ID: 1147745979

View in Genome Browser
Species Human (GRCh38)
Location 17:42694861-42694883
Sequence TACTGGTGGGAGGAGTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 462}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147745962_1147745979 22 Left 1147745962 17:42694816-42694838 CCTCCCTAAGGCTGGCCTATAGG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 1147745979 17:42694861-42694883 TACTGGTGGGAGGAGTGTGGGGG 0: 1
1: 0
2: 0
3: 44
4: 462
1147745966_1147745979 18 Left 1147745966 17:42694820-42694842 CCTAAGGCTGGCCTATAGGGAGG 0: 1
1: 0
2: 3
3: 15
4: 123
Right 1147745979 17:42694861-42694883 TACTGGTGGGAGGAGTGTGGGGG 0: 1
1: 0
2: 0
3: 44
4: 462
1147745965_1147745979 19 Left 1147745965 17:42694819-42694841 CCCTAAGGCTGGCCTATAGGGAG 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1147745979 17:42694861-42694883 TACTGGTGGGAGGAGTGTGGGGG 0: 1
1: 0
2: 0
3: 44
4: 462
1147745968_1147745979 7 Left 1147745968 17:42694831-42694853 CCTATAGGGAGGATATATGAGCA 0: 1
1: 0
2: 1
3: 1
4: 96
Right 1147745979 17:42694861-42694883 TACTGGTGGGAGGAGTGTGGGGG 0: 1
1: 0
2: 0
3: 44
4: 462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147745979 Original CRISPR TACTGGTGGGAGGAGTGTGG GGG Intronic
900166720 1:1246913-1246935 TACTGGGCGGCGGAGTGAGGAGG - Intergenic
900297539 1:1959551-1959573 TACAGGAGGGAGGGGTGTGGTGG - Intronic
900330919 1:2133996-2134018 CCCAGGTGGGTGGAGTGTGGAGG + Intronic
900542994 1:3213352-3213374 TGCTGGGGAGAGGGGTGTGGGGG + Intronic
902145336 1:14394120-14394142 TACTGCTGGCATGTGTGTGGGGG - Intergenic
902509656 1:16959309-16959331 TAATGGTAGGAAGGGTGTGGTGG - Intronic
902641968 1:17772630-17772652 TAGTGGTGGGAAGAGGTTGGGGG + Intronic
903570988 1:24304788-24304810 TACTGTTGTGGGGGGTGTGGAGG + Intergenic
903750670 1:25618350-25618372 AGTTGGTGGGAGGAGTTTGGGGG - Intronic
904117813 1:28175423-28175445 TAGGGGTGGGAGGTGTGTTGGGG - Intronic
904755812 1:32767978-32768000 CACTGGAGGGAGGAGAGGGGAGG - Intronic
905169558 1:36101272-36101294 TACTGGGTGGAGGTGTGGGGAGG - Intronic
905356168 1:37386416-37386438 TACTGGTGGCAGGACTAGGGAGG - Intergenic
905377137 1:37530298-37530320 TACTTGTAGGCTGAGTGTGGTGG - Intergenic
907324206 1:53626305-53626327 GACCGGAGGGAGGGGTGTGGTGG - Intronic
907470730 1:54671795-54671817 TACAGGTGAGGTGAGTGTGGGGG + Intronic
907554618 1:55333625-55333647 GACTGGTGGCAGGGTTGTGGGGG + Intergenic
908411784 1:63873377-63873399 AACGGGTTGGAGGAGTGGGGTGG - Intronic
909577765 1:77194631-77194653 TATTTGTGGGTGGAGGGTGGGGG + Intronic
909743847 1:79067905-79067927 TACTGTTGGGAGAAGAGTGGAGG - Intergenic
909945945 1:81663074-81663096 CAGTGGTGGGAGGAGTGTTAGGG - Intronic
911711695 1:101080994-101081016 TGCTGGTGAGCGAAGTGTGGAGG + Intergenic
913247101 1:116879491-116879513 TCCTGGTGGACTGAGTGTGGCGG + Intergenic
916033586 1:160901055-160901077 TACTGGAGGGTGGAGGGTGGAGG + Intergenic
917751529 1:178057899-178057921 TGCTGGGGGGAGGCATGTGGGGG - Intergenic
917854647 1:179090613-179090635 TCCTGGTGGCAGGAGAGAGGAGG + Intronic
918395627 1:184110860-184110882 CAGTGGTGTGGGGAGTGTGGTGG - Intergenic
918395638 1:184110915-184110937 TATATGTGGGAGGTGTGTGGGGG - Intergenic
919913868 1:202128410-202128432 TGCTGCTGTGAGGAGTGCGGCGG + Exonic
920349025 1:205325391-205325413 TCCTGGTGGGAGCAGGGTGCAGG + Intergenic
920682150 1:208081448-208081470 TGAGGGTAGGAGGAGTGTGGGGG + Intronic
921999635 1:221462999-221463021 AACTGGGGGGAGGAAGGTGGTGG - Intergenic
922539014 1:226404966-226404988 TTTTGGTGGGAGGAGGATGGCGG - Intronic
922619784 1:226982567-226982589 TCCTGGTGGGGAGGGTGTGGTGG + Intronic
922753106 1:228080220-228080242 GACTGGAGGGAGGGGTTTGGGGG - Intergenic
922938152 1:229436711-229436733 TACGGGTGTGTGGAGTGTTGAGG - Intergenic
923080099 1:230645317-230645339 TACTGGTAGTAGGAGAGAGGTGG + Intronic
924437114 1:244051139-244051161 AGCTGGTGGCAGGAGTGTAGAGG + Intronic
924582198 1:245332238-245332260 CAGTGGTTGGAGGAGTGTGTAGG + Intronic
1063677128 10:8150742-8150764 TCCTGGGGGGCGGAGGGTGGGGG + Intergenic
1064178009 10:13092005-13092027 TGATGGTGGGAGGAGAGGGGAGG + Intronic
1065169770 10:23014798-23014820 TACTGGAGGGTGGAGGGTGGAGG + Intronic
1067296311 10:44976989-44977011 AACTGGTGGTAGGGGTGTGAGGG - Exonic
1067562845 10:47315880-47315902 TTCTGGAGGGAGCAGGGTGGTGG + Intergenic
1067831349 10:49612734-49612756 TACTGGTGGGGGGTGCGTGGAGG + Intronic
1069178144 10:65320856-65320878 ATCTGGTGGGAGGAGTGAAGGGG - Intergenic
1070964513 10:80521384-80521406 TACTGGTAGGGGGTGGGTGGTGG + Exonic
1071304542 10:84286836-84286858 TAGGGGTGGGAGGAAGGTGGGGG + Intergenic
1071915801 10:90294422-90294444 AACTGTTGGGAGGAATGTTGAGG + Intergenic
1073485652 10:103817303-103817325 TACTTGAGGGTGGAGGGTGGAGG - Intronic
1073744933 10:106457243-106457265 CAATGGGGGGAGGATTGTGGGGG - Intergenic
1073906939 10:108292817-108292839 TTATGGTGGGAGGAGGGAGGGGG - Intergenic
1075398033 10:122141806-122141828 TCTTGGTGGGATGTGTGTGGTGG + Intronic
1075541666 10:123318844-123318866 TAATGGTGGCAGCAGTGAGGGGG + Intergenic
1075828732 10:125384739-125384761 TGCTGGTTGGAGGAGTGGTGGGG + Intergenic
1076558848 10:131347914-131347936 TGCTGGTGGGAGGACTGGGTAGG - Intergenic
1076582350 10:131520225-131520247 CACTGGTGGGAGGTGTTTGGAGG + Intergenic
1077535722 11:3123032-3123054 TACTGGTGGGGGGTGTGCAGTGG + Intronic
1078104421 11:8349801-8349823 GTGGGGTGGGAGGAGTGTGGTGG - Intergenic
1078679825 11:13464979-13465001 ATATGGTGGGAGGAGTGGGGCGG - Intergenic
1080083629 11:28252267-28252289 TGTTGGTGGGAGGAGTGGGGAGG + Intronic
1081691236 11:45080104-45080126 TGCTGGTGGGGGGAGGGTGAGGG - Intergenic
1081706997 11:45188116-45188138 TACTGAGGGAGGGAGTGTGGAGG - Intronic
1083164202 11:60873572-60873594 AGCAGGTGGGGGGAGTGTGGGGG - Intronic
1084195688 11:67522775-67522797 AGCTGGTGAGAGGAGTGGGGAGG - Intronic
1084307977 11:68299074-68299096 AGCTGGTTGGTGGAGTGTGGAGG - Intergenic
1085186187 11:74578042-74578064 TAAGGATGTGAGGAGTGTGGGGG - Intronic
1085393780 11:76195957-76195979 TTCTGGTGGGGGGAGTCTGGGGG - Intronic
1086173440 11:83861727-83861749 TAGTGGTGGGAGGTAGGTGGGGG + Intronic
1086526400 11:87732235-87732257 TACTTGAGGGTGGAGGGTGGGGG - Intergenic
1086800019 11:91161907-91161929 GTCTGGTGGGGGGAGTGGGGAGG - Intergenic
1086812509 11:91328378-91328400 GAATGGTGGGAAGAGTGTGGTGG + Intergenic
1086872619 11:92056928-92056950 TTCTGGTGGGGGGAGGGTGCGGG - Intergenic
1087144525 11:94798881-94798903 TACTGGTCAGAGCAGTGGGGAGG + Intronic
1087173518 11:95074887-95074909 TACTGGTGGGAGGACTCAAGTGG - Intergenic
1087883037 11:103441349-103441371 TATTGGAGGGGGGAGTGCGGGGG - Intronic
1088507787 11:110542782-110542804 TACTGGTGGCAGTGGGGTGGTGG - Intergenic
1088741960 11:112774570-112774592 TATTAGGGAGAGGAGTGTGGGGG + Intergenic
1088902301 11:114127473-114127495 TACTGGGGTGGGGAGTGTGAGGG - Intronic
1089628200 11:119765077-119765099 TACTGGTGAGAGGGGCGTGGTGG - Intergenic
1089935131 11:122356873-122356895 TCCTGGTGGGGGGAGGGGGGAGG - Intergenic
1090046495 11:123339745-123339767 TACTAGAGGGAGGAGGGAGGAGG + Intergenic
1090577233 11:128118521-128118543 TATTGGAGGGTGGAGGGTGGAGG + Intergenic
1091230276 11:133983845-133983867 TTCTGGCGGGAGGAGAGGGGTGG + Intergenic
1091399943 12:175529-175551 GACAGGTGGGAGGAGTGAGGAGG + Exonic
1091525989 12:1301655-1301677 TATTGGAGGGTGGAGAGTGGAGG + Intronic
1091561176 12:1614778-1614800 TAATGATGGATGGAGTGTGGAGG - Intronic
1091639587 12:2225570-2225592 TCCTAGTGGGCGGAGTGGGGAGG + Intronic
1094086287 12:26595931-26595953 TACTGTTGGGAGGGGATTGGAGG - Intronic
1095520192 12:43054727-43054749 TAGGGGTGGGAGGAGGGTGTGGG - Intergenic
1095977493 12:47949698-47949720 GACGGGTGGGAGGAGAGTGGTGG - Intergenic
1096647870 12:53048058-53048080 TACAGGCGGGAGGAGGGTGAGGG + Intronic
1096705586 12:53419812-53419834 TAAAGGTGGAAGGAGTGAGGAGG - Intergenic
1100386747 12:94110908-94110930 TACAGGTGGGAAGAGGGAGGTGG - Intergenic
1101625906 12:106441031-106441053 TTCTGGAGGGTGGAGTCTGGTGG - Intronic
1101835377 12:108291453-108291475 TCCTGGTGTGAGCAGTGAGGGGG - Exonic
1102071523 12:110023852-110023874 TAACTGTGGGAGGAGGGTGGAGG + Intronic
1102144497 12:110644724-110644746 TGCTGGTGGGCTGGGTGTGGTGG + Intronic
1103250975 12:119499846-119499868 TACTGGGTGGAGGAGGGAGGTGG - Intronic
1103532388 12:121611504-121611526 TGGTGGTGGGAGGAGCCTGGTGG + Intergenic
1104647129 12:130505542-130505564 TAGTGGTGGGGGGAGTGGAGGGG - Intronic
1104893926 12:132152784-132152806 TTGTGGTGGGAGGTGTATGGTGG + Intergenic
1106003688 13:25749280-25749302 TTCTGATGGGAAGAGAGTGGAGG + Intronic
1107133914 13:36923823-36923845 TTGAGGTGGGAGGAGTGTGGAGG - Intergenic
1107307925 13:39042847-39042869 TTTTGGTGGGAGGAGAGGGGAGG + Intronic
1107389656 13:39950890-39950912 TACTGGAAGGTGGAGTGTGGGGG + Intergenic
1108718969 13:53110541-53110563 GACTGGTGGCAGGAGGCTGGGGG + Intergenic
1109142025 13:58725306-58725328 AGCTGGTGGCAGGAGTGTGGAGG + Intergenic
1109251497 13:60026158-60026180 TTCTGGTGGGAGCAGTGTGTGGG - Intronic
1109387693 13:61654082-61654104 TAGTGGTGGGAGAAGAGAGGTGG + Intergenic
1109848178 13:68024686-68024708 TCCTGGTGGCAGGTGTTTGGGGG + Intergenic
1110021681 13:70481193-70481215 TACTTGAGGGTGGAGGGTGGAGG - Intergenic
1110182845 13:72637754-72637776 AACTGGTGGGAGGTGGGTGATGG + Intergenic
1110549611 13:76797850-76797872 TACTGGGGACAGGTGTGTGGGGG - Intergenic
1111068306 13:83127834-83127856 TACTGATGGGATGATGGTGGGGG - Intergenic
1111494741 13:89033551-89033573 CACAGGTTGGAAGAGTGTGGAGG + Intergenic
1113581524 13:111433439-111433461 GACTGGAGGGAGGAGGGTTGTGG - Intergenic
1113857061 13:113452852-113452874 TGCTGGTGGGAGTAGGGTGAGGG - Intronic
1114009079 14:18348200-18348222 TACTGCTGTGAGGAGTGAGTGGG + Intergenic
1114330332 14:21630514-21630536 TACTTGAGGGTGGAGAGTGGAGG - Intergenic
1114493011 14:23114865-23114887 GACTGGCAGGAGGAGAGTGGTGG - Intergenic
1115615913 14:35094673-35094695 TAATGCTGGGCCGAGTGTGGTGG + Intronic
1116536382 14:46036208-46036230 TACTTGAGGGTGGAGCGTGGCGG + Intergenic
1119377206 14:74204333-74204355 CAGAGGTGGGAGGAGTGAGGGGG - Intergenic
1119505106 14:75165972-75165994 GACTTGGGGGAGGAGTGGGGGGG + Intronic
1119915614 14:78398531-78398553 TACTGTTGGGCAGAGTTTGGAGG + Intronic
1122283289 14:100636783-100636805 TGCACGTGGGAGGAGCGTGGAGG - Intergenic
1122297775 14:100714811-100714833 TACCGTTGTGAGGAGGGTGGTGG + Intergenic
1122444448 14:101759167-101759189 CATCGGTGGCAGGAGTGTGGAGG - Intergenic
1122819325 14:104333328-104333350 TGCTGGAGGTAGGGGTGTGGAGG - Intergenic
1123090131 14:105738739-105738761 GACAGGTGGGGAGAGTGTGGGGG + Intergenic
1124513615 15:30348101-30348123 GCCAGGTGGGACGAGTGTGGTGG - Intergenic
1124729306 15:32182664-32182686 GCCAGGTGGGACGAGTGTGGTGG + Intergenic
1124800777 15:32830947-32830969 TAGTGGTGGGGGGTGTTTGGAGG - Intronic
1124988065 15:34642382-34642404 TACTGCAGGGAGGGGAGTGGGGG + Intergenic
1125018596 15:34962479-34962501 TACTGGTTGGCCGGGTGTGGTGG + Intronic
1126545100 15:49864707-49864729 TACTGGTGGGAAGATTGCAGAGG - Intronic
1126674821 15:51151738-51151760 TACTAGAGGGAGGAGGGAGGGGG + Intergenic
1126895617 15:53254138-53254160 TGCAGGTGGGAGGAGGGTTGAGG + Intergenic
1128075128 15:64821087-64821109 GACTGGTGGGGGCAGGGTGGGGG + Exonic
1128870722 15:71153311-71153333 TACAGGTGGGAGGTGAGTGAGGG + Intronic
1129034122 15:72639534-72639556 TACTGCTGGGATGTGTGTGTTGG - Intergenic
1129215760 15:74097682-74097704 TACTGCTGGGATGTGTGTGTTGG + Intergenic
1129653422 15:77507356-77507378 TGCTTCTGGGAGGGGTGTGGGGG - Intergenic
1129732895 15:77942010-77942032 TACTGCTGGGATGTGTGTGTTGG + Intergenic
1129777831 15:78248346-78248368 CACTGGTGGGAGTAGTGTGCTGG + Intergenic
1130119753 15:81037807-81037829 TACTGGTGAGAGAAGAGGGGAGG + Intronic
1130137379 15:81192790-81192812 CACTGGTAAGAGGAGGGTGGCGG + Intronic
1130192726 15:81751751-81751773 TACTGGTGGGAGGTTTGGGGTGG - Intergenic
1130324455 15:82868419-82868441 TACTGGAGGGTGGAGGGTGGAGG + Intronic
1130382313 15:83380880-83380902 TACTTCTGGGAGGAGAGTTGGGG - Intergenic
1130910370 15:88266432-88266454 TACTCGTGGGTGGGGTGCGGTGG + Intergenic
1133121465 16:3611342-3611364 GCCTGGAGGGAGGAGGGTGGCGG - Intronic
1133983892 16:10653267-10653289 CTCTGGTGGGAAGAGGGTGGTGG + Intronic
1134114680 16:11539060-11539082 CACCGGTGGAAGGAATGTGGGGG + Intergenic
1134225111 16:12383852-12383874 TAGTGGAGGGAGGAGGGCGGAGG - Intronic
1134857286 16:17530868-17530890 TAGTGGTGGGCTGGGTGTGGTGG + Intergenic
1135109378 16:19678763-19678785 TACTGATGGGCTGGGTGTGGTGG - Intronic
1135865887 16:26101422-26101444 CAGTGGTGGCAGGAATGTGGTGG - Intronic
1136039764 16:27568949-27568971 TTCAGGTGGGAGGGGAGTGGTGG - Intronic
1138300239 16:55920024-55920046 TGCTGGTGGGGGAAGGGTGGTGG - Intronic
1138753750 16:59456891-59456913 AAAGGGTGGGAGGAGTGTGAGGG - Intergenic
1139107199 16:63841047-63841069 TACTTGAGGGTGGAGGGTGGGGG + Intergenic
1140041894 16:71413599-71413621 AAATGGTGGCAGGAGTTTGGTGG + Intergenic
1140629800 16:76837679-76837701 TCCTGTTGGGCTGAGTGTGGTGG + Intergenic
1140941102 16:79722734-79722756 TGTTGGTGGGAGGTGTGAGGAGG + Intergenic
1141253710 16:82381891-82381913 TGGTGGCGGGGGGAGTGTGGTGG + Intergenic
1141767899 16:86070773-86070795 TACTCACGGGGGGAGTGTGGTGG - Intergenic
1141981122 16:87551013-87551035 TCCTGGTGGACAGAGTGTGGGGG + Intergenic
1142186107 16:88695434-88695456 TCCTGCTGGGAGGTGGGTGGCGG + Intergenic
1142202923 16:88769754-88769776 CTCTGGTGGGCGGAGCGTGGTGG + Intronic
1203094785 16_KI270728v1_random:1244317-1244339 CACTGGGGGGGGGGGTGTGGCGG + Intergenic
1142715064 17:1742797-1742819 TCCTGGTGGGAGGGGAGGGGTGG + Intergenic
1143555552 17:7657562-7657584 CACCTGTGGGTGGAGTGTGGAGG - Exonic
1143772607 17:9178318-9178340 ATCAGGTGGGAGGAGGGTGGGGG - Intronic
1144137770 17:12314688-12314710 TGGTGGTGGTGGGAGTGTGGGGG + Intergenic
1144755968 17:17681134-17681156 TAATGGTGGGGTGAGGGTGGGGG + Intergenic
1144781773 17:17811912-17811934 TGTTAGTGGGAGGAGTGGGGAGG - Intronic
1146271619 17:31488792-31488814 CAGTGGTGGGAGGTGTGTTGTGG + Intronic
1147051214 17:37796411-37796433 CACCGGGGTGAGGAGTGTGGTGG - Intergenic
1147242596 17:39100293-39100315 GAGTGGTGTGAGGAGTGAGGTGG + Intronic
1147578860 17:41617558-41617580 TACTGATGGGACAAGTGAGGAGG - Intergenic
1147745979 17:42694861-42694883 TACTGGTGGGAGGAGTGTGGGGG + Intronic
1147975686 17:44246971-44246993 TAAGGGTGGGAGGAGTGGGATGG + Intergenic
1148327828 17:46794110-46794132 CTCTGGTGGGAGGGGCGTGGGGG + Intronic
1148617559 17:49012648-49012670 TCCTGCTGGGAGGAGGGAGGAGG - Intronic
1149363021 17:55913863-55913885 TGCTGGTGGCAACAGTGTGGTGG + Intergenic
1149522468 17:57328013-57328035 TACTGTTGGGGGGAGTGGGTAGG + Intronic
1150048474 17:61936159-61936181 TACTTGAGGGTGGAGGGTGGGGG + Intergenic
1150193611 17:63270813-63270835 TACTGGTGGGAGGAGGTAGGAGG - Intronic
1150256051 17:63745675-63745697 TTCTGGTGGGAGTGGGGTGGTGG - Exonic
1150661783 17:67087214-67087236 TTTTGGTGGGAGTAGGGTGGAGG - Intronic
1150957084 17:69870933-69870955 TACTGTAGGGAGGAATGTGCTGG - Intergenic
1152437219 17:80283708-80283730 TGCTGGTGGGAGGTGGGGGGTGG + Intronic
1152776739 17:82206545-82206567 GAGTGGTGGGTGGGGTGTGGGGG + Intronic
1153000460 18:450733-450755 CAGAGGTTGGAGGAGTGTGGAGG + Intronic
1153143149 18:1998071-1998093 TAGAGCTGGGAGGAGTGAGGAGG + Intergenic
1153476799 18:5506060-5506082 TAGTGGTGGAAGTAATGTGGCGG - Intronic
1153564272 18:6404097-6404119 GAAGGGTGGGAGGAGGGTGGGGG + Intronic
1154147568 18:11878955-11878977 AACTGGTTGGAGGAGTGGGGAGG + Intronic
1156495672 18:37523851-37523873 TGAAGGTGGGAGGAGGGTGGTGG + Intronic
1156918678 18:42491937-42491959 TTGTGGTGGGGGGAGTGTTGGGG + Intergenic
1157158477 18:45290260-45290282 TACTAGTGGGAGCAGGGAGGTGG - Intronic
1158064643 18:53391721-53391743 TACTGGTGGGAGCATGGGGGTGG - Exonic
1159038429 18:63299485-63299507 TACTGCTGGTAGCAGTGTGTTGG - Intronic
1160137620 18:76286037-76286059 TTCTGCAGGGAGGGGTGTGGAGG - Intergenic
1160377176 18:78421829-78421851 AACTGGTGGGTGGAGGGTTGGGG + Intergenic
1160571100 18:79818234-79818256 TCCTTCTGGGAGGAGGGTGGGGG - Intergenic
1161073386 19:2273519-2273541 GACTGGTGGGAGGAGTGCCTGGG + Intronic
1161518216 19:4708778-4708800 TATTGGAGGGTGGAGGGTGGAGG + Intronic
1162468843 19:10859966-10859988 CACTGGAGTCAGGAGTGTGGAGG - Intronic
1163398868 19:17079741-17079763 GGCTGGTGGGTGGGGTGTGGGGG - Intronic
1164541022 19:29121694-29121716 TACTTGTGGGATTAGTCTGGCGG + Intergenic
1165160610 19:33813556-33813578 GGCTGCTGGGAGGAGAGTGGTGG + Exonic
1165371806 19:35412708-35412730 TACTGAAGGGATGGGTGTGGTGG - Intergenic
1165912419 19:39237391-39237413 AACTGGTGGGAGGATAGTAGAGG + Intergenic
1165987984 19:39787313-39787335 CTCTGGTTGGGGGAGTGTGGTGG - Intergenic
1166381463 19:42357305-42357327 TACTTCAGGGAGGACTGTGGGGG + Intronic
1166660823 19:44646297-44646319 TCCTGGTTGGAAGAATGTGGGGG - Intronic
1166794991 19:45420566-45420588 CACAGGTGGGAGGAGGGAGGAGG - Intronic
1168146179 19:54421026-54421048 TAATGGTGGGTGGAGTGGTGGGG - Intronic
1168513264 19:56990330-56990352 TACTAGAGGGAGGAGGGAGGGGG + Intergenic
1168571651 19:57475848-57475870 TACAGGAGGGAGATGTGTGGGGG - Intronic
925997402 2:9304503-9304525 TACAGGTGGGAGGGCTGTAGGGG + Intronic
927395662 2:22648057-22648079 GCCTGGTGGGAGGAGACTGGGGG + Intergenic
927492886 2:23532164-23532186 TCCTGGTGGGAGAGGGGTGGAGG + Intronic
927845034 2:26467015-26467037 CAGTGGTGGGAGGTGAGTGGGGG + Intronic
928077865 2:28281466-28281488 TCCTGCTGGGAGGAGACTGGTGG - Intronic
928127933 2:28629033-28629055 TACTGCTGGGAGGAACCTGGGGG - Intronic
928683843 2:33728195-33728217 AACTGGTGGAAGGAGAGGGGCGG - Intergenic
928883131 2:36119872-36119894 TAGTGGGGGGAGGAGAATGGTGG - Intergenic
929574050 2:43041292-43041314 TCCAGGTTGGAGGAGTGGGGAGG - Intergenic
930063448 2:47309967-47309989 TAGAGGTGGGTGGGGTGTGGTGG - Intergenic
930394564 2:50804727-50804749 TAGAGGTGGGAGTAGTGAGGAGG - Intronic
930756745 2:54982241-54982263 TACTTGTGGGCCGGGTGTGGTGG - Intronic
932532990 2:72557642-72557664 TACTTGAGGGTGGAGGGTGGAGG + Intronic
933236280 2:79868311-79868333 TACTGGTGGCAGGGGTTGGGGGG - Intronic
933344589 2:81066776-81066798 TACTGGTTGGAAGAGTTTTGAGG - Intergenic
934066799 2:88348846-88348868 TACTGGTGGGGGGAGGGAGGAGG + Intergenic
935973476 2:108554664-108554686 TACAGCTGAGAGGAGTGTGCTGG + Intronic
936294272 2:111254256-111254278 AACTGCTTGGATGAGTGTGGAGG - Intergenic
937220857 2:120342725-120342747 TGCTGGTGGGAGGAGGGAAGAGG - Intergenic
937558805 2:123194529-123194551 TGTTGGTGGGTGGAGTCTGGCGG + Intergenic
938082527 2:128377789-128377811 TACTGGTTGTAGGAGGGAGGGGG + Intergenic
938095844 2:128462718-128462740 TACTTGAGGGTGGAGGGTGGGGG + Intergenic
938320587 2:130359676-130359698 TCCTTGTGGGAGGAGGGAGGAGG + Intronic
938380800 2:130835594-130835616 TGGTGGTGGGAGGAGGGTGTGGG - Intergenic
938461703 2:131501658-131501680 GACTGGAGGGTGGGGTGTGGCGG + Intergenic
940026553 2:149214655-149214677 CACTGGTAGGTAGAGTGTGGGGG - Exonic
940077350 2:149757624-149757646 TCATGGTAGGAGGAGTGTGTGGG - Intergenic
940729883 2:157376390-157376412 TAGAGGTTGGAAGAGTGTGGAGG - Intergenic
940768799 2:157818718-157818740 CACTGATAGGAAGAGTGTGGAGG + Intronic
940861126 2:158771679-158771701 TAGAGGTGGGAGCAGTATGGGGG - Intergenic
942892536 2:181008660-181008682 TAGTGGTGAGAGGAGGATGGAGG + Intronic
942908561 2:181213078-181213100 TACTTGAGGGAGGAGGGTGGGGG + Intergenic
943819231 2:192298882-192298904 CACTGGTGGCAGAAGTGGGGAGG - Intergenic
944293075 2:198030161-198030183 TACTGGAGGGTGGAGGGTGAAGG - Intronic
944435072 2:199680165-199680187 TACAGGTTGGAGGAGTCTGTTGG + Intergenic
944573463 2:201068529-201068551 TACGGATGGGAGGAGTGTGAAGG - Intronic
944746911 2:202666564-202666586 CACTGGTGGGTGGGATGTGGGGG + Intronic
945170940 2:206994248-206994270 TAGTGGTGGGGGGACTGGGGAGG + Intergenic
945753077 2:213812549-213812571 TATTTGTGGGAGGAGGGTGCAGG + Intronic
945872007 2:215237604-215237626 TTTTGGTGGGGGGGGTGTGGGGG - Intergenic
946204169 2:218091474-218091496 TCCTGGTGGGAGTGGGGTGGGGG - Intergenic
946642092 2:221794793-221794815 TACTGGGGGTGGGGGTGTGGGGG + Intergenic
946970817 2:225089127-225089149 CACATGTGGGAGGAATGTGGTGG - Intergenic
947877279 2:233476111-233476133 GACTGTTGGGAGGAGTATGAGGG + Exonic
947989920 2:234478585-234478607 TGGTGGTGGGTGGAGTGTGTAGG + Intergenic
947998541 2:234548405-234548427 TACTTGGGGGTGGAGGGTGGGGG + Intergenic
948623526 2:239251788-239251810 TGTTGGAGGGAGGAGTGTGCTGG - Intronic
948626850 2:239274825-239274847 GACAGCTGGGAGGAGCGTGGGGG - Intronic
949056408 2:241930215-241930237 TACAGGTGGGAGGGGCATGGAGG + Intergenic
1169228747 20:3872907-3872929 TACTGGTGGGTGGTGGGAGGGGG - Exonic
1169332970 20:4730913-4730935 TGATGGTGGGAGGTGGGTGGTGG + Intergenic
1170851738 20:20011128-20011150 TAATGGTGGGAGGGGAGGGGAGG - Intergenic
1170945659 20:20889022-20889044 AACTGCTGGGAGAGGTGTGGAGG - Intergenic
1171256395 20:23691766-23691788 TGCTGGTGGGTGGAGTGTGAGGG + Intergenic
1171263753 20:23753690-23753712 TGCTGGTGGGTGGAGTATGAGGG + Intergenic
1171272921 20:23830360-23830382 TGCTGGTGGGTGGAGTGTGAGGG + Intergenic
1171284344 20:23924854-23924876 TAGTGGTGAGTGGAATGTGGGGG + Intergenic
1172632035 20:36385145-36385167 TAGTGGTGAGGGGAGGGTGGTGG - Intronic
1173141849 20:40491624-40491646 CACTGGTGGCAGGATTTTGGGGG + Intergenic
1174391195 20:50219331-50219353 TTGAGGTGGGAGGAGTGTGGTGG + Intergenic
1175148411 20:56913709-56913731 TACAGGTGGGTGAAGTGTGGGGG - Intergenic
1176008767 20:62880736-62880758 TCCTGGTGGGGGGAGCGGGGCGG + Exonic
1176264305 20:64200812-64200834 AACAGGTGGGAGGGGTGGGGTGG + Intronic
1176717726 21:10367692-10367714 CACTAGTGGGGGGAGTGGGGTGG - Intergenic
1176720054 21:10385327-10385349 TTCTGGTGGGTGGACTATGGTGG - Intergenic
1176942734 21:14943579-14943601 AAGTGGTGAGAGGAGTGTAGAGG + Intergenic
1178378872 21:32091949-32091971 TCTTGGTGGGAGGAGGGGGGAGG + Intergenic
1178779500 21:35588011-35588033 AAGTGGTGGGAGGTGTGTGAAGG - Intronic
1179840645 21:44070819-44070841 TGCTGGTGGGAGAAGAGTGCTGG + Intronic
1180298953 22:11020598-11020620 CACTAGTGGGGGGAGTGGGGTGG - Intergenic
1180661907 22:17475111-17475133 CACTGGTGGGAGCAGCGTGGGGG + Intronic
1181625541 22:24119909-24119931 GAATGGAGGGAGGAGTGTAGGGG + Intronic
1182080672 22:27526667-27526689 TGTTGGTGGGAAGAGTATGGAGG - Intergenic
1182327584 22:29525388-29525410 GGGTGGTGGGAGGACTGTGGTGG - Intronic
1182356873 22:29726149-29726171 TCCTGGTGGGATGAGTGAAGGGG + Intronic
1183402694 22:37613924-37613946 CAGGGGTGGGAGGAGTGGGGAGG + Intronic
1184020985 22:41821462-41821484 GACTGGTGGGGGGAGGGGGGAGG - Intronic
950644839 3:14371014-14371036 TGCTGGTGGGAGGAGTGCTCAGG - Intergenic
950848927 3:16043711-16043733 CACTGGTGGTGGCAGTGTGGTGG + Intergenic
951750851 3:26034769-26034791 TACTGGATGGTGGAGGGTGGAGG + Intergenic
951990516 3:28671339-28671361 CAATGGTGGGAGGACTCTGGGGG - Intergenic
952548553 3:34449937-34449959 TCCTGGAGGGAGGAATGTGCTGG - Intergenic
953070626 3:39515954-39515976 TACTAGTGTCAGGAATGTGGGGG - Exonic
953829001 3:46279087-46279109 GCCTGGTGGGATGAGGGTGGGGG + Intergenic
953879013 3:46681989-46682011 TACTGCTGGGAGGCGTGCAGTGG - Intronic
954155333 3:48682085-48682107 CACTGGTGGGGGCGGTGTGGTGG + Exonic
955241705 3:57183795-57183817 TATTGGAGGGAGGAGACTGGGGG + Intergenic
956337169 3:68176892-68176914 TAGTTCTGGGAGGAATGTGGGGG + Intronic
956372389 3:68577427-68577449 TACTTGAGGGTGGAGGGTGGAGG + Intergenic
957973041 3:87407144-87407166 TAGGGGTGGGGGGAGTGGGGAGG + Intergenic
958069493 3:88591877-88591899 TATTGGAGGGTGGAGGGTGGAGG + Intergenic
959098332 3:101981831-101981853 TACTTGAGGGTGGAGGGTGGAGG - Intergenic
959574433 3:107919247-107919269 TGGTGGTGGGAGGAGTGGGATGG - Intergenic
959637954 3:108596471-108596493 TAGAGGTTGGAGAAGTGTGGAGG + Intronic
959764440 3:110008492-110008514 AACTTGTGGGAGAAGTGTTGTGG + Intergenic
960150560 3:114244864-114244886 CAGAGGTTGGAGGAGTGTGGAGG + Intergenic
961740805 3:129032151-129032173 TAATGTTTGGAGTAGTGTGGAGG - Intronic
962121457 3:132565135-132565157 TGCTGGTGTGAGGAGTGGTGGGG - Intronic
962330482 3:134473500-134473522 TACTTGAGGGAGGAGGGTGAAGG + Intergenic
962817441 3:139014970-139014992 CAGAGGTGGGAGGGGTGTGGGGG - Intronic
963317010 3:143770494-143770516 TTGTGTTGGGAGGAGTCTGGGGG + Intronic
965755362 3:172021083-172021105 GACTGGTGGAGGGTGTGTGGGGG - Intergenic
965908144 3:173736325-173736347 GACTGGTGGAAGGAGAGTGGGGG - Intronic
966595642 3:181722884-181722906 TACTGGGAAGAGGGGTGTGGAGG + Intergenic
966877144 3:184328855-184328877 TAGTGGTGAGAGAACTGTGGAGG + Intronic
967254678 3:187577694-187577716 TACTGGAGGGTGGAGGGTGGAGG + Intergenic
968125148 3:196153504-196153526 GACTTGGGGGAAGAGTGTGGGGG - Intergenic
969373201 4:6747119-6747141 TACTGCTGGGAGCAGGGAGGAGG + Intergenic
969399186 4:6942662-6942684 CTGTGGTGGGAGGAGTGAGGCGG + Intronic
969572209 4:8015683-8015705 AAGTGGTGGGAGGTGTGTGTTGG + Intronic
969831884 4:9804592-9804614 TCCTGGTGGGAGGAGAGGAGGGG - Intronic
970305174 4:14724260-14724282 TACTGTTGGTGGGAGTGTTGTGG + Intergenic
971296779 4:25400820-25400842 TCCTGGTGGGAGGAAGGTGGGGG + Intronic
973573815 4:52266087-52266109 GTCTGGGGGGAGGAATGTGGTGG - Intergenic
975214349 4:71736751-71736773 TGCTGGTGGGCTGGGTGTGGTGG + Intergenic
976211052 4:82670021-82670043 GTGTGGTGGGAGGTGTGTGGGGG - Intronic
976400003 4:84596704-84596726 TCTTGGTGGGGGGAGTGGGGAGG + Intronic
976600575 4:86934824-86934846 GATTGGTGGGAGGATCGTGGGGG - Intronic
978193840 4:105947492-105947514 CAGTGGTGGGATGAGTGTTGTGG - Intronic
978637353 4:110825179-110825201 TACTGGTGGGTAGAGAGAGGAGG - Intergenic
980030153 4:127818727-127818749 TACTGGAAGGTGGAGGGTGGAGG + Intronic
980908033 4:138968084-138968106 TACTGGAGGGAGGAGGGAGGTGG + Intergenic
981001590 4:139833797-139833819 TACTGATGGGATGGGGGTGGGGG + Intronic
982605894 4:157515552-157515574 TACAGCTGGCAGGAGTATGGAGG + Intergenic
982747057 4:159114822-159114844 TACTTTTGGTAGGAGTGAGGGGG + Intronic
983268170 4:165529858-165529880 TATTGGAGGGAGTAGTGTAGGGG + Intergenic
983280747 4:165678073-165678095 AACTGATGGGAGGAGTGCTGAGG + Intergenic
983497824 4:168463429-168463451 TATTGGAGGGCGGAGGGTGGAGG + Intronic
984636303 4:182113681-182113703 GTGTGGTGGGAGAAGTGTGGGGG + Intergenic
984758265 4:183343205-183343227 CAGTGGTGGGGAGAGTGTGGAGG - Intergenic
985586453 5:740128-740150 GAGTGGTGGGAGGAGGGTGATGG + Intronic
985601041 5:832305-832327 GAGTGGTGGGAGGAGGGTGATGG + Intronic
985616990 5:928733-928755 TAAAGGTTGGAAGAGTGTGGAGG + Intergenic
985644244 5:1077656-1077678 GAGTGGTGGGAGGTGGGTGGTGG - Intronic
986540147 5:8836499-8836521 TGGTGGTGGGAGGTGGGTGGAGG - Intergenic
986786842 5:11122718-11122740 TACTAGTTTGAGGAGTGGGGTGG + Intronic
986897489 5:12387565-12387587 TACTGGTGGGGCGTGTGTAGGGG + Intergenic
988897944 5:35698609-35698631 TACTGGTGGAAGGAGGGTAATGG - Intronic
989339930 5:40362791-40362813 TACTGGAGGGTGGAGGGTGGAGG - Intergenic
990024505 5:51168913-51168935 TACTTGAGGGTGGAGGGTGGAGG + Intergenic
990181829 5:53169477-53169499 TACTGGATGGAGGAGTGATGGGG - Intergenic
990687054 5:58316392-58316414 TACTTGAGGGTGGAGGGTGGGGG - Intergenic
990786984 5:59432568-59432590 TAGTCTTGGCAGGAGTGTGGAGG - Intronic
991491959 5:67192692-67192714 GCCTGGTGGGAGGCGTGTGGGGG - Intronic
991575625 5:68100421-68100443 TCATTGTGGGAGGTGTGTGGTGG - Intergenic
993921096 5:93803548-93803570 TATTGGAGGGTGGAGGGTGGAGG + Intronic
994099768 5:95879989-95880011 GGGTGGTGGGAGGAGTGGGGAGG + Intergenic
994470648 5:100200655-100200677 TACTTGAGAGAGGAGGGTGGAGG - Intergenic
994645700 5:102466175-102466197 TACTGGAGGGCAGAGGGTGGGGG - Intronic
995803462 5:116025055-116025077 TAGTGGTGGGAGGGGAGTGGTGG - Intronic
996111025 5:119567016-119567038 TACTGGTGGGGCGAAGGTGGTGG + Intronic
996163822 5:120200046-120200068 TAGTGCTGGGAGGAGTGGGCTGG + Intergenic
997193631 5:131962928-131962950 CAGTGGTGGGAGGACTGTGTGGG - Intronic
997592969 5:135086846-135086868 TCCTGGTGGGAGCAGTGTCAGGG + Intronic
997658226 5:135570801-135570823 TACTGGGGGGCAGTGTGTGGAGG + Exonic
998374034 5:141679914-141679936 TGATGCTGGGAGGAGTGGGGAGG - Intronic
1000612969 5:163395435-163395457 AAGGGGTGGGAGGAGGGTGGAGG + Intergenic
1001330946 5:170761934-170761956 TACAGGTGGGATGTATGTGGAGG + Intergenic
1001848336 5:174941036-174941058 AAGTGATGGGAGGAGTCTGGAGG + Intergenic
1002634160 5:180598847-180598869 CAAGGGTGGGGGGAGTGTGGGGG + Intergenic
1003140936 6:3470739-3470761 TCCGGGTGGGTGCAGTGTGGAGG + Intergenic
1003290318 6:4775082-4775104 AACTGGTGGGAGGAGCCTTGTGG + Intronic
1004653382 6:17634108-17634130 TAGTGGTGGGAGTAATGGGGGGG - Intronic
1005229815 6:23686574-23686596 TTCTGGGAGGAGGAGTGTGGTGG - Intergenic
1005310074 6:24550748-24550770 TACTCGCGGGTGGAGGGTGGGGG - Intronic
1006109878 6:31738059-31738081 GACTTGGGGGAGGAGTGGGGTGG + Intronic
1007398487 6:41590406-41590428 TCCTGGAGGCAGGGGTGTGGCGG - Intronic
1007948381 6:45846761-45846783 TACTAGTGGGTGGAGGGTGAGGG + Intergenic
1008116100 6:47552043-47552065 TCTTGGTGGGAGGAGTGTCAAGG + Intronic
1008269951 6:49479960-49479982 TACTTGCGGGAGGAGAGTGAGGG + Intronic
1008853470 6:56052894-56052916 TACTGGAAGGTGGAGGGTGGAGG + Intergenic
1009462603 6:63932686-63932708 TTCTGTTGGGTGGAGTGTGAGGG - Intronic
1010271806 6:73924066-73924088 TATAGATGGCAGGAGTGTGGGGG + Intergenic
1010433907 6:75808962-75808984 TACAGGTGAGAGGAGGGTAGAGG + Intronic
1010769776 6:79815148-79815170 TTATGGTTGGAGGAGTGTGGTGG + Intergenic
1011317454 6:86051957-86051979 TTGTGGTGGGGGGAGTGGGGAGG - Intergenic
1013091013 6:106900927-106900949 TAGAGGTTGGAAGAGTGTGGAGG + Intergenic
1013216575 6:108032760-108032782 TGGGGGTGGGTGGAGTGTGGTGG + Intergenic
1013592615 6:111632041-111632063 TGGTGGTGGGTGGAGTTTGGAGG + Intergenic
1016271249 6:142292959-142292981 TACTGTTGGGCCAAGTGTGGCGG - Intergenic
1017233563 6:152097613-152097635 TACTGGTGGCGGGGGTGGGGAGG - Intronic
1018609936 6:165638172-165638194 TTTTGGTGGGGGGAGGGTGGTGG - Intronic
1019378996 7:711826-711848 TCCGGGTGGGAAGAGTGGGGGGG + Intronic
1019653736 7:2175519-2175541 TACTGCAGTGAGAAGTGTGGTGG - Intronic
1019735483 7:2648045-2648067 TCCTGGTGGGGTGAGTCTGGGGG + Exonic
1020116486 7:5479352-5479374 TTCTGGAGGAAGGAGTGGGGCGG + Intronic
1020154418 7:5710659-5710681 TACTGGTGCTAGGAGTGTGAAGG - Intronic
1020594642 7:10190558-10190580 TGCTGGTGGGAGGACAGTAGTGG + Intergenic
1021611967 7:22466370-22466392 TACTTGAGGGTGGAGGGTGGGGG - Intronic
1021649861 7:22822628-22822650 GACTGGAGGGAAGAGGGTGGCGG - Intronic
1021670545 7:23031264-23031286 TACTTTGGGGAGGGGTGTGGTGG - Intergenic
1022333576 7:29402025-29402047 CACTGGAAGGAGCAGTGTGGCGG - Intronic
1023554318 7:41404866-41404888 TGCTGGTGGCAGGGGTGTCGTGG + Intergenic
1023848130 7:44134721-44134743 TTGTGGTGGTGGGAGTGTGGAGG + Intergenic
1024063182 7:45713939-45713961 TACTGGCCTGGGGAGTGTGGAGG - Exonic
1024173158 7:46810915-46810937 TACAGGATGGGGGAGTGTGGTGG + Intergenic
1024230103 7:47357448-47357470 TTCAGCTGGGAGGAGTGTTGGGG - Intronic
1025609849 7:63068386-63068408 TTCTTGTGGGAGGAGTGGGGCGG - Intergenic
1025710132 7:63900816-63900838 TTCTCGTGGGAGGAGCGGGGCGG + Intergenic
1025970249 7:66316915-66316937 TACTGGAGGGTGGAGGGTGGAGG + Intronic
1026062257 7:67036924-67036946 GACTGGAGGGAGGAGGGTGTGGG + Intronic
1026372037 7:69709761-69709783 TTATTATGGGAGGAGTGTGGAGG + Intronic
1026449245 7:70512873-70512895 CACTGGTGAGTGAAGTGTGGGGG + Intronic
1026451955 7:70537173-70537195 TACTGGTGGGAAGGAGGTGGAGG - Intronic
1026902242 7:74043711-74043733 AACTCGTGGGAGGAGGGTTGTGG + Intronic
1028160283 7:87476542-87476564 TCCTTTTGGGAAGAGTGTGGAGG - Intronic
1029244531 7:99189464-99189486 TACTGGTGGGAGTGATTTGGGGG - Intronic
1029250517 7:99232938-99232960 AACTGGTGGGAGGAGAGTAGAGG + Intergenic
1029310000 7:99654223-99654245 TTGGGGTGGGAGGAGTGGGGAGG - Intronic
1029704483 7:102268890-102268912 GCCTGGTGGGAGGTGTTTGGGGG - Intronic
1031911724 7:127523870-127523892 TACTGGAGGGGGGAGAGGGGAGG + Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034302723 7:150030742-150030764 AAGTGGTGGGAGGGGTGTGTGGG - Intergenic
1034970772 7:155417943-155417965 GGCAGGTGGGAGGAGTGGGGGGG - Intergenic
1036600438 8:10255743-10255765 TACTGGGGGCTGGAGTGGGGCGG + Intronic
1037840666 8:22243231-22243253 TAGTGGTGGGAGGAGGTGGGGGG + Intergenic
1038920858 8:32082364-32082386 TACTTGAGGGTGGAGGGTGGAGG - Intronic
1038945365 8:32353669-32353691 AACTAGTGGCAGGAATGTGGAGG + Intronic
1038974995 8:32685452-32685474 TGGTGGAGGTAGGAGTGTGGAGG - Intronic
1041330882 8:56723145-56723167 TAGTGGTGGGAGCTGTTTGGAGG + Intergenic
1042146156 8:65732407-65732429 TCCTGGTGCAAGGAATGTGGTGG - Intronic
1043282791 8:78489332-78489354 TATTGGAGGGTGGAGGGTGGGGG - Intergenic
1043534175 8:81182803-81182825 TTATGGTGGGGGGAGTATGGTGG + Intergenic
1043989289 8:86733089-86733111 TACTAGAGGGAGGAAGGTGGGGG - Intronic
1044147029 8:88729400-88729422 AACTGGGGCGAGGTGTGTGGGGG - Intergenic
1045274426 8:100689720-100689742 TACTAGTGGGCCGGGTGTGGTGG - Intronic
1046804042 8:118460676-118460698 TACTGGAGGGAGAAGTGCAGAGG + Intronic
1048672689 8:136740612-136740634 AACAGGAGGGAGGAGTGCGGGGG + Intergenic
1049030413 8:140032410-140032432 TGCTGGCTGGAGGAGGGTGGGGG - Intronic
1049369590 8:142257502-142257524 GAGTGGTGGGTGGAATGTGGTGG - Intronic
1049452735 8:142670669-142670691 AACTGGAGGGTGGACTGTGGTGG + Intronic
1049597699 8:143492332-143492354 CCCTGGTGGGAGGAGGGAGGTGG - Intronic
1049950818 9:641993-642015 TAGTGCTGGGGGGTGTGTGGTGG - Intronic
1049969648 9:810614-810636 TTCTTGTGGGTGGAGTGTGCTGG - Intergenic
1050735838 9:8762016-8762038 TACTGGTGGGAAAAGTGAGTAGG + Intronic
1050981173 9:12017927-12017949 TACTTGAGGGATGAATGTGGGGG + Intergenic
1052669205 9:31534093-31534115 TACTTGAGGGTGGAGGGTGGAGG - Intergenic
1054793974 9:69281519-69281541 TACAGGAGGGAGGACTCTGGGGG - Intergenic
1055472943 9:76631818-76631840 TACTAGAGGGTGGAGGGTGGAGG - Intronic
1055734927 9:79316726-79316748 TACTGGTGGGAGGAGAATAATGG - Intergenic
1056388532 9:86119188-86119210 TCCTGGGGGAAGAAGTGTGGAGG + Intergenic
1056427425 9:86491101-86491123 TTCCGGGGAGAGGAGTGTGGTGG + Intergenic
1056966369 9:91165994-91166016 TACAGGTGGGTGGGGTGGGGGGG - Intergenic
1057023673 9:91719741-91719763 TACTTGTAGGGGGAGGGTGGAGG + Intronic
1057360315 9:94367303-94367325 TACTTGAGGGTGGAGGGTGGGGG - Intergenic
1057724248 9:97556938-97556960 TGCTGATGGGAGGAGCCTGGAGG + Intronic
1057987461 9:99731864-99731886 AACTGGTGGGGGGCGTGGGGAGG + Intergenic
1058589988 9:106555073-106555095 TACTGGTGGGTGTTGTTTGGTGG - Intergenic
1059155403 9:111984650-111984672 TCATGGTGGGAGGGGTGTGTGGG - Intergenic
1060361700 9:122965309-122965331 GGCTGGTTGGAGGAGTCTGGTGG + Intronic
1061931435 9:133834990-133835012 ATCTGGAGGGCGGAGTGTGGGGG - Intronic
1062129462 9:134884784-134884806 AAGCCGTGGGAGGAGTGTGGGGG - Intronic
1062395552 9:136351251-136351273 CACTGATGGGAGAGGTGTGGAGG + Intronic
1062612208 9:137380365-137380387 TACCGGCGGGAGGATTGAGGGGG - Intronic
1062612258 9:137380473-137380495 TACCGGTGGGGGGATTGGGGGGG - Intronic
1062712044 9:137980660-137980682 TACTAGAGGGAGGAGGGAGGGGG - Intronic
1202802376 9_KI270720v1_random:11743-11765 TTATGGTGGGGGGAGTGAGGAGG - Intergenic
1185540958 X:902725-902747 TTCTGGTGGGTGGACTATGGTGG + Intergenic
1185542749 X:916506-916528 CACTAGTGGGGGGAGTGGGGTGG + Intergenic
1186455301 X:9706009-9706031 AAGAGGTGGGAGGAGTGGGGGGG + Intronic
1186577360 X:10780414-10780436 TGATGGTGGGAGGGGTGTGGAGG + Intronic
1187131724 X:16509479-16509501 TATTGTGGGGAGGAGGGTGGTGG - Intergenic
1188229185 X:27640078-27640100 CATTGGTGGGAGGAGGGGGGAGG - Intronic
1188241264 X:27794506-27794528 AACTGGAAGGAGGTGTGTGGAGG + Intergenic
1188475251 X:30585421-30585443 TACGGGTGGGGGGAGGGGGGAGG - Intergenic
1189450640 X:41125624-41125646 TGTTGGCGGGAGGGGTGTGGGGG - Intronic
1189838620 X:45046719-45046741 AACGGGTGGGAGGATTGTGTAGG + Intronic
1190164705 X:48063500-48063522 TAATGGTGGCAGGAGGGAGGGGG + Intronic
1190964059 X:55280683-55280705 TTTTGGTGGGAGGGGTGTAGGGG + Intronic
1192859942 X:75056858-75056880 TATTGTTGGTAGTAGTGTGGGGG - Intronic
1193248048 X:79253483-79253505 TAGTGGTGGGTGGAGGGAGGAGG + Intergenic
1193484435 X:82069387-82069409 TATTGGAGGGGGGAGGGTGGAGG - Intergenic
1194415845 X:93610625-93610647 TACTTGAGGGTGGAGGGTGGGGG + Intergenic
1194434271 X:93850267-93850289 TATTGGAGGGTGGAGGGTGGGGG + Intergenic
1194842743 X:98763995-98764017 TACTAGAGGGAGGAGTGGGGAGG + Intergenic
1194945043 X:100056763-100056785 TTGGGGTGGGAGGAGTGGGGAGG + Intergenic
1196145789 X:112315391-112315413 TAGAGGTGGGAGTAGCGTGGGGG - Intergenic
1196367029 X:114934849-114934871 TAGAGGTTGGAAGAGTGTGGAGG - Intergenic
1197771978 X:130094961-130094983 TGCTGGTGGGCCGAGGGTGGTGG + Intronic
1197934203 X:131724066-131724088 TATTGGTAGGAGAGGTGTGGTGG + Intergenic
1199652309 X:149958600-149958622 TAAGGGTGGGAGGGGTGTGAGGG - Intergenic
1200138684 X:153886694-153886716 TCCTGTTGGGAGGGGTGCGGGGG + Intronic
1201319327 Y:12680804-12680826 TACCTGTGGGAGGAGGGTAGAGG + Intergenic
1201518557 Y:14846329-14846351 TACTAGTGGGTGGTGTGTTGTGG + Intergenic