983 20:21424080-21424102 GAAGAAAGGAAGATGGAGGAAGG - Intergenic
1172511118 20:35501757-35501779 ATATAGAGGCAGATGGAGGATGG - Intronic
1172829656 20:37822638-37822660 CTAGGAAGGCAGATTTAGGATGG + Intronic
1173226009 20:41162861-41162883 CTAGAGCAGCAGATGGGGGCAGG - Intronic
1174607347 20:51770411-51770433 CTAGCAAAGCAGATGGGAGATGG - Intergenic
1174761435 20:53210554-53210576 GGAGACAAGCAGATGGACGATGG - Intronic
1174799037 20:53547520-53547542 CTTGAAAAGCAGATGAAGCCAGG - Intergenic
1174865316 20:54130230-54130252 TTAGAAATGCAGAGGGAGGATGG + Intergenic
1175172124 20:57088124-57088146 TTACAAGAGCAGATGGCGGATGG - Intergenic
1175474204 20:59258175-59258197 TTAAAAAAAAAGATGGAGGAGGG + Exonic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1177023082 21:15887273-15887295 CTAGGAATGCAGGTAGAGGATGG - Intergenic
1177706015 21:24705710-24705732 CGAGAAAAGCAGATGGATCCTGG - Intergenic
1178701818 21:34840365-34840387 GTAGAAAAGCAGATTTAGAATGG - Intronic
1178726426 21:35056593-35056615 ATAGATAAGGAAATGGAGGAAGG - Intronic
1179044730 21:37833918-37833940 CTAGAAATGCAGGTGGTAGAAGG - Intronic
1179713353 21:43275413-43275435 CAAGCAGAGCAGATGGAGGGAGG - Intergenic
1180299266 22:11023789-11023811 CTAGATAGGCAGATAGTGGAGGG - Intergenic
1180703129 22:17792560-17792582 CCAGAAAGGCAGGTGGAGAAAGG - Intronic
1181688140 22:24543291-24543313 CCAGTAAAGCAGTTGGAGAAAGG + Intronic
1181932742 22:26415763-26415785 CTAGAAATGCAGAAGGTGGGTGG - Intergenic
1182146856 22:28001937-28001959 CTAGAAAATCACAGTGAGGACGG + Intronic
1182160203 22:28114020-28114042 CTGGAAAAGGATATGGAGGCTGG - Intronic
1184238925 22:43201536-43201558 ATAGAAAAGAAGGAGGAGGAAGG + Exonic
1184362197 22:44025197-44025219 GTGGAAAGGCAGATGGAGAAAGG + Intronic
1184875683 22:47274016-47274038 CCAGAAAAGCAAAGGAAGGATGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
949104016 3:181766-181788 CAAGAGAAGAAGATGCAGGAGGG - Intergenic
950109823 3:10411910-10411932 CTGGAAATGCAGATGGTGGGTGG - Intronic
950283318 3:11725246-11725268 GAAGAAAAGGAGAAGGAGGAGGG - Intergenic
950704876 3:14773436-14773458 GTAAGAAAGAAGATGGAGGAGGG + Intergenic
950712330 3:14821226-14821248 CTATAAAAGATGAGGGAGGAGGG - Exonic
950769631 3:15301224-15301246 CTAGGTAAGCAGATGGAGAGTGG - Intronic
950773447 3:15330720-15330742 CTAGAAAAGCAAATGAATGTCGG + Intronic
953077967 3:39588188-39588210 CTGGAAAAGCACATACAGGATGG - Intergenic
953902207 3:46849772-46849794 CTGGAAAAGAGGTTGGAGGAGGG + Intergenic
956551763 3:70468862-70468884 TTAGAAAAGCACATAGAGAAAGG + Intergenic
956835461 3:73092777-73092799 CTCCAAAAGCAGATGGAAGTTGG - Intergenic
956971836 3:74535551-74535573 ATACAAAAGCATATGGAGGGTGG + Intergenic
957502055 3:81069775-81069797 TTATAAAAGCAGATGAAGGATGG - Intergenic
957938074 3:86969341-86969363 CAAGCAAAGCAAATGGAGGGAGG - Intronic
958064725 3:88528778-88528800 CTAGCAAAGCAGTAGGGGGAGGG + Intergenic
958517267 3:95133115-95133137 GTAAAAAAGCAGATGGCTGATGG - Intergenic
959302847 3:104624459-104624481 CTAGAAAAGCAGGCAGAAGAAGG + Intergenic
959463043 3:106650552-106650574 AAAAAAAAGCAGATGGAAGAAGG - Intergenic
959890582 3:111550731-111550753 TCAGAAAAGAAGATTGAGGAAGG + Intronic
960356812 3:116663814-116663836 ATAGAAATGCAGAGGGAAGAAGG + Intronic
960958804 3:123054573-123054595 CAAGAAAAGCAGAGAGGGGATGG + Intergenic
961134972 3:124501890-124501912 ATAGAAAACCAGAAGGAGAAAGG + Intronic
961791864 3:129382086-129382108 CTAGAACCTCAGATGGAGGAAGG + Intergenic
961805887 3:129489045-129489067 CTAGAACCTCAGATGGAGGAAGG + Intronic
962564654 3:136645367-136645389 CTAGAATAGAGCATGGAGGAAGG - Intronic
962694966 3:137939049-137939071 CTAGAATAGAAAGTGGAGGAGGG - Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963774085 3:149420828-149420850 CTAGAAATGAGGATGAAGGATGG + Intergenic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
964066039 3:152580786-152580808 CTAGCCAAGCAGACGTAGGATGG - Intergenic
964388439 3:156173874-156173896 ATAGAACAAAAGATGGAGGAAGG + Intronic
965193321 3:165560073-165560095 CCAGAAAAATAGGTGGAGGAAGG + Intergenic
966104821 3:176323228-176323250 GTAGAATAGCAGATGGAACACGG + Intergenic
966721965 3:183072382-183072404 CTCTAATTGCAGATGGAGGAGGG + Exonic
967418981 3:189252550-189252572 CCAGAAAAGTAGAGGAAGGAGGG + Intronic
967507200 3:190266016-190266038 ATAGAAAAGGGGAAGGAGGAGGG + Intergenic
969297232 4:6277356-6277378 ACAGAAAAGCAGAGGGAGGCAGG - Intronic
969858163 4:10016431-10016453 CATGAAAAGTACATGGAGGAGGG + Intronic
971063867 4:23005025-23005047 CTAGAACAGCACTTGGGGGATGG + Intergenic
971367373 4:25988210-25988232 TGAAAAAAGCAGATGGAGGTTGG + Intergenic
971424489 4:26502720-26502742 CTGGAAACGCAGAGGGATGAAGG - Intergenic
973796762 4:54435026-54435048 CTTGAAAAGGAGAGGGAGTAGGG - Intergenic
975646410 4:76550348-76550370 CTAGAAGAGCAGATAGGGCATGG + Intronic
976143258 4:82015283-82015305 GAAGAAAAGGAGAAGGAGGAGGG + Intronic
976813035 4:89117653-89117675 CTAGCCAAGCAGAAGGAGTAGGG + Intergenic
977599193 4:98917665-98917687 TCAGAAAAGAAGATGGAGGAGGG + Intronic
977932015 4:102759979-102760001 CAGCAAAAGCAGTTGGAGGATGG + Intronic
978174598 4:105714440-105714462 CTAGAAAAGAAAAAAGAGGAAGG + Intronic
978613176 4:110566777-110566799 ATAGAACAGAAGATGGAGGAAGG - Intergenic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
978957989 4:114638520-114638542 CAAGGAAAACAGATGGAGGGAGG - Intronic
979490412 4:121320323-121320345 CTAGCAGATCAGAGGGAGGAAGG + Intergenic
979737705 4:124108014-124108036 TTAGAAAGGCATAAGGAGGAAGG - Intergenic
979806281 4:124975823-124975845 CTAGAGAAGCATCTGGATGAAGG - Intergenic
981866424 4:149425574-149425596 ATAGAAAAAAAGGTGGAGGAAGG - Intergenic
981869242 4:149466917-149466939 TTAGAAAAGAAGCTGGAGGGAGG - Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
986199172 5:5565813-5565835 AAACAAAAGCAGATGGAGTACGG - Intergenic
987304832 5:16627572-16627594 CTAGAACATAAGATGGGGGAGGG + Intergenic
988950668 5:36256341-36256363 AGAGAAAAGCAGATGGAGAAAGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990715431 5:58631270-58631292 TTTGTAAAGCAAATGGAGGATGG - Intronic
991009767 5:61870735-61870757 CTATGATAGCAGATGGAGGCAGG - Intergenic
991297855 5:65100829-65100851 CTTCAAAAGGAGATGGAGGTGGG - Intergenic
991631283 5:68658579-68658601 TTTGAAAAGAAGTTGGAGGAGGG - Intergenic
993629815 5:90272298-90272320 ATAGACTAACAGATGGAGGAAGG + Intergenic
993919595 5:93784279-93784301 CTAGAAAGGGAGTTTGAGGATGG + Intronic
994840169 5:104913780-104913802 AAAGAAAAGAAAATGGAGGAGGG + Intergenic
995369269 5:111400619-111400641 CCAGAAAAGCAGAAGGAGCAAGG - Intronic
995553702 5:113305540-113305562 CTGGAAGAGAAGATGAAGGAAGG - Intronic
996616703 5:125450626-125450648 ATTGAAGAGCAGAGGGAGGAAGG + Intergenic
997260741 5:132463996-132464018 CTCCAACACCAGATGGAGGAGGG + Exonic
997801453 5:136866586-136866608 CTAGACAAGCAGATAGATGCTGG - Intergenic
997812357 5:136984064-136984086 CTAGAAAATCCTATGGAGGAGGG + Intronic
998779351 5:145639340-145639362 CTTGAAAACCAGAGGGAGAAGGG + Intronic
998880197 5:146637723-146637745 CTAGAACAGCAGCTGGGGGAAGG - Intronic
999201121 5:149816982-149817004 CTAGAAAGGCTGGTGGAGGCTGG - Intronic
1000046210 5:157523986-157524008 CAGGAACAGCAGTTGGAGGAAGG - Intronic
1000133214 5:158319905-158319927 ATAGAAAATCACAGGGAGGAGGG - Intergenic
1001021644 5:168187936-168187958 CTAGAAATGCAGACACAGGAGGG - Intronic
1001642233 5:173252604-173252626 CTAGAAAAGCAGAAGAGAGAGGG + Intergenic
1001906192 5:175475644-175475666 TGGGAAAAGCAGATGGATGAAGG - Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1005801700 6:29432058-29432080 CTAGAAAAGGGGATGGAGGGTGG - Intronic
1007118628 6:39362297-39362319 CTAGAACAGCAGGAGGAGGAGGG - Intronic
1007643130 6:43358929-43358951 CTAGAAAAGCAGAACCAGCAGGG + Intronic
1008271437 6:49494949-49494971 CTAGTGGAGCAGATGGAGCAGGG + Intergenic
1008360510 6:50612126-50612148 TTAGAAAAACAGATGGTGGAGGG + Intergenic
1008935378 6:56986690-56986712 CAAGAAAAGAAGGTGGAGGAGGG - Intronic
1010379989 6:75213357-75213379 CTTGAGAAGCAGATAGAGGGAGG - Intergenic
1010927000 6:81755035-81755057 GAAGAAAAGGAAATGGAGGAAGG + Intergenic
1011079571 6:83474612-83474634 CTAGCAGAGCAGATGAAGTAAGG + Intergenic
1011366743 6:86590646-86590668 CTATAACAGCAGGTGAAGGAAGG + Intergenic
1011425029 6:87218602-87218624 CATGAAAAGCTGATGGAGAATGG + Exonic
1012375749 6:98559857-98559879 TTAGAAAGGAAGAGGGAGGAAGG - Intergenic
1012420681 6:99061591-99061613 TTTAAAAACCAGATGGAGGAAGG - Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1014288698 6:119533590-119533612 GTAAGAAAGCAGATGAAGGAGGG + Intergenic
1015195276 6:130518718-130518740 CTAGAAAATCATTTGGAGGATGG + Intergenic
1015507381 6:134003255-134003277 CTAGAAAAGCAGAGAGAGACAGG - Intronic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1015902434 6:138082018-138082040 CTAGAAAAGCACATGGGGTCAGG + Intergenic
1016225125 6:141725390-141725412 AAAGAAAAGGAGATGGTGGAAGG - Intergenic
1016700976 6:147053861-147053883 TTAGAAGAGTAGATGGAGCATGG - Intergenic
1016906454 6:149155237-149155259 AAAGAAAAGTAGATGGAGGGGGG + Intergenic
1017296887 6:152807937-152807959 CTGGAAATGAAAATGGAGGAAGG - Intergenic
1017641315 6:156496936-156496958 CTAGAAAAAAAACTGGAGGAGGG + Intergenic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1018051891 6:160016389-160016411 CCAGCAAGGCAGATTGAGGAAGG - Intronic
1018504206 6:164446172-164446194 ATCAAAAAGCAGAGGGAGGATGG + Intergenic
1019057279 6:169232583-169232605 TCAGAAAAGCAGCAGGAGGAAGG - Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019364298 7:623922-623944 CTAGGGAAGGAGGTGGAGGATGG + Intronic
1019534270 7:1520375-1520397 CTGGAACAGAAGGTGGAGGAAGG + Intergenic
1019945372 7:4324541-4324563 GAAGAAAAGGAGAAGGAGGATGG - Intergenic
1020967469 7:14889506-14889528 CTTGAAAAGGAGATGGGAGATGG + Intronic
1021239885 7:18187372-18187394 CTAGAAAAGAAGATAGAATAGGG - Intronic
1021658497 7:22895276-22895298 CTAGAGAAGCAGATGGGGTTGGG - Intergenic
1021818474 7:24473246-24473268 CTAGATGAGGAGATGGAGGAAGG + Intergenic
1022094229 7:27129217-27129239 CTAGAAGATTATATGGAGGAGGG + Exonic
1022151126 7:27607708-27607730 TTAGATAAGCAGCTGGAGGAAGG - Intronic
1022309005 7:29177621-29177643 ATAGATAAACAGATGGAAGAAGG - Intronic
1022399659 7:30025120-30025142 TTAGAAAATCAGGTGGAGGATGG + Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022837228 7:34129899-34129921 CTAGATCAGCAGTTGGAGGAAGG - Intronic
1024020341 7:45362640-45362662 CTAGAGAAGCAGATGCTGCAAGG + Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024199916 7:47096212-47096234 AAAGAAAAGCAGATGCTGGAGGG + Intergenic
1024852136 7:53731108-53731130 GTAGAAAATCAGATGGATGTGGG + Intergenic
1026742250 7:72986186-72986208 CAGGAAAGGCAGATGGGGGAGGG - Intergenic
1026802098 7:73406606-73406628 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027028374 7:74870925-74870947 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027101485 7:75378892-75378914 CAGGAAAGGCAGATGGGGGAGGG + Intergenic
1027595741 7:80171841-80171863 GAAGAAAAGCTGAGGGAGGAAGG - Intronic
1027795651 7:82690691-82690713 CTAGAGAAAAAGGTGGAGGAAGG - Intergenic
1030552979 7:110987986-110988008 TTAGAAAAACAAATGGAGAAAGG + Intronic
1030632635 7:111912617-111912639 GAAGGAAAGAAGATGGAGGAGGG + Intronic
1031985029 7:128158637-128158659 CCAGAGGAGGAGATGGAGGATGG - Intergenic
1032087661 7:128892274-128892296 CTAGAAGAGGAAATGGAGCATGG + Intronic
1032581349 7:133106101-133106123 CAAGAAAAGCAGATGCGGAAGGG - Intergenic
1032595444 7:133234972-133234994 GTAGAAAAGGAGATGCACGAAGG - Intergenic
1033454894 7:141493777-141493799 CTAGAAGACCAGGTGAAGGAAGG - Intergenic
1033639495 7:143247611-143247633 AGAGAAAAGAAGAAGGAGGAAGG + Intronic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1033821627 7:145141361-145141383 CCAAAAAAGGAGATGGAGGTGGG - Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1036298628 8:7555535-7555557 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1036299933 8:7563185-7563207 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1036406024 8:8455900-8455922 CTAGAAAAGCAGAGCAAGAAAGG - Intergenic
1036409563 8:8486679-8486701 CAAGAAAAGAAGAAGGACGATGG - Intergenic
1037775825 8:21835003-21835025 ATGGAAAAGCACATCGAGGATGG - Intergenic
1038495152 8:27996244-27996266 CTAGAACAGCAGCTCCAGGAAGG + Intergenic
1038612287 8:29068263-29068285 CAAGAAAAGAAGATAGAAGACGG + Exonic
1039306804 8:36272182-36272204 AAAAGAAAGCAGATGGAGGAGGG - Intergenic
1039436608 8:37563856-37563878 CCACAAAAGCAGAAGGAAGAAGG + Intergenic
1039869470 8:41533399-41533421 CTTGAAAGGCAGCTAGAGGATGG + Intronic
1039913922 8:41845770-41845792 GGAGAAAAACAGATGGAGAAGGG - Intronic
1040788582 8:51197247-51197269 CTTGAAAATCTGGTGGAGGAAGG + Intergenic
1041173923 8:55173533-55173555 CCAGAAAAGGTGTTGGAGGAAGG - Intronic
1041457571 8:58076833-58076855 CTAGAAAGGAAGCTAGAGGAAGG - Intronic
1041841552 8:62278154-62278176 CTAGAAAAGCTGCTGCAGGATGG + Intronic
1041870595 8:62630297-62630319 CTATAAAAACATATGTAGGATGG + Intronic
1042413293 8:68490044-68490066 CTAGAAAAGCAGAACAAGGCCGG - Intronic
1042985931 8:74582882-74582904 TTACAAAAACAGATGGAGGTGGG + Intergenic
1045006234 8:97919108-97919130 CTAGAAAAGAAGATAGTGGCAGG - Intronic
1045117157 8:98995205-98995227 CTGGGAAAGCATATGGAAGAAGG - Intergenic
1046476104 8:114745897-114745919 ATAGAAAAACAGAGGAAGGAAGG + Intergenic
1046944016 8:119957885-119957907 CTAGAAAAGAAAATAGAGGCCGG - Intronic
1048378713 8:133845373-133845395 CTAGAACAGTTAATGGAGGAGGG - Intergenic
1048433382 8:134391470-134391492 ATAGGGAAGTAGATGGAGGAAGG - Intergenic
1048452361 8:134544647-134544669 CTAGAAGAAAAGGTGGAGGAGGG + Intronic
1048764882 8:137833076-137833098 CTAGAATAGCAGAGTCAGGAAGG + Intergenic
1048820078 8:138372358-138372380 CTAGAGAAGAGGATGGAGGGAGG + Intronic
1049815519 8:144597375-144597397 CTAGAAGAGCACGTGGAGGGAGG + Intronic
1050377842 9:4991693-4991715 CTAGAAAAGGAGATGTGGGGTGG - Intronic
1050533686 9:6612435-6612457 AAAGAAAAGTAGATGGAGGCTGG + Intronic
1052275693 9:26673723-26673745 CTTGAAAAGCAACTGGAGAAGGG - Intergenic
1052799943 9:32957634-32957656 GAAGAAAAACAGCTGGAGGAGGG + Intergenic
1052916260 9:33926314-33926336 AGAGAAAACAAGATGGAGGAGGG + Intronic
1053218930 9:36295262-36295284 AAAGAAAAGCAGCTGGAGGCTGG + Intronic
1054932814 9:70653754-70653776 TTAGTAAAGCAGATGGTGAAGGG - Intronic
1055882070 9:81013696-81013718 GTAGAATAGCAGATGGAACACGG - Intergenic
1056534182 9:87513566-87513588 CTAGACCAGCAGCTGGAGGTAGG + Intronic
1056562332 9:87742355-87742377 CAAGAAAAGCAGCTGCAGCAAGG + Intergenic
1057081296 9:92176462-92176484 TGACAGAAGCAGATGGAGGAGGG - Intergenic
1057249488 9:93488754-93488776 ATATCAAAGCAGATGCAGGAAGG - Intronic
1057440143 9:95077191-95077213 CTAGGAAAGCAGATGCTGGCAGG - Intronic
1057479290 9:95431991-95432013 CTAGAAATTCAGAGGCAGGAAGG - Intergenic
1057777974 9:98026255-98026277 CTAGGACAGGAAATGGAGGAGGG + Intergenic
1057810528 9:98253705-98253727 CCAGAAAGGCATCTGGAGGAGGG - Intronic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1059409783 9:114124713-114124735 CTAGAAAAGAAGACTGAGGCTGG + Intergenic
1060338667 9:122752463-122752485 CTAGAAAAGCTGATGGTTGTGGG - Intergenic
1062698528 9:137887540-137887562 ATAGACCAGCAGATGCAGGAAGG + Intronic
1188488523 X:30710332-30710354 CTAGGTTAGCAGATGAAGGAAGG - Intronic
1189207503 X:39254437-39254459 CTAGAAAAGGAGGAGGAGGATGG + Intergenic
1189225459 X:39409666-39409688 CTTGAAAAGCAGGTAGAGGTCGG + Intergenic
1190824462 X:54004300-54004322 AGAGAAAAGCAGATGGGGGTGGG + Intronic
1191012740 X:55777752-55777774 CTAGAAAAGCAACTGGAGTGTGG + Intergenic
1192161721 X:68793357-68793379 CTAGAAATGCATATGTAGGCAGG + Intergenic
1192370999 X:70512882-70512904 CTAGAATAAGAGGTGGAGGAAGG - Intergenic
1192582713 X:72298422-72298444 CTAGAGAAGGAGAGGGAGTAAGG - Intronic
1193249552 X:79272985-79273007 CTGGAAAAGAAGATGTAGGGTGG - Intergenic
1194511433 X:94800848-94800870 CTAGTAAAGCAGATACAGAAAGG - Intergenic
1197037972 X:121900143-121900165 CAAGAAAAGTAGATAGATGATGG + Intergenic
1197622544 X:128766593-128766615 CAAGAAAAACAGAGGGAGAAAGG - Intergenic
1197683557 X:129413358-129413380 CTAGACAACAAGATGGAAGAAGG + Intergenic
1198011838 X:132564330-132564352 CTAAACAAGCATATGGAAGACGG - Intergenic
1198313616 X:135444745-135444767 CTAGAAAAGCAAATGGATTCTGG + Intergenic
1198333263 X:135641973-135641995 CATGAAGAGCAGATGGAGAATGG - Intergenic
1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG + Intergenic
1199604237 X:149563825-149563847 CTATAATAGCAGGTGGAGGGGGG + Intergenic
1200107334 X:153722349-153722371 CTGGAAAAGCAAATGAAAGAGGG - Intronic
1201724492 Y:17137864-17137886 GTAGAATAGCAGATGGAACATGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic