ID: 1147746440

View in Genome Browser
Species Human (GRCh38)
Location 17:42697643-42697665
Sequence GTTCGGAAGTGGGTCTTGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147746440_1147746452 24 Left 1147746440 17:42697643-42697665 CCCCTCAAGACCCACTTCCGAAC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1147746452 17:42697690-42697712 AGCTGAGGCCCTTCGAGTTCAGG 0: 1
1: 0
2: 0
3: 10
4: 98
1147746440_1147746453 25 Left 1147746440 17:42697643-42697665 CCCCTCAAGACCCACTTCCGAAC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1147746453 17:42697691-42697713 GCTGAGGCCCTTCGAGTTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 110
1147746440_1147746451 9 Left 1147746440 17:42697643-42697665 CCCCTCAAGACCCACTTCCGAAC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1147746451 17:42697675-42697697 CATGACTGCTGAGCTAGCTGAGG 0: 1
1: 0
2: 1
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147746440 Original CRISPR GTTCGGAAGTGGGTCTTGAG GGG (reversed) Exonic
902342716 1:15794547-15794569 TTTCTGAAGTGGGTCTGTAGTGG - Intergenic
902672635 1:17985331-17985353 GTTTGGATGTGGGTCTTGCCTGG + Intergenic
903818786 1:26084992-26085014 ATGCAGAAGAGGGTCTTGAGGGG - Intergenic
913325782 1:117627394-117627416 GTTAGGAAGTTGCTTTTGAGTGG - Exonic
913649193 1:120894339-120894361 ATTTGGCAGTGGGTCTTCAGGGG + Intergenic
916549567 1:165837120-165837142 GTTGGGAAGTGGGGCCTGATGGG - Intronic
920350746 1:205336468-205336490 GGGCGGAAGGGTGTCTTGAGGGG - Exonic
922334732 1:224609457-224609479 GTTTGGATGGGGGTGTTGAGAGG + Intronic
922703266 1:227774668-227774690 GCTGGGAAGTGGGTTTTGTGGGG + Intronic
1067777367 10:49173305-49173327 CTTCGGTAGTGGGTCCTGAGAGG + Intronic
1071131967 10:82404998-82405020 GTTAGGAGCTGGGTCTAGAGTGG + Intronic
1074081189 10:110169415-110169437 ATTAGGAAGTGGGGCTTCAGAGG - Intergenic
1074597812 10:114883412-114883434 GTTGGGGAGTGGGTTGTGAGGGG - Intronic
1074948015 10:118299963-118299985 GATTGGAAGTGGGTCTTGTGTGG + Exonic
1080609869 11:33894499-33894521 GTTCGGAAAGGCCTCTTGAGGGG + Intergenic
1083028674 11:59572328-59572350 GCTAGGATGTGGATCTTGAGGGG - Intergenic
1084270976 11:68029012-68029034 GTTCAAAAGTGGGACTTGGGAGG - Exonic
1084955728 11:72690365-72690387 CTGCAGAAGTGGGTCTTGGGAGG + Intronic
1085831371 11:79904851-79904873 GTTAGGAAGGGGGTGTGGAGTGG + Intergenic
1093126191 12:15331077-15331099 GGCCGGAAGGGGGTCTTGAGAGG + Intronic
1100849704 12:98696463-98696485 GTTGGGAAGTAGGGCTTGATAGG - Intronic
1104061884 12:125275592-125275614 ATTCTGAAGTGGGTTTTGAAAGG + Intronic
1106692151 13:32129870-32129892 GTTGGCAAGTGGGGCGTGAGGGG - Intronic
1112338964 13:98537145-98537167 CTTCAGAGGTAGGTCTTGAGGGG - Intronic
1114539485 14:23444026-23444048 GCTTGGAGGTGGGTCTTGAGAGG + Intergenic
1117588623 14:57241430-57241452 TTTCTGAAGTGGGTATTAAGGGG - Intronic
1119164976 14:72485012-72485034 GCTTTGAACTGGGTCTTGAGTGG - Intronic
1121514040 14:94537180-94537202 GTTCATAAATGGGTCTTGACAGG + Intergenic
1124910073 15:33911128-33911150 GTGCTGGAGTTGGTCTTGAGAGG - Intronic
1129983732 15:79897375-79897397 GTTCAGTAGTGGGACTTCAGGGG + Intronic
1131361697 15:91797726-91797748 GTTTGGAAGTGGGTCCTAATGGG - Intergenic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1143808012 17:9445697-9445719 GTTTGGAAGTGGGTCTTTTATGG - Intronic
1147746440 17:42697643-42697665 GTTCGGAAGTGGGTCTTGAGGGG - Exonic
1147847702 17:43416658-43416680 GTTCTGACTTGGGTGTTGAGTGG - Intergenic
1148646016 17:49219987-49220009 GGTGGGAAGTGGCTTTTGAGAGG + Intronic
1153183915 18:2466180-2466202 GTGGGGATGTGGGTCTTGTGTGG - Intergenic
1153183926 18:2466229-2466251 GTGGGGAAGTGGGCCTTGTGTGG - Intergenic
1155833848 18:30553524-30553546 GTTGGGAGGTGGGTCTGGGGTGG - Intergenic
1156454775 18:37286806-37286828 GGTTGGGAGTGGGTCTTCAGAGG + Intronic
1162125869 19:8499261-8499283 GTTCGGAGGGGGGTCTGGCGGGG + Exonic
1162147897 19:8624481-8624503 GTTGGGAAGTGGGGCCTAAGGGG + Intergenic
1163847593 19:19646325-19646347 TCTCGGGAGAGGGTCTTGAGGGG + Exonic
1167126041 19:47549370-47549392 GTCCAGAAGTGGGTTTTGAGGGG + Exonic
924992066 2:320755-320777 TCTCGGAAGTGGCTCTGGAGAGG + Intergenic
933158621 2:79000537-79000559 GGTGGGAAGTGGGTAGTGAGAGG - Intergenic
933167127 2:79088443-79088465 CTTCTGAAGTAGGTCTTGAGAGG - Intergenic
1172769929 20:37376017-37376039 GTTTGGAGGTGGGCCTTGGGAGG - Intronic
1175551998 20:59823258-59823280 ATTCAGAAGTGGGTCTTTATAGG + Intronic
1178983906 21:37287051-37287073 GTTGGGAGGTGGGGCTTGATGGG + Intergenic
1181566425 22:23741557-23741579 GTTACTAAGTGGGTCTTGATAGG - Intergenic
1183346480 22:37311106-37311128 GTTGGGAAGTGGGTTGTGCGGGG - Intronic
950687801 3:14631238-14631260 GTTCTGAAGTAGTTCTTGATGGG - Intergenic
955070887 3:55571681-55571703 GTTCAGAAGTGTTTCCTGAGTGG + Intronic
956224006 3:66935757-66935779 GTTCTGAAGTGGGTTTTATGAGG - Intergenic
958718774 3:97820654-97820676 TTTGGTAAGTGGGTCTTCAGTGG + Intergenic
964197873 3:154085397-154085419 GTTTAGAAGTGGGTATTGTGGGG + Intergenic
967073817 3:185984240-185984262 GTTAGGAAGTGCGTATTGAACGG + Intergenic
971986013 4:33825189-33825211 GTTTGGAAATGGGTAATGAGGGG + Intergenic
972249164 4:37281034-37281056 GGTGGGGAGTGGGTCTGGAGGGG + Intronic
978734190 4:112066566-112066588 GCTGGGAAGTGGGTGTTGGGAGG + Intergenic
981151908 4:141388667-141388689 ATTCAGAAGAGGGCCTTGAGGGG + Intergenic
994459138 5:100051520-100051542 GTTCAGAAGTGGGACTTCTGGGG + Intergenic
995414331 5:111891872-111891894 AGTTGGAAGTGGGGCTTGAGGGG - Intronic
997364515 5:133317425-133317447 GTCGGGAAGTGGGGCTGGAGGGG - Intronic
1004604536 6:17181703-17181725 GTCTGGAAGGGGGTCATGAGTGG - Intergenic
1013911501 6:115281154-115281176 GTTAGGAGGTGGGTCTTTGGGGG - Intergenic
1021844035 7:24746704-24746726 CTTCGGAGGTGTGTCTAGAGTGG - Intronic
1023402902 7:39803251-39803273 TTTCTGAAGTGGGTCTGTAGTGG - Intergenic
1024075159 7:45814321-45814343 GGTTGCAAGTGGGTCTGGAGAGG - Intergenic
1024646730 7:51377385-51377407 TTTCTGAAGTGGGTCTGTAGTGG + Intergenic
1025062324 7:55821163-55821185 TTTCACAAGTAGGTCTTGAGTGG - Intronic
1025177667 7:56810195-56810217 GTCTGCAAGTGGGTCTGGAGAGG + Intergenic
1025568524 7:62523012-62523034 GTTTGGAAGTGTGTATTTAGAGG + Intergenic
1025617958 7:63140619-63140641 TTTCACAAGTAGGTCTTGAGTGG - Intergenic
1029482558 7:100822192-100822214 CTTAAGAAGTGGGTCCTGAGTGG + Intronic
1030153272 7:106426967-106426989 GGTGGGAAGTGGGTCCAGAGAGG + Intergenic
1033836641 7:145321366-145321388 GTAGGGAAGAGGATCTTGAGTGG + Intergenic
1037778333 8:21850152-21850174 GTTAGGAAGTGGGGCTTGGGGGG + Intergenic
1040059651 8:43093473-43093495 GTTCGGAAGCGCGTCCTGGGCGG - Intergenic
1045140630 8:99278269-99278291 ATTAGGAAGTGAGTTTTGAGAGG + Intronic
1045298995 8:100894649-100894671 GTTCCGGAGTGGGTAGTGAGTGG - Intergenic
1060913680 9:127370883-127370905 GTTCAGCAGTGGGTCTGGACTGG - Intronic
1186426898 X:9469497-9469519 GTTGGGAATTGGGTCTGGAAAGG + Intronic
1189995262 X:46631613-46631635 GTTGGGTGGTGGGTCTTGATCGG + Exonic
1190064872 X:47232970-47232992 ATCCGGAAGTGGCTGTTGAGGGG + Exonic
1190260855 X:48795973-48795995 GTTCTGAAGGGGGTTTTTAGAGG - Intergenic
1195972998 X:110494052-110494074 GTTGGAACCTGGGTCTTGAGGGG + Intergenic
1197400959 X:125990370-125990392 GTTGGGAAGTGGGGCTTAATGGG + Intergenic
1198479863 X:137031361-137031383 GTGCAGAAGTGGCTGTTGAGGGG + Exonic
1199756428 X:150869324-150869346 GGTCGGATGTGGGTGGTGAGGGG - Intronic