ID: 1147749226

View in Genome Browser
Species Human (GRCh38)
Location 17:42718379-42718401
Sequence CCATTTCCTTCTCTTTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 486}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147749226_1147749233 -2 Left 1147749226 17:42718379-42718401 CCAGAACAAAGAGAAGGAAATGG 0: 1
1: 0
2: 4
3: 43
4: 486
Right 1147749233 17:42718400-42718422 GGTGGCTGGGGATGGAAGAGAGG 0: 1
1: 0
2: 9
3: 112
4: 975
1147749226_1147749232 -10 Left 1147749226 17:42718379-42718401 CCAGAACAAAGAGAAGGAAATGG 0: 1
1: 0
2: 4
3: 43
4: 486
Right 1147749232 17:42718392-42718414 AAGGAAATGGTGGCTGGGGATGG 0: 1
1: 1
2: 12
3: 155
4: 1250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147749226 Original CRISPR CCATTTCCTTCTCTTTGTTC TGG (reversed) Intronic
901655424 1:10766662-10766684 ACCTTTCTTTCTCTTTGTTTAGG - Intronic
902364211 1:15960527-15960549 CCTTTTCCTGGTCTTTTTTCAGG - Intronic
903269037 1:22176464-22176486 CCACGTCCTTCACTTTGCTCGGG - Intergenic
904488420 1:30843154-30843176 TCCTTCCCTCCTCTTTGTTCAGG - Intergenic
905093881 1:35452207-35452229 CCATTTCCTTTTCTTTCATCAGG - Intronic
906620842 1:47277140-47277162 CTATTTCCTTCTCATCATTCAGG - Intronic
906734397 1:48110687-48110709 CTGGTTCCTTCTCTTTGTTCAGG - Intergenic
908436623 1:64113137-64113159 TCTTTTGTTTCTCTTTGTTCTGG + Intronic
909174795 1:72343665-72343687 GCATTTCCTTCTCTTTGAAGGGG - Intergenic
910348052 1:86263608-86263630 CCATTCACTTCTCTGGGTTCAGG - Intergenic
911833114 1:102579733-102579755 CCATTTCCTTTTTTTTTTTTTGG - Intergenic
912456845 1:109803753-109803775 CTAATTCCTGCTCTTTTTTCTGG + Intergenic
912674828 1:111669151-111669173 CCATTTCTGTCTCTTTATTTTGG - Intronic
912799462 1:112712059-112712081 CCAATTCCTTTTCTTTCTTTGGG - Intronic
916847858 1:168671529-168671551 CCATCTCCTTCTGTCTTTTCTGG - Intergenic
918304373 1:183232630-183232652 CCCTTTCCTTCTTTGCGTTCAGG + Exonic
919420015 1:197358390-197358412 CCATTTCCTTTTATTTGATGAGG - Intronic
919581962 1:199387583-199387605 CAATTTCCTTGTATTTCTTCTGG - Intergenic
920018383 1:202932680-202932702 CCATTTTATTCTTTTTGCTCAGG + Intergenic
921136947 1:212269694-212269716 TCATTTCTTTCTCTTTTCTCAGG + Intergenic
921327133 1:213997474-213997496 CCATTTCCTGCTCTCTGATCAGG - Exonic
921465679 1:215484223-215484245 TCCTGTCCTGCTCTTTGTTCTGG - Intergenic
922392704 1:225162478-225162500 CCAGTTTGTTCTTTTTGTTCAGG + Intronic
923004012 1:230030732-230030754 CAATTTCCCTCTCTTAGTTGGGG - Intergenic
923113479 1:230912303-230912325 CCATTTTCTTCCCTTCGTTGCGG - Intronic
1063849622 10:10171827-10171849 CTATTTCCTTCTCCTTATTTTGG + Intergenic
1065875125 10:29991186-29991208 CCATTTCATTTTCTTAGTTATGG - Intergenic
1067287549 10:44917824-44917846 CCTATTCCTTCTCAGTGTTCAGG - Intronic
1068130663 10:52890738-52890760 CCATTCCCTTTTCTGGGTTCAGG - Intergenic
1068914097 10:62409604-62409626 CCATTTCCTTCTTGTGCTTCAGG + Intronic
1070899860 10:80019026-80019048 GCATTTTCTTCTCTGTGTTCAGG + Intergenic
1070901662 10:80035221-80035243 GCATTTTCTTCTCTGAGTTCAGG + Intergenic
1071167168 10:82820368-82820390 CCTTTTCCTTCTCTTTATATTGG + Intronic
1071677644 10:87670844-87670866 CCATTTTCTTCTCAGTGTTGAGG + Intronic
1071691701 10:87826952-87826974 CCATTTCCTCCTCATTCTACAGG + Intronic
1071971177 10:90908695-90908717 CCATTTCCTTCCCTCTCTTCAGG + Intergenic
1072153423 10:92701835-92701857 CCATTTCCCTCTCAGTTTTCTGG + Intergenic
1072459715 10:95607807-95607829 CCAGCTCCTTCTCACTGTTCAGG - Intronic
1072697850 10:97617322-97617344 ACCTATCCTTCTCTTTGTTCAGG - Exonic
1073044146 10:100626281-100626303 CCATTTCCTTCTTTTTCTCTAGG + Intergenic
1073865179 10:107794808-107794830 CCTTTTCCTCCTCTATATTCTGG + Intergenic
1074196617 10:111193038-111193060 TCATTTCCTTCTACTTGTTTTGG + Intergenic
1074412694 10:113242094-113242116 CCATTTCCAACCCTTTATTCTGG - Intergenic
1075301822 10:121331519-121331541 CTGATTCTTTCTCTTTGTTCAGG + Intergenic
1075444424 10:122503934-122503956 ACATTTCCTCGTCTGTGTTCAGG + Intronic
1075548780 10:123376795-123376817 GCATTTCCTTATCTCTGTCCAGG + Intergenic
1075966662 10:126617701-126617723 CCATGTCCTTGTCTGTGTCCTGG + Intronic
1076010649 10:126985505-126985527 CCATGTCCTGCTGTTGGTTCTGG - Intronic
1076426022 10:130368227-130368249 CCTTTTCCTTTCCTTGGTTCAGG + Intergenic
1077233797 11:1470324-1470346 CCACTTCATCCTCTTTGCTCGGG - Exonic
1077448378 11:2615467-2615489 CCATATCTTACTCTTTGTTATGG + Intronic
1077924236 11:6664356-6664378 CCATTTCCTTCTACTTTCTCTGG - Intergenic
1080173608 11:29336030-29336052 CCATTTGCCTCTCCTTATTCTGG + Intergenic
1080600358 11:33816462-33816484 CAATTCCCTCCTCTTAGTTCTGG - Intergenic
1080755628 11:35194944-35194966 GCATTTCCTTCTCTTATTACTGG - Intronic
1080799329 11:35595027-35595049 CCATCTCCTTCTCTGGCTTCTGG - Intergenic
1081211397 11:40339040-40339062 CCTTTTCCTCCTCTTTATTAAGG + Intronic
1081426627 11:42932876-42932898 GCTTTTCCTTCTCTCTGTACTGG - Intergenic
1081581373 11:44354608-44354630 TCACTTCCTCCTCTATGTTCGGG + Intergenic
1081741620 11:45444952-45444974 GCACTTCCTTCTCTCTGTCCTGG - Intergenic
1082199967 11:49354372-49354394 CCATTTCATTGTTATTGTTCCGG + Intergenic
1083735532 11:64678157-64678179 ACATTTCCTTTTCCCTGTTCTGG - Intronic
1083738100 11:64693244-64693266 CCTTTTCCTTTTTTTTTTTCCGG - Intronic
1084744740 11:71162040-71162062 GCATTTTCTGCTTTTTGTTCTGG + Intronic
1085050794 11:73379215-73379237 CTATTTCCACCTCTTTGTTGAGG - Intronic
1085053196 11:73390235-73390257 GCATTTCCTCCTCATCGTTCTGG + Intronic
1085287325 11:75372106-75372128 CCCCTTCCTTCTCTTTATTGGGG + Intergenic
1086461779 11:87013017-87013039 TCTTTTCCTTTTCTTTTTTCAGG + Intergenic
1086655703 11:89351825-89351847 CCATTTCATTGTTATTGTTCTGG - Intronic
1086950493 11:92885762-92885784 TCATTTCCTTCCTTGTGTTCAGG + Intronic
1087533376 11:99412018-99412040 CCATTTCTTTATTTTTATTCTGG - Intronic
1087911077 11:103754006-103754028 CATTTTCCTTCTCATTGTTTTGG - Intergenic
1088549311 11:110995149-110995171 ACATTTTCTTCTCTTCATTCAGG + Intergenic
1088853587 11:113725787-113725809 CCATTCTTTTCTCTTTATTCGGG + Intergenic
1089064332 11:115650990-115651012 TCATTTCCTTCTCTGCGCTCAGG + Intergenic
1089355300 11:117846828-117846850 CCCTCTCCTCCTCTTTCTTCAGG + Intronic
1091165685 11:133473836-133473858 ACATTTCCTTCTTCTTTTTCCGG - Intronic
1091913364 12:4249996-4250018 CCATTTCCTTCTCTGTAATATGG + Intergenic
1092771958 12:11904813-11904835 CCATTTCCTTCTCTAGGATTTGG + Intergenic
1093250641 12:16800075-16800097 CCATTTCTTTTTTTTTTTTCTGG + Intergenic
1094093724 12:26679439-26679461 CCATTTCCTGCTCTTGGTGATGG - Intronic
1094789912 12:33900568-33900590 TCATATTTTTCTCTTTGTTCTGG + Intergenic
1095181231 12:39148682-39148704 CCATTTTGTTCTTTTTGCTCAGG + Intergenic
1095875477 12:47075997-47076019 CCAGCTCCTTCTCTTTTCTCAGG - Exonic
1096001023 12:48130699-48130721 CCATTTCTTTCTCTGTTTTGAGG - Intronic
1096558603 12:52419551-52419573 GCATTTCCCTCACTCTGTTCAGG + Intergenic
1097053164 12:56235637-56235659 CCTCTTCCTGCTCTTTGTGCTGG + Exonic
1097126585 12:56781197-56781219 CCATTTCCCTCCCTTATTTCTGG + Intronic
1097975593 12:65683313-65683335 CCATTGCCTTCTTTTTGTTATGG + Intergenic
1098212787 12:68184215-68184237 CCATTTCCTCCTGTTTCTTTTGG + Intergenic
1098414527 12:70217809-70217831 ACATTTATTTCTCTTAGTTCTGG - Intergenic
1098596700 12:72280553-72280575 TCTTTTCCTTCTTTTTTTTCTGG - Intronic
1098613277 12:72488127-72488149 CCATTTCATTCTTTGTTTTCTGG - Intronic
1098908746 12:76188129-76188151 CCATTTCCTCCTCCTTTTCCAGG - Intergenic
1101160657 12:101971449-101971471 CAATTTTCTTCTTTTTGCTCAGG - Intronic
1101643590 12:106607099-106607121 CCATTGCCTTCTTTATGATCTGG - Intronic
1101845317 12:108358770-108358792 GAATTTCCTTGCCTTTGTTCTGG - Intergenic
1102939441 12:116926273-116926295 GCTTTTCCTTGCCTTTGTTCTGG + Intronic
1103115523 12:118326437-118326459 CAGTTTTCTTCTTTTTGTTCAGG + Intronic
1103171742 12:118826550-118826572 CCTTTTCCACCTCTTTCTTCTGG + Intergenic
1103622268 12:122194812-122194834 CCATTTCCTTCATGTTGTTATGG + Intronic
1104275846 12:127327029-127327051 TCATTACATTCTCTTTATTCGGG + Intergenic
1106250176 13:27977011-27977033 CTATTACCTTGTCTTTGTTGGGG + Intergenic
1106368817 13:29111437-29111459 GCATCTCCTCATCTTTGTTCTGG - Intronic
1106580320 13:31012418-31012440 CCATTTCCTTATTTTTGTGAAGG + Intergenic
1106815966 13:33407484-33407506 CCATTTCTTCCTATTTTTTCTGG + Intergenic
1107894326 13:44945466-44945488 CTATTTCCTCCTCTTTTTTAAGG - Intronic
1108372913 13:49788757-49788779 ACATTTCCTTTTATTTGTTCTGG - Intronic
1109606633 13:64705814-64705836 CCTTTTCCTTCTCTTAATTCTGG + Intergenic
1109762913 13:66853737-66853759 TCATTTCCTTTTTTTTTTTCAGG + Intronic
1109828630 13:67756480-67756502 CTATTTCCTTCCTTTTGTTCAGG + Intergenic
1110868951 13:80428337-80428359 CCATCTCCCACTCTTTGTTCTGG + Intergenic
1112348066 13:98609331-98609353 CCATTTTCTTCTCTTCGTTATGG - Intergenic
1112427615 13:99317885-99317907 CCATTTGCTTCTCTGTATTATGG + Intronic
1112804466 13:103148073-103148095 CCATTTCCTAATCTGTGTACAGG - Intergenic
1113407456 13:110054751-110054773 CCTTTTTCTTCTTTTTTTTCAGG + Intergenic
1113724284 13:112587154-112587176 CCATTTCTTGCTCCTTGTTTTGG - Intronic
1114997777 14:28378581-28378603 CAATTTCATTCTTTTTCTTCTGG - Intergenic
1115067295 14:29279481-29279503 CCTTTTTCTTCCCTTTGTTTGGG - Intergenic
1115398305 14:32933567-32933589 CCACTTCCTCCTCTTTCTTCCGG - Intergenic
1116354258 14:43907670-43907692 ACATTTTCTTCTCTCTGTTCTGG + Intergenic
1117321076 14:54623807-54623829 CCATTTCCTTCTAATGTTTCAGG - Intronic
1118668667 14:68099154-68099176 TCACTTCCTACTCTTTGTTGTGG + Intronic
1118685005 14:68282417-68282439 CCATTTCAATATATTTGTTCTGG + Intronic
1120144650 14:80966775-80966797 CCATTTACTTCTCACAGTTCTGG + Intronic
1120901279 14:89577725-89577747 CCATTTTCTCCTTTTTCTTCAGG + Intronic
1121303570 14:92890628-92890650 ACATTTACTTCTCATGGTTCTGG - Intergenic
1121433694 14:93905166-93905188 CCACTTCCTTTTCCTTGTCCAGG + Intergenic
1122047908 14:99036422-99036444 CCTTCTCCAGCTCTTTGTTCTGG + Intergenic
1123004211 14:105313901-105313923 CCATTGCCTCCTCTTTGCTTGGG + Exonic
1123420007 15:20123883-20123905 CCATTTCCGTCTTATAGTTCTGG - Intergenic
1123529228 15:21130419-21130441 CCATTTCCGTCTTATAGTTCTGG - Intergenic
1124225539 15:27890527-27890549 CCATTTCCTTCCCTCTCTCCTGG - Intronic
1125855093 15:42940867-42940889 CCATTGCTTTTTCTTTCTTCAGG + Intergenic
1125925463 15:43559376-43559398 CCATGTCCTTCTCCTTAATCTGG - Intronic
1125979436 15:43987087-43987109 CCATTTCCCTCCCTCTCTTCAGG + Intronic
1126351345 15:47747978-47748000 TGCTTTCCTTCCCTTTGTTCTGG + Intronic
1126431705 15:48592586-48592608 CCTTTGCCTTCTCTTTGCTTGGG - Intronic
1126693852 15:51309310-51309332 ACATTTATTTCTCATTGTTCTGG - Intronic
1127140910 15:55975828-55975850 CCATTTTGTTCTTTTTGCTCAGG - Intronic
1127408211 15:58675883-58675905 CCATTTGCTTCTTTTTGGTAAGG + Intronic
1127773073 15:62245871-62245893 CCTCTTCCTGCTCTTGGTTCAGG + Intergenic
1127773118 15:62246170-62246192 CCTCTTCCTGCTCTTCGTTCAGG + Intergenic
1127773170 15:62246488-62246510 CCTCTTCCTGCTCTTGGTTCAGG + Intergenic
1128521743 15:68379927-68379949 GCATTTCCTGCTCTCTGATCTGG + Intronic
1128792982 15:70446769-70446791 CCTTTTCCTTCTCTCAGTTCAGG + Intergenic
1128887500 15:71302378-71302400 CCATTTCCAGCTGTGTGTTCTGG - Intronic
1129186775 15:73912131-73912153 CCATTTCCTTCTCCTTGTTTGGG + Intergenic
1129697904 15:77751062-77751084 CCATCTCCCTCTCTGTGTCCAGG + Intronic
1131179774 15:90231788-90231810 CCATCTCGTTCCCTTTGTTTAGG - Intronic
1131231039 15:90659740-90659762 CTAGTTCCTTCTCATTGTTTGGG - Intergenic
1131676576 15:94676151-94676173 GCATCTCCCTCTCTTTGCTCTGG - Intergenic
1132252790 15:100346786-100346808 ACATTTATTTCTCATTGTTCTGG - Intergenic
1133626613 16:7575779-7575801 TCTTTTCTTTCTCTTTTTTCTGG - Intronic
1133911690 16:10071901-10071923 CCATTTCCTTCTCTGTGAAATGG - Intronic
1134751064 16:16625518-16625540 TCATTTCCTTCTCTTTCTTTTGG - Intergenic
1134775972 16:16853926-16853948 CCATTTACTTCTATTTATTATGG - Intergenic
1134994392 16:18728073-18728095 TCATTTCCTTCTCTTTCTTTTGG + Intergenic
1135736267 16:24934159-24934181 CCATTTTTTTTTCTTTTTTCGGG + Intronic
1135763952 16:25160799-25160821 CCATTTTCTTTTCTCTATTCAGG + Intronic
1135860772 16:26053986-26054008 CCTTTTCCTTGTCTTTGTGGTGG - Intronic
1135961860 16:27001610-27001632 CCATTTATTTCTCCTGGTTCTGG + Intergenic
1135972228 16:27080858-27080880 CCTTTTCCTTCTCTCTCTTCAGG + Intergenic
1135983245 16:27165085-27165107 CCATTTCTCTCTCTTTTTTTGGG - Intergenic
1136988418 16:35135712-35135734 ATACTTACTTCTCTTTGTTCTGG + Intergenic
1137236058 16:46619387-46619409 CCATTTCTTTGTCCCTGTTCAGG + Intronic
1138050814 16:53775387-53775409 CCATTGCTGTCTCCTTGTTCAGG + Intronic
1140127868 16:72132901-72132923 CCAGCTCCTTCTCCTTTTTCAGG + Exonic
1140878734 16:79177825-79177847 CCATTTTCCTTACTTTGTTCAGG + Intronic
1141586992 16:85040659-85040681 TCATTCCCTTCTCTCTGTTCAGG + Intronic
1141640050 16:85335704-85335726 TCTTTTCCTTCTCTTTCTCCCGG - Intergenic
1144535425 17:16084354-16084376 CATCTTCCTTCTCTTTGTCCTGG - Intronic
1144802566 17:17940576-17940598 CTTATTCCTGCTCTTTGTTCAGG - Intronic
1145989236 17:29068692-29068714 CCATTCCCTGCTATTTGATCTGG - Intergenic
1146690503 17:34871783-34871805 GCAATTTCTCCTCTTTGTTCTGG - Intergenic
1146772354 17:35580535-35580557 CCTTTTTCTTTTCTTTTTTCTGG - Intronic
1147117916 17:38316103-38316125 CCATTTCTTTCTTCTTTTTCTGG + Intronic
1147526997 17:41234807-41234829 CCATTTCCTTTTTATTTTTCTGG - Intronic
1147528119 17:41246486-41246508 CCATTTCCTTTTTATTTTTCTGG - Intronic
1147531010 17:41277363-41277385 CCATTTCCTTTTTATTGTTGTGG - Intergenic
1147749226 17:42718379-42718401 CCATTTCCTTCTCTTTGTTCTGG - Intronic
1148519973 17:48264125-48264147 CCATTTCCATGTTTTTGTTTTGG - Intronic
1148565292 17:48629079-48629101 CCAGTTCATTCTCTTTCCTCTGG - Intronic
1148800803 17:50224434-50224456 ACATTTACTTCTCATTGTTCTGG + Intergenic
1150326346 17:64261723-64261745 TCATTTCTTTCTTTTTTTTCTGG - Intronic
1151181503 17:72332337-72332359 GAATTTCTTCCTCTTTGTTCTGG - Intergenic
1151462750 17:74264458-74264480 CTTTTTCCTTCTTTTTCTTCTGG + Intergenic
1151656349 17:75498001-75498023 CCACTACCTCCTCTTTGATCTGG - Intronic
1152984207 18:307332-307354 CCATTTGCTTCTGTTTCTTTGGG + Intergenic
1153145577 18:2027912-2027934 CAATTTCCTTCCCTTTTTTGTGG - Intergenic
1153536379 18:6106590-6106612 CTATTTTCTTCTCTTTTCTCAGG - Intronic
1153695881 18:7641087-7641109 GCTTTTCTTTCTCTTTGTCCCGG + Intronic
1155031946 18:21992331-21992353 CCATTTCCCTCTTTGTGGTCTGG - Intergenic
1155402981 18:25459005-25459027 TAATTTCTTTTTCTTTGTTCTGG + Intergenic
1155472783 18:26208337-26208359 CCACTCCCTTCTTTTTCTTCAGG - Intergenic
1155661804 18:28258140-28258162 CCATTGCCTTTTACTTGTTCTGG - Intergenic
1156110634 18:33722110-33722132 CCATTTCTCTCCCTTTCTTCAGG + Intronic
1156161898 18:34369659-34369681 CCATTTCCTTTTCTAGTTTCTGG - Intergenic
1156233403 18:35177558-35177580 TAAATTCCTTCTCATTGTTCAGG - Intergenic
1156303380 18:35854681-35854703 CCATTTTTATCTCTTTCTTCAGG + Intergenic
1156867673 18:41907013-41907035 CCATCTGTTTCTCTTTGGTCAGG + Intergenic
1157397784 18:47357109-47357131 ACATTTACTTCTCACTGTTCTGG + Intergenic
1157618138 18:48999768-48999790 GGATTTCCTTCTCTTTTTTAAGG + Intergenic
1158445842 18:57519776-57519798 CCATTTCCATCCCTATGTTTTGG + Intergenic
1158842781 18:61406001-61406023 TCATCTCCTGCTCTTTATTCAGG + Intronic
1160117397 18:76093579-76093601 CCATTTCATTCTCTTTCCTGGGG - Intergenic
1162475869 19:10899002-10899024 CCGTGTTCCTCTCTTTGTTCAGG - Intronic
1162532842 19:11245763-11245785 CCCCTTCCTTCTCCTTGTTGGGG - Intronic
1163230450 19:15998334-15998356 GCATGTCCTCCTCATTGTTCTGG + Intergenic
1163453477 19:17392674-17392696 CCAGTCCCTTCTCTTGGTCCAGG + Intergenic
1164567658 19:29339469-29339491 CCTCTTCCTTCTCTTGGTTGAGG - Intergenic
1165864126 19:38925691-38925713 TCCTTTCCTTCTCTCTGTACCGG - Intronic
1166029413 19:40115633-40115655 CCATTTCCTTCTTTTTGTTTTGG + Intergenic
1167280979 19:48568412-48568434 CCAGCTCCTTCTCTGTCTTCAGG - Intronic
1167904597 19:52648435-52648457 TTTTTTCCTTCACTTTGTTCTGG - Intronic
1168726491 19:58585485-58585507 CCAATGCCTTCTCTTTTTTTTGG - Intergenic
925032672 2:662927-662949 ACATTTCCTTTTCTCTATTCTGG + Intergenic
925654730 2:6133972-6133994 CCATTTATTTCTCATGGTTCTGG - Intergenic
925887260 2:8403703-8403725 CCCTTTCCTTTTCTTTCTTAAGG + Intergenic
926027481 2:9557374-9557396 CCATTTTCTTTTCTTTTTTTTGG + Intergenic
926276983 2:11411448-11411470 CCTTTTCCTTCTCACTATTCTGG + Intergenic
926441654 2:12895392-12895414 ACATTTACTTCTCATGGTTCTGG - Intergenic
927308723 2:21603869-21603891 CTAATTCCTTCTCTTCTTTCTGG + Intergenic
927383937 2:22511326-22511348 CCATTCCTTTCTCTTAGTTTCGG + Intergenic
928400628 2:30976137-30976159 ACATCTCCCACTCTTTGTTCTGG + Intronic
930495880 2:52142896-52142918 CCATTTCTTTCTCAGTGTTTTGG - Intergenic
930718562 2:54616508-54616530 CAGTTTCCTTCTCTTTATTAAGG + Intronic
930733472 2:54750955-54750977 ACATTTCTTTCCCTTTCTTCTGG - Intronic
931700591 2:64905772-64905794 CCACTGCCTTCTCTTAGTGCAGG - Intergenic
931893125 2:66697396-66697418 TAATTTCCTTGTTTTTGTTCTGG - Intergenic
932279001 2:70473298-70473320 CCATTTACTTCTCTAAGCTCTGG - Intronic
933012677 2:77088106-77088128 CTCTTTTCTCCTCTTTGTTCAGG - Intronic
933207049 2:79518823-79518845 CCACTTCATTCTGTTTCTTCAGG + Intronic
933223973 2:79724199-79724221 CCATTTTCTTCTTTTGGCTCTGG + Intronic
933343397 2:81050913-81050935 CCATTTCCTTCTCTCTTCCCTGG + Intergenic
934755764 2:96823588-96823610 CCATTTCCAGCTTTTTGTCCAGG + Intronic
935111281 2:100096497-100096519 GCATTTCCTTCTCCCTGTTTTGG - Intronic
935222899 2:101029861-101029883 CAAATTCCATCTCTTTGTTCTGG - Intronic
935857365 2:107289537-107289559 CCATTTTCTTCTTTTTGCTTTGG - Intergenic
936123688 2:109768667-109768689 GCATTTCCTTCTCCCTGTTTTGG + Intergenic
936220998 2:110602799-110602821 GCATTTCCTTCTCCCTGTTTTGG - Intergenic
936595728 2:113845714-113845736 CCATTCCCTTTTCTTTTTGCTGG - Intergenic
936667166 2:114610003-114610025 ACATTGCCTTTTCTCTGTTCTGG - Intronic
936778325 2:116001244-116001266 CCATTCCCTTCATTTTTTTCTGG - Intergenic
936780248 2:116023897-116023919 CCATTTCAATCTCTTGGCTCTGG + Intergenic
936833893 2:116683593-116683615 ACATTCCCTTCTCTTTGTCTTGG + Intergenic
937394557 2:121523719-121523741 GCATTTCCTTCACTTTCCTCTGG + Intronic
938062170 2:128262531-128262553 CCATTTCCTTCTCTGTGAAATGG - Intronic
938194255 2:129312845-129312867 CCATTTGCTTCTTTTTTTTCTGG - Intergenic
938229537 2:129646550-129646572 CCATTATCTTCTTTTTCTTCTGG + Intergenic
939552023 2:143627127-143627149 AAATTTCCTTCTCACTGTTCTGG - Intronic
940346740 2:152636679-152636701 CCATTTCCCTCTGTTTGTGGAGG + Intronic
940826544 2:158418564-158418586 CTAGTTCCTTCTCATAGTTCAGG + Intronic
942677333 2:178441704-178441726 CCATTTCTTTTTCTTTGTTCAGG - Exonic
943081875 2:183265891-183265913 CCATTTCCTTCTCCTTTCCCTGG + Intergenic
943513513 2:188856102-188856124 CCTTCTCCTTCTGTTTCTTCAGG - Intergenic
943785285 2:191870986-191871008 CCAGTTCCATCTCTGTTTTCAGG - Intergenic
944341081 2:198600362-198600384 CCCTTTCCATCACTTAGTTCTGG + Intergenic
944346890 2:198678510-198678532 CCATTTCCTTCTCTCAATTTGGG - Intergenic
944400839 2:199324329-199324351 CCATTTACTTATTTTTTTTCTGG - Intronic
944758865 2:202792366-202792388 TCATGTACTTCTCTTTGTGCAGG - Intronic
945027950 2:205637190-205637212 ACAGTTCCTTCTCTTAGTTCTGG - Intergenic
945463033 2:210133573-210133595 CCTTTTCCTTCTATTTGCTTTGG + Intronic
945626561 2:212214610-212214632 CCAGTTCTTGCTCTATGTTCTGG - Intronic
945940762 2:215947233-215947255 CCATCTCCTTCTCTTCTTTTAGG - Intronic
946299569 2:218814407-218814429 CAATTTCCTTTTCTATGATCCGG - Exonic
948011573 2:234653250-234653272 CCATGTCCTTCTCCTTTTTTAGG - Intergenic
948129264 2:235588335-235588357 CCCTAGCCTTCCCTTTGTTCTGG - Intronic
948445263 2:238027729-238027751 GCTTTTCCTTCCCTTTATTCGGG - Intronic
948493444 2:238329237-238329259 CCCTGTCCTTCCCTTTGTCCCGG - Exonic
948710418 2:239821765-239821787 CCAGTATCTTCTCTTTGTCCTGG - Intergenic
948947924 2:241230677-241230699 CCATGCCCTGCTCTTTCTTCTGG + Intronic
1169274566 20:4224810-4224832 CCATTCCCCTCTCTTTGACCTGG + Intronic
1169510316 20:6256758-6256780 CCTTTTTCTTCTCTGAGTTCTGG + Intergenic
1170009467 20:11705769-11705791 CCATTTCCCTCTCCTCATTCTGG - Intergenic
1170121159 20:12913765-12913787 TTTTTTCCTTCTCTTTCTTCAGG - Intergenic
1170196552 20:13694849-13694871 GCCTTGCCTTCTCTTTCTTCTGG + Intergenic
1170561970 20:17566510-17566532 CAATTTACTTCTCATAGTTCTGG + Intronic
1171015819 20:21540897-21540919 CCATTTCCTGGTCATTGTTTTGG - Intergenic
1172087204 20:32395680-32395702 TCATTTGATTCTCTTTGTTTTGG + Intronic
1173002142 20:39112047-39112069 CCCTTTCCTTCTCCTTGCTCTGG + Intergenic
1173468233 20:43301461-43301483 CCCTTCCCTTCTCTGTGTCCTGG - Intergenic
1173866290 20:46314420-46314442 CCATTTCATTCATGTTGTTCTGG + Intergenic
1173969388 20:47139996-47140018 ACTTTTCCTTCTCTGTGTGCTGG + Intronic
1175056028 20:56199059-56199081 CCAAGTCCTTTTCTTTTTTCTGG - Intergenic
1175533810 20:59693292-59693314 CCCTTCTCTTCTCTTTGTTCTGG + Intronic
1177017161 21:15806403-15806425 CTTTTTCCTTGTCTTTTTTCTGG + Intronic
1177216018 21:18130041-18130063 CCTATTCCTTCTCCTTGCTCCGG - Intronic
1178400084 21:32278359-32278381 CCATTTGTTTCTCTTTTTTTAGG + Intronic
1178571696 21:33743465-33743487 CCATTTCCTTTTATTTATTTAGG - Intronic
1178684988 21:34703569-34703591 TTAATTCCTTCTTTTTGTTCAGG - Intronic
1179244666 21:39621597-39621619 CTATTTCCTTTTGTTTATTCAGG + Intronic
1180231424 21:46429024-46429046 CCATTCCCTGCTCTTAGTTTTGG + Intronic
1180718087 22:17885943-17885965 CCATGTACTTCACTTTGTTCTGG + Exonic
1180782923 22:18530875-18530897 CCCTTTCCTTCTGTTTATTTGGG + Intergenic
1181006961 22:20018084-20018106 CCATTTCATTTTCTTTGTCCTGG - Intronic
1181090486 22:20469193-20469215 CCATTTCCTTCCCTTTTGCCTGG - Intronic
1181239821 22:21470237-21470259 CCCTTTCCTTCTGTTTATTTGGG + Intergenic
1181256366 22:21565414-21565436 CCCTTTCCTTCTCTCCTTTCAGG + Intronic
1181493433 22:23274937-23274959 CCACCTCCTTCTCTTTCTTCTGG + Intronic
1181518351 22:23430947-23430969 CCATCCCCTTCACTGTGTTCAGG + Intergenic
1182965123 22:34514147-34514169 CCATTTCTTTCTCTCCGTTCTGG - Intergenic
1184981131 22:48096777-48096799 TCATTTGCTTTTATTTGTTCAGG + Intergenic
949090915 3:27872-27894 CCATCACCTTCTCTTTTTGCAGG + Intergenic
949272588 3:2236909-2236931 CCATTTCATACCCTTTCTTCTGG - Intronic
949388621 3:3534719-3534741 CAATTCCCTTCTTTTTCTTCTGG - Intergenic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950834363 3:15905081-15905103 CCATTTCCTTCTCTGTAAACTGG - Intergenic
950865201 3:16183173-16183195 CCATCCCCTTCTCTTTGTGCAGG - Intronic
951118027 3:18888169-18888191 CAATTTTCTTCTCTGTGTTAAGG - Intergenic
951512133 3:23514176-23514198 TCAATACCTTCTCATTGTTCAGG + Intronic
952230311 3:31422843-31422865 CCATTTACATCTCATTGATCAGG - Intergenic
952597010 3:35029687-35029709 CCATCTCCTTCTCTCTGGCCTGG + Intergenic
955017889 3:55089624-55089646 TCATATCCTTCTCTTTGTCTTGG + Intergenic
955319933 3:57967081-57967103 CCAGCTCCTTCTCATTGTTTAGG + Intergenic
955523345 3:59796236-59796258 GCATTTCATTCTCATTGTACTGG - Intronic
956426417 3:69140274-69140296 CTCTTTCCTTCTTTTTGTTGGGG + Intergenic
956784925 3:72634643-72634665 GGATTTCCTTCAGTTTGTTCTGG - Intergenic
957031235 3:75244085-75244107 CCATCACCTTCTCTTTTTGCAGG + Intergenic
957046477 3:75378902-75378924 CCTTTTCCTATTCTGTGTTCTGG + Intergenic
958462477 3:94417075-94417097 GCATTCCCTTCTCTTTGTCTGGG + Intergenic
959607241 3:108255285-108255307 ACATTTCTTTCTCATAGTTCTGG + Intergenic
960136408 3:114110140-114110162 CCTTTCCTTTCTCTTTGTTTGGG + Intergenic
960267324 3:115635167-115635189 CAATTTCCTTCTCTTTTATTAGG - Intronic
961813153 3:129533261-129533283 CAATTTCCTTCTCTGTGCTTTGG + Intronic
961850714 3:129815302-129815324 CCATTTTGTTCTTTTTGCTCAGG - Intronic
962352294 3:134664944-134664966 CCATTTCCTTCTCTTCTTCCTGG - Intronic
963249540 3:143090334-143090356 CCCTTTCCTTCTCTATATTTGGG + Intergenic
964055960 3:152457927-152457949 CCATTCCCTTTTCTTTCTTTTGG - Intronic
964168108 3:153733949-153733971 CCCTTTCCTTGACTTTGTTTTGG - Intergenic
964450504 3:156808182-156808204 CCCTTCCCTTCTCTTTTTTTTGG - Intergenic
965013799 3:163130387-163130409 CCATTTATTTATCTTTGTTTTGG - Intergenic
965578552 3:170243798-170243820 CCAGCTACTTCTCTTAGTTCTGG + Intronic
965815233 3:172629341-172629363 CCATGTTCTTCTCTTTTTGCGGG - Intergenic
966374659 3:179283837-179283859 CCATTTTGTTCTTTTTGCTCAGG - Intergenic
967079669 3:186037826-186037848 CCACCTCCTTCTCTTTCATCAGG + Intergenic
967264490 3:187678323-187678345 CCTTTTCCTTCTCTTGGCTTTGG - Intergenic
967744046 3:193034972-193034994 CCATTTCCTTCTCTTAGGAGAGG + Intergenic
968855999 4:3122460-3122482 ACATTTCCTGCTCATGGTTCTGG - Intronic
970502421 4:16691527-16691549 CCATCTCCTTCTCTCTGTCCTGG - Intronic
970847606 4:20560643-20560665 CCCTTTATTTCTCTTGGTTCAGG + Intronic
970852968 4:20623805-20623827 CCCTTTCTTTCTCTCTATTCTGG - Intergenic
971634055 4:29033845-29033867 CCATTTCCTTTTCCTTTTCCAGG - Intergenic
971981333 4:33754824-33754846 CAATTTCCTTATCTTTATTATGG + Intergenic
972195621 4:36650195-36650217 ACAGTTCCTTCTCTTGGTCCTGG - Intergenic
972299380 4:37770811-37770833 CTATTTCTTTCTCTTTTTTAGGG + Intergenic
972552432 4:40146805-40146827 TCATTTCCTCCTCTCTATTCTGG + Intronic
973542544 4:51948762-51948784 CCATTTCTTTTTTTTTTTTCAGG + Intergenic
973584810 4:52379006-52379028 CCTTTTCATTCTCTTTTCTCTGG - Intergenic
973705822 4:53579321-53579343 CCCTTTCCTTCTTTCTGATCTGG + Intronic
973793398 4:54398962-54398984 CTATTTCCTTGTCTGTCTTCAGG - Intergenic
973926802 4:55747290-55747312 ACATTTTCTTCTCTTGCTTCTGG - Intergenic
974237599 4:59201821-59201843 CCATTTCCTTGTCTCTGCACTGG + Intergenic
974714096 4:65643979-65644001 CAATTTCCTTGTCTTGGTTAAGG - Intronic
975609198 4:76187344-76187366 CCATTTGCTTATCTGGGTTCTGG - Intronic
975661849 4:76696471-76696493 CCAGTACCTTCTCTTTGTCGTGG + Intronic
976042341 4:80902199-80902221 CCCTTTCCTTCTCTGGGTCCAGG + Intronic
977450429 4:97189404-97189426 CCATTTCACTGTCTTTGCTCAGG + Intronic
977901006 4:102422396-102422418 CACTTTCCGTCTCTTTGCTCAGG + Intronic
978625754 4:110683627-110683649 CCACTCCCTTCTCTGAGTTCTGG + Intergenic
978636359 4:110811806-110811828 CCATTTCCTTCTCATCCTTCAGG + Intergenic
979132158 4:117060623-117060645 ACTTTTCGTTCTTTTTGTTCTGG - Intergenic
979212912 4:118127634-118127656 CAATTTTGTTCTTTTTGTTCAGG + Intronic
981156946 4:141449178-141449200 TTATTTTCTTTTCTTTGTTCCGG - Intergenic
981690036 4:147498250-147498272 ACTTTTCCTGCTTTTTGTTCTGG + Intronic
981834288 4:149037188-149037210 CCTCTTCCTTCTCTATGCTCTGG + Intergenic
982382130 4:154760491-154760513 ACATTTATTTCTCATTGTTCTGG - Intergenic
982713637 4:158783873-158783895 CCATTGCTTTCTCTTTCTTGGGG + Intronic
982933090 4:161434101-161434123 CAGTTTTGTTCTCTTTGTTCAGG - Intronic
984373931 4:178902317-178902339 CTATTTCCTTCTGTGTGTTGGGG - Intergenic
986374168 5:7113502-7113524 GCATTTCCTTCTTTTTTTTAAGG + Intergenic
986755535 5:10832574-10832596 ACATTTCTTTCTCATAGTTCTGG + Intergenic
986896166 5:12372073-12372095 ACATTTACTTCTCATAGTTCTGG + Intergenic
986967318 5:13289743-13289765 CCATTTGTTTCTTTTTGGTCGGG - Intergenic
987692124 5:21280913-21280935 CTTTTTCCTTCTCTTTTTTAAGG - Intergenic
990665841 5:58070290-58070312 CCTTTTCTTTCCCTTTCTTCAGG - Intergenic
991393099 5:66170735-66170757 CCTTTTCCTTGTCTTTTTCCCGG - Exonic
991497229 5:67238349-67238371 CCTTTGCCTTCTCCTTGTCCTGG - Intergenic
991644647 5:68789531-68789553 TCATTTCCTTCTGTTCTTTCTGG + Intergenic
992457218 5:76926922-76926944 CAATTTCCTTCTTTTTCATCTGG + Intergenic
993277214 5:85875783-85875805 CTAGTTCCTACTCTTTGTTTGGG - Intergenic
993642989 5:90428364-90428386 CCAACTCTTTCTCTTTCTTCTGG - Intergenic
994015901 5:94965234-94965256 CCATTTTTTTCTCTTTCTGCTGG + Intronic
994585276 5:101700599-101700621 GTATTTCCTTTTATTTGTTCTGG + Intergenic
994615638 5:102100762-102100784 ACATTTACTTCTCATGGTTCTGG + Intergenic
994807030 5:104461283-104461305 CAATTTTGTTCGCTTTGTTCAGG + Intergenic
995050059 5:107693207-107693229 CCATTTTGTTCTTTTTGCTCAGG - Intergenic
995071957 5:107933365-107933387 CTATTTACTTATCTTTGTTTTGG + Intronic
995188817 5:109299032-109299054 CCATTTCCTTAGCTTTTTCCAGG + Intergenic
996556265 5:124782172-124782194 CCATTTCTTTCTCTGTGAACGGG + Intergenic
996789246 5:127274903-127274925 CCATATCCCTCTCATTTTTCTGG + Intergenic
996805288 5:127447535-127447557 CCATTTCCTTCCCTTCTTGCAGG + Exonic
997705075 5:135942739-135942761 CCATTCCCTGCTCTTAGGTCAGG + Intronic
997973506 5:138424188-138424210 CCATCTCCTTCACTTCCTTCTGG - Exonic
998432571 5:142078819-142078841 CCATTTCCTTCTCTGTGATATGG + Intergenic
999286669 5:150398430-150398452 CCTTTTTCTTCTTTTTCTTCTGG - Exonic
999408343 5:151326711-151326733 CCTTCTCCTACTCCTTGTTCAGG + Intronic
999589961 5:153134043-153134065 AAATTTACTTCTCATTGTTCTGG - Intergenic
999905973 5:156141716-156141738 CCATTTACTTCACTATGCTCTGG - Intronic
1000924592 5:167178396-167178418 TCACTTCCTTCACCTTGTTCTGG - Intergenic
1001003281 5:168027946-168027968 CCATTTTTTTCTCTTCTTTCTGG - Intronic
1001492870 5:172168117-172168139 CTATTTCCCTGTCTTTATTCTGG + Intronic
1001647962 5:173296241-173296263 CCATTTCCTTGTCTGATTTCTGG + Intergenic
1002598298 5:180338600-180338622 CCATTTTTTTCTCTTTGAACAGG - Exonic
1003378441 6:5601129-5601151 ACATTTACTTCTCACTGTTCTGG - Intronic
1003442593 6:6157933-6157955 TCATTTCCATCTCTCTCTTCAGG - Intronic
1003673806 6:8184268-8184290 CAATTTCTTACTCTATGTTCAGG + Intergenic
1003850699 6:10219447-10219469 TAATTTCCTTCTCTTTGATTGGG - Intergenic
1004548737 6:16626064-16626086 CCAGTTCCTTCCTTTTTTTCAGG - Intronic
1005706517 6:28459975-28459997 CTCCTTCCTTCTCTTTATTCAGG - Intergenic
1007916638 6:45567532-45567554 ACATTTCCTCCTCTTGGTCCAGG + Intronic
1009381483 6:63035871-63035893 CCATTTCTTCCCCTTGGTTCTGG + Intergenic
1009482080 6:64171775-64171797 CCATTTCCTTCTCCGTGTGTTGG + Intronic
1009540840 6:64956142-64956164 CCATTTCATTCTTTTTGCTTAGG - Intronic
1009614240 6:65984634-65984656 CCTTTTCTTTCTATTTGTTTAGG + Intergenic
1010280698 6:74019550-74019572 CCATTTTGTTCTTTTTGCTCAGG - Intergenic
1010559869 6:77335274-77335296 CAGTTTCGTTCTCTTTGCTCAGG + Intergenic
1010846798 6:80719804-80719826 CTCTTTCCATCTCTTAGTTCTGG - Intergenic
1010881054 6:81172457-81172479 GCATTTCCTTCTCTGTGCTCAGG + Intergenic
1011204028 6:84872269-84872291 CCATTTCCTTCTCGTTCTTGTGG - Intergenic
1012125806 6:95426865-95426887 ACATTTCCTTTTCTTTCATCAGG + Intergenic
1012541259 6:100364662-100364684 CTATTTTCTCCTCTTTTTTCTGG - Intergenic
1016295557 6:142569890-142569912 CCATTTCCTTCTCTCTGAAGTGG + Intergenic
1017634361 6:156429384-156429406 CAATTTCCATCTTTTTCTTCAGG + Intergenic
1018326373 6:162674342-162674364 TCATTTCCTCCTCTTACTTCAGG - Intronic
1019607466 7:1917363-1917385 CCATGTCCTTATCTCTGGTCAGG - Intronic
1019850990 7:3557074-3557096 CTCTTTCCTTCTGCTTGTTCTGG - Intronic
1020028202 7:4914523-4914545 CCAGCTCCCTCTCTTTGTTGGGG - Intronic
1020338111 7:7080178-7080200 CCATTTCCTTCTCTATGATCAGG - Intergenic
1020591106 7:10138308-10138330 ACATTTATTTCTCTTGGTTCTGG - Intergenic
1020833233 7:13116639-13116661 CATTTTCCATCTCTTTCTTCAGG + Intergenic
1021124222 7:16832026-16832048 CAATTTTGTTCTCTTTGCTCAGG - Intronic
1021190039 7:17609735-17609757 GCATTTTTTTCTCTTTTTTCTGG + Intergenic
1021570084 7:22056223-22056245 CCATTTCCTCCTCTTTTTTTTGG - Intergenic
1022620645 7:31980658-31980680 CAAATTTCTTCTCTTAGTTCTGG + Intronic
1022677289 7:32511813-32511835 CCATTTCTTTCTGTTCCTTCTGG - Intronic
1022687400 7:32609520-32609542 CCATTTCCTTTATTTTATTCAGG - Intergenic
1024029940 7:45451606-45451628 CAATTTCCTTTTCCTTTTTCTGG - Intergenic
1024198222 7:47081042-47081064 CCATCTCCATCTGTTTGGTCTGG + Intergenic
1024382630 7:48716277-48716299 TCATGTCTTTCTCTTTTTTCTGG + Intergenic
1026129308 7:67606953-67606975 CCACCTCCTTCTCTCTTTTCTGG - Intergenic
1026158599 7:67849358-67849380 CCATTTCCTTTTCTTCTTGCAGG + Intergenic
1026358388 7:69580056-69580078 CAATTTCCTTCTCTCTGTATGGG - Intergenic
1026552891 7:71382757-71382779 CCAATTCCTTCTCTTTCTCTAGG - Intronic
1027926747 7:84474961-84474983 CTATTTCCTTCTCTTTTCTTAGG - Intronic
1028157672 7:87449966-87449988 ACCTTTCCAGCTCTTTGTTCTGG + Exonic
1028486684 7:91366303-91366325 CCTTTGCCTTCTGTATGTTCAGG + Intergenic
1029299804 7:99571666-99571688 CCATTTCCTTCTCTATGAGCAGG + Exonic
1029451954 7:100646450-100646472 CCATGTCCTTCCTTCTGTTCTGG - Intronic
1029793004 7:102864862-102864884 CCATTTCCTTCTCTTTAAAATGG - Intronic
1031411961 7:121450013-121450035 CAATTGCCTTCACTTTGTTGTGG - Intergenic
1031654572 7:124337968-124337990 CCATTCCATTCTCTTTTTTTCGG - Intergenic
1031851567 7:126870590-126870612 CCATTGCTTTCCCTTTTTTCAGG - Intronic
1032675019 7:134121852-134121874 CCACTTCCTTCTCCTCTTTCAGG + Intergenic
1033886805 7:145959455-145959477 CCATTTGCTTCTCTATATTATGG + Intergenic
1034870716 7:154681139-154681161 CCTTTTCCTTAATTTTGTTCTGG - Intronic
1036201486 8:6774456-6774478 GCATGTCCTTCCCTTTATTCAGG - Intergenic
1036297049 8:7545798-7545820 CCCAGTCCTTGTCTTTGTTCAGG + Intergenic
1036325520 8:7775221-7775243 CCCAGTCCTTGTCTTTGTTCAGG - Intergenic
1036974645 8:13397208-13397230 CCATTCCCTTCTCTATATTGAGG - Intronic
1037385797 8:18339356-18339378 CCATTTCCTTCCCTTGATTTGGG - Intergenic
1038744400 8:30244613-30244635 CTATTTCCTTTTACTTGTTCAGG - Intergenic
1039587853 8:38721457-38721479 CCATTTACTCCTTTTTGTACCGG - Intergenic
1041213042 8:55571984-55572006 ACATTTACTTCTCATGGTTCTGG + Intergenic
1043693565 8:83188609-83188631 CCATGCCCTTCTCTTAGCTCTGG - Intergenic
1043724637 8:83595042-83595064 CCATAGCCTTTTCTTTTTTCAGG - Intergenic
1043822460 8:84884811-84884833 CTATTTCTCTCTCTTTCTTCAGG + Intronic
1043836937 8:85059547-85059569 ACATTTCCTTCTTTTTTTTTTGG + Intergenic
1044011645 8:87001248-87001270 CCATCTCATTCTCTTTTTTATGG + Intronic
1044329414 8:90899041-90899063 CCATTTCCTCCTCTTTTCACAGG - Intronic
1045474267 8:102539844-102539866 CCATTTATTTCTCATAGTTCTGG + Intergenic
1046084329 8:109413281-109413303 TCATTTATTTCTCTGTGTTCTGG + Intronic
1046349643 8:112990550-112990572 GCATTTCCTATTCATTGTTCTGG - Intronic
1046481510 8:114825110-114825132 CCATTTCCTACTATTTGTTATGG - Intergenic
1046804167 8:118462267-118462289 CCATATCCTTTACTTTGTGCAGG - Intronic
1046936188 8:119887498-119887520 CCCTTCCCTTCTCTTCTTTCTGG + Intronic
1047217381 8:122887660-122887682 CCATTTTCTTTTCTTTGCTTTGG - Intronic
1047663942 8:127069087-127069109 CCATCTCTTTCTCTCTGCTCAGG + Intergenic
1048060599 8:130915947-130915969 CCCTTGCCTTTCCTTTGTTCTGG - Intronic
1048499730 8:134964699-134964721 CAATTTCCTTCTCTTTTTTAAGG + Intergenic
1049033756 8:140058516-140058538 GCATTTCCATCTCTGTTTTCCGG - Intronic
1049264048 8:141657273-141657295 CCATTTTCTTCTCTCTCTTCTGG - Intergenic
1051061394 9:13049208-13049230 CCCTTTCCTTCTCCTTATCCAGG - Intergenic
1051520173 9:17978427-17978449 CGATTTCTTTCTCTTTATTTTGG + Intergenic
1051596130 9:18825972-18825994 CTGTTTCCTCCTCTTTGTACTGG + Intronic
1051641991 9:19231363-19231385 ACATTTCCTTCTCTGTCTTACGG + Intronic
1051731122 9:20144051-20144073 CCATTTGCTTCCCGTTGTACTGG - Intergenic
1051777796 9:20655454-20655476 CCATCTCTCTCCCTTTGTTCAGG - Intergenic
1052098928 9:24419483-24419505 TCCTTTCCTTCTCTCTTTTCAGG - Intergenic
1052572901 9:30251169-30251191 CCATTTATTTCTCTCAGTTCTGG - Intergenic
1052755062 9:32532643-32532665 CTAATTCCTTCTCATTCTTCAGG - Intergenic
1053314455 9:37039614-37039636 ACTTTTCCTTCACTTTGTACTGG + Intergenic
1053454683 9:38225077-38225099 CCATTTCATTCTCTGAGCTCCGG + Intergenic
1053520595 9:38773902-38773924 CAGTTTTCTTCTTTTTGTTCAGG + Intergenic
1054993731 9:71360862-71360884 CCTCTTCCTTCTTTTTTTTCTGG - Intronic
1056014191 9:82365385-82365407 TCCTTTCCTTCATTTTGTTCCGG + Intergenic
1056073040 9:83008432-83008454 CCGTATCCTTCCCTATGTTCTGG + Intronic
1056370223 9:85946540-85946562 CCATTTTCTTCTCTTTTTGATGG + Intronic
1059263633 9:113004664-113004686 ACATTTCTTTCTCATAGTTCTGG - Intergenic
1059500288 9:114746468-114746490 CCTTTTCTTTTTCTCTGTTCTGG - Intergenic
1059666581 9:116451994-116452016 CCTCCTCCTTCTCTTTATTCAGG + Intronic
1059746404 9:117205958-117205980 CCATTTCCTTTGTTTTGTTTGGG - Intronic
1060235651 9:121860796-121860818 ACATTTACTTCTCATGGTTCTGG - Intronic
1060951052 9:127603212-127603234 TTATTTGCTTCTCTTTGTTAGGG + Intergenic
1186510896 X:10129018-10129040 CCTTTTCCTTCTGTCTGTCCTGG + Intronic
1186680873 X:11872403-11872425 ACATTTCCTTTTCTTTCTTCAGG + Intergenic
1187342814 X:18436489-18436511 CCAGGTCCTTCTCATTCTTCGGG - Intronic
1188005663 X:25014195-25014217 CCCTTTCTTTCTCTTTTTGCAGG + Intronic
1188815075 X:34703279-34703301 CCATTTCGTTATTTATGTTCTGG + Intergenic
1189024540 X:37378708-37378730 TGATGTCCTTCTCTTTATTCTGG + Intronic
1189097237 X:38153539-38153561 CCATTTCATTTTCTTCTTTCTGG + Intronic
1189128390 X:38472609-38472631 CCCTTTCTTTCTTTTTGTTTTGG + Intronic
1189532169 X:41896462-41896484 CCATTTCCCTCTCTTTCTCTTGG + Intronic
1189755120 X:44263035-44263057 GCACTGACTTCTCTTTGTTCTGG - Intronic
1190238598 X:48637499-48637521 ATATTTACTTCTCCTTGTTCTGG + Intergenic
1192271598 X:69585525-69585547 TCATTTCTTTCTCATTTTTCAGG - Intergenic
1192332254 X:70185204-70185226 CCATCTCCTGGACTTTGTTCAGG + Intronic
1192831216 X:74752468-74752490 CCTTTTCTTTCTCTCTGTACCGG + Intronic
1194095795 X:89637045-89637067 CTATTTCCTTCCCTTTCTCCAGG - Intergenic
1194554430 X:95339497-95339519 CCATGTCTTTATCTTTGTTTTGG - Intergenic
1195804945 X:108753882-108753904 CCATTTCATTCTTTTTGCTCAGG + Intergenic
1195872099 X:109497361-109497383 CAGTTTCGTTCTCTTTGCTCAGG + Intergenic
1197343856 X:125307902-125307924 CCCTTTCCTCCTCCTTTTTCTGG - Intergenic
1197361514 X:125510009-125510031 TCTTTTTCTTCTCCTTGTTCTGG - Intergenic
1197563964 X:128058045-128058067 ACATTTATTTCTCATTGTTCTGG - Intergenic
1198012113 X:132568048-132568070 ATATTTTCTTCTCTTTTTTCTGG - Intergenic
1198110687 X:133500256-133500278 CCAAATCCTTCTCTTTGATAAGG - Intergenic
1198330482 X:135618144-135618166 CCATTTCTTTCTCAAGGTTCTGG - Intergenic
1198630858 X:138636975-138636997 CAATTTCCTTTCCTTTTTTCTGG + Intronic
1198781372 X:140239731-140239753 GCGTTTTCTTCTTTTTGTTCAGG + Intergenic
1200448796 Y:3298417-3298439 CTATTTCCTTCCCTTTCTCCAGG - Intergenic
1201148379 Y:11079711-11079733 GCATTTTCTGCTTTTTGTTCTGG + Intergenic
1201417400 Y:13761124-13761146 CCATTTCCTTTTCCATGTTTTGG + Intergenic
1202599982 Y:26583515-26583537 CCTTTTGCTTCTATTTGTTTAGG + Intergenic