ID: 1147752552

View in Genome Browser
Species Human (GRCh38)
Location 17:42745055-42745077
Sequence ACGGCGCAGGGGTGGGGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 456}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147752552_1147752561 1 Left 1147752552 17:42745055-42745077 CCGCGGCCCCACCCCTGCGCCGT 0: 1
1: 0
2: 2
3: 61
4: 456
Right 1147752561 17:42745079-42745101 CCCCGCCCCGCGCCTCCTGTCGG 0: 1
1: 0
2: 3
3: 35
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147752552 Original CRISPR ACGGCGCAGGGGTGGGGCCG CGG (reversed) Intergenic
900000283 1:11051-11073 ACGGCGCCGGGCTGGGGCGGGGG + Intergenic
900019988 1:181565-181587 ACGGCGCCGGGCTGGGGGCGGGG + Intergenic
900070574 1:769029-769051 ACGGGGTGGGGGTGGGGCTGGGG - Intergenic
900137877 1:1126109-1126131 ACGGAGGAGGGCAGGGGCCGCGG + Intergenic
900262356 1:1738289-1738311 CAGGCGGAGGGGTGGGGCCCAGG + Intronic
900436158 1:2632191-2632213 ACAGAGCAGGGGAGGGGCTGGGG - Intronic
900500870 1:3003881-3003903 ACAGCCCCGGGGTGAGGCCGGGG + Intergenic
900598168 1:3491763-3491785 ACGGTGCGGGGGTGGGGGGGGGG + Intronic
900626659 1:3611605-3611627 AGGGGGAAGGGGCGGGGCCGAGG - Intergenic
900899779 1:5508738-5508760 AGGGCTCAGGGGTGGGGAGGTGG - Intergenic
901242873 1:7704966-7704988 GCGGGGCGGGGGCGGGGCCGGGG + Intronic
901303673 1:8217336-8217358 CCCGCGCACGGCTGGGGCCGGGG + Intergenic
901506214 1:9687579-9687601 AGGGCGTGGGGGCGGGGCCGGGG + Intronic
901506578 1:9689453-9689475 TCGGGGCTGGGGCGGGGCCGGGG - Intronic
901631731 1:10651330-10651352 AGGGGGCTGGGGTGGGGGCGGGG + Intronic
902272816 1:15316764-15316786 ACAGGTCAGGGGTGGGGCAGGGG - Intronic
902410045 1:16207098-16207120 AGGGCGCAGAGGAGGGGCCGGGG - Exonic
902584173 1:17427820-17427842 ACCGGGCAGGGGTGGGGGAGGGG + Intronic
903504759 1:23825486-23825508 ACGGCGGAGGGGCGGGGGCGGGG - Intronic
903603106 1:24556278-24556300 AGGGCCCGGGGGTGGGGACGAGG + Intronic
903822045 1:26110942-26110964 TCGGCGCAGGGGAGAGGCCTTGG - Intergenic
904467776 1:30718470-30718492 GCGGGGCAAGGGTGGGGCCAGGG - Intronic
904467822 1:30718596-30718618 GCAGGGCAGGGGCGGGGCCGGGG - Intronic
904542121 1:31239987-31240009 ACGGCAGAGGGGTGGGGCGGGGG + Intergenic
904563336 1:31413157-31413179 GCGGGGCCGGGGCGGGGCCGGGG + Intronic
905137107 1:35808294-35808316 TTGGCGCTGGGGTGGCGCCGCGG - Exonic
905153101 1:35948463-35948485 CCGGCGGTGGGGTGGGGGCGGGG - Intronic
905296089 1:36955277-36955299 AAGGGGCAGGTGTGGGGCGGTGG + Intronic
905308524 1:37034556-37034578 AGGGCGCAGGGGAGGGGGCTGGG - Intergenic
905378765 1:37544705-37544727 ACGGCGCTGGAGTGGCGGCGGGG - Intronic
905648273 1:39639691-39639713 GCGGGGCCGGGGCGGGGCCGGGG - Exonic
905779157 1:40692271-40692293 GCGGCGCAGGCGTGGGGTTGCGG + Intronic
905847115 1:41242243-41242265 GAGGCGCGGGGGAGGGGCCGGGG - Intergenic
906214319 1:44030358-44030380 CCGGCCCGGGGGCGGGGCCGTGG - Intronic
906691831 1:47797879-47797901 ACAGGGCTGGGGTGGGGCTGTGG + Intronic
906962474 1:50426821-50426843 ACTGCGTTGGGGTGAGGCCGGGG + Intergenic
907053465 1:51344966-51344988 ACCGGGCAGGGGTGGGGACTCGG - Intronic
907364096 1:53945739-53945761 GCGGCGAAGGGGCGGGGCTGAGG - Exonic
912687655 1:111779693-111779715 ACTGGGCAGGGGTGGGGGTGGGG + Intronic
912878894 1:113390186-113390208 AGGGCGCAGAGGAGGGGCAGGGG - Intergenic
913323359 1:117605982-117606004 GCGGCTCAGGGGCGGGGACGGGG + Exonic
914386157 1:147172225-147172247 GAGGCGCAGGGGCGGGGCCGGGG - Intronic
914790847 1:150876424-150876446 AAGGCGCCGGGGCGGGGCGGGGG - Intronic
914947228 1:152078593-152078615 ACGGTGCAGGGGCTGGGCAGAGG + Intergenic
915246276 1:154558446-154558468 GCGGCCCAGGGGGGGGCCCGGGG - Exonic
915310587 1:155004093-155004115 CCGGAGCAGGGGAGGGGCAGAGG + Intronic
915977412 1:160400389-160400411 AAGGCGCAGGGCTGGGGGAGCGG + Intergenic
918040776 1:180912829-180912851 AGCGCGGAGAGGTGGGGCCGCGG - Intergenic
919925316 1:202189003-202189025 ATGGGGCTGGGGTGGGGGCGTGG + Intergenic
919972955 1:202592391-202592413 AGGAGGCAGGGGTGGGGCTGGGG + Exonic
920080306 1:203368265-203368287 AAGGCGCGGGGGTGGGGGCGGGG + Intergenic
921007864 1:211112145-211112167 ACGGTGCAGTGGCGGGGCAGAGG - Intronic
921604929 1:217140695-217140717 ACGGCGAAGGGGTGGGGGAGGGG - Intergenic
922416554 1:225427851-225427873 CCGGCGCAGCGGCCGGGCCGGGG - Intronic
922555182 1:226527400-226527422 GTGGGGCAGGGCTGGGGCCGGGG + Intergenic
922766403 1:228158695-228158717 AAGGCGCAGGGCGGGGGCCGCGG - Exonic
923647481 1:235838971-235838993 AGGGCGCAGGGGTGGGGGATAGG - Intronic
1065373820 10:25016658-25016680 ACTGCGCGGGGGCGGGACCGGGG + Exonic
1065698844 10:28404920-28404942 AAGGCGGGGGGGTGGGGCGGGGG + Intergenic
1065712956 10:28533940-28533962 ACGGCGCGGGTGGGGGGCCGGGG - Intronic
1066025998 10:31361595-31361617 ACGGTGCAGGGGCTGGGCAGAGG + Intronic
1066759223 10:38738067-38738089 CCGGGGCAGGGCTGGGGCCAGGG - Intergenic
1067533942 10:47094420-47094442 CCGGTGCAGTGTTGGGGCCGTGG + Intergenic
1068629427 10:59284541-59284563 ATGTGGCAGGGGTGGGGCTGTGG - Intronic
1068652560 10:59538856-59538878 ACGTTGCAGGGGTTGGGCCTGGG - Intergenic
1069992494 10:72323921-72323943 ACAGCCCAGGGTTGGGGCGGGGG + Intergenic
1070795017 10:79211340-79211362 ATGGGGCAGGGCTGGGGCTGAGG - Intronic
1071527419 10:86366525-86366547 AGGGCGCAGGGGCGGGCGCGCGG - Intergenic
1073099572 10:100999725-100999747 ACCGCGCAGGGGAGGGTCCGAGG - Exonic
1075413188 10:122244169-122244191 AGGGAGCAGGGGTGGGGATGGGG - Intronic
1076306171 10:129467097-129467119 AGCGCGCGGGGGCGGGGCCGGGG - Intergenic
1076306202 10:129467189-129467211 GGGGCGCGGGGGCGGGGCCGAGG - Exonic
1076398744 10:130162798-130162820 AGGCCGCAGGGGTGGGCCTGAGG - Intronic
1076683519 10:132186878-132186900 GCGGAGCCGGGGTGGGGGCGGGG + Exonic
1076854464 10:133109073-133109095 GAGGGGCAGGGGTGGGGCCGGGG - Intronic
1076861510 10:133140254-133140276 GCGGGGCAGGGGCGGGGCAGGGG - Intergenic
1077018477 11:407185-407207 GCGGCGCAGGGGCGGGGGCGGGG + Intronic
1077099504 11:815859-815881 ACGGGGCAGGGGTGAGGCGGGGG + Intergenic
1077137650 11:1009237-1009259 AGGGGTCAGGGGTGGGGACGGGG + Intronic
1077319942 11:1936637-1936659 ACGGAGCACGGATGGGGCTGGGG - Intronic
1077481491 11:2816908-2816930 ACTGCCCAGGGGTTGGGCTGTGG - Intronic
1077874683 11:6294123-6294145 AAGGGGCAGGGGTGGGGGTGTGG + Intergenic
1077895820 11:6452516-6452538 ATGGAGTTGGGGTGGGGCCGGGG - Intronic
1079250148 11:18781146-18781168 AGGGGGCCGGGGCGGGGCCGGGG - Intronic
1080595970 11:33774528-33774550 GCGGGGCAGGGGCGGGGCCAGGG - Intronic
1080646267 11:34190241-34190263 GCGGGGCAGGGGTGGGGCAGGGG - Intronic
1081807870 11:45900086-45900108 GCGGGGCCGGGGCGGGGCCGAGG - Intronic
1081870663 11:46381367-46381389 GCGGCGCAGGGAGTGGGCCGGGG + Intronic
1082891032 11:58139024-58139046 ACAAAGCAGGGGTGGGGCCCTGG + Intronic
1083886511 11:65575996-65576018 CCGGCGCGGGGCGGGGGCCGGGG - Intergenic
1084575161 11:69984501-69984523 ACAGCGCTGAGGTGGGGGCGGGG + Intergenic
1084786988 11:71448299-71448321 TGGGCGCAGGTGAGGGGCCGAGG - Exonic
1085023991 11:73226022-73226044 ACGGGGCAGGGGTGGAGGCACGG + Intronic
1085074063 11:73573962-73573984 AAGGGGCAGGGGTGGGGGCAGGG + Intronic
1085532793 11:77201841-77201863 ACTGCCAAGGGGTGGGGCCGGGG + Intronic
1088604478 11:111514724-111514746 GCGGGGCAGGGGCGGGGCGGGGG + Intergenic
1089172685 11:116526296-116526318 ATGGGGCTGGGGTGGGGCTGGGG - Intergenic
1089289358 11:117428507-117428529 GCTCAGCAGGGGTGGGGCCGGGG + Exonic
1089489802 11:118875545-118875567 ACGGTGCCAGGGTGGGGCCCAGG + Intergenic
1090974997 11:131672835-131672857 ACGGTGCCGGGGTGGGGGTGGGG + Intronic
1090975015 11:131672902-131672924 ACGGTGCCGGGGTGGGGGTGGGG + Intronic
1090975033 11:131672969-131672991 ACGGTGCCGGGGTGGGGGTGGGG + Intronic
1090975050 11:131673036-131673058 ACGGTGCCGGGGTGGGGGTGGGG + Intronic
1091373368 12:11179-11201 ACGGCGCCGGGCTGGGGGCGGGG + Intergenic
1091449460 12:563327-563349 AGGGCGCAGGGGTGTGGGCAGGG - Exonic
1092229225 12:6767456-6767478 AGGGCGAACGGATGGGGCCGGGG - Intronic
1092258926 12:6942078-6942100 ACGGGGCAGGGGAGGGGCGGCGG - Exonic
1094845169 12:34358350-34358372 GCCGCGCATGGGTGGGGCCCAGG - Intergenic
1094847621 12:34368250-34368272 ACCGCGCATGCGTGGGGCCCAGG - Intergenic
1094849027 12:34374072-34374094 ACCGCGCATGCGTGGGGCCCAGG - Intergenic
1094851757 12:34385437-34385459 ACCGCGCATGAGTGGGGCCCAGG - Intergenic
1094856107 12:34403536-34403558 ACGGTGCATGTGTGGGGCCGAGG + Intergenic
1095949274 12:47773164-47773186 GCGGCGCTGGGGGCGGGCCGGGG + Intronic
1096460725 12:51820430-51820452 ACGGCGCGCGGGGGAGGCCGCGG - Intergenic
1096481492 12:51944176-51944198 AAGGTGTAGGGGTGGGGCCCTGG - Intergenic
1096634318 12:52948967-52948989 AGGGCGCGGGGGTGGGGCCCGGG + Exonic
1096647704 12:53047497-53047519 GCGGCCCAGGGCTGGGGCCGGGG + Intronic
1096782729 12:54000432-54000454 TCGGCGCCGAGGTGGGGCTGGGG - Exonic
1096870318 12:54588586-54588608 AGCGCGCCGGGCTGGGGCCGGGG - Exonic
1097046128 12:56189126-56189148 AGGGCGCAGCAGTGGGGGCGGGG + Intronic
1097190264 12:57216403-57216425 CAGGCGCAGGGCAGGGGCCGAGG - Intergenic
1097191519 12:57221648-57221670 TCGGCGCGGGGGCGGGGCGGAGG - Intronic
1100540047 12:95548893-95548915 CCGGCGCAGGGGTGGGGCTGTGG - Intronic
1101038423 12:100728942-100728964 ATGGGGCAGGGGTGGGTTCGGGG - Intronic
1102177946 12:110889814-110889836 ACAGGGCAGGGGTGGGGTGGGGG - Intronic
1103561039 12:121793461-121793483 GCGGGGCTGGGGTGGGGGCGAGG - Intronic
1103786451 12:123436537-123436559 GCGGCCCGGGGGTGGGCCCGGGG + Exonic
1103907828 12:124336302-124336324 AGGGAGCAGGGATGGGGCTGCGG - Intronic
1104483738 12:129130969-129130991 ACCGGGCAGTGGTGGGACCGAGG + Intronic
1104678112 12:130729460-130729482 TCAGCGCAGGGGTGGGGAGGAGG - Intergenic
1104686340 12:130787470-130787492 ACGGCCTGGGGGTGAGGCCGTGG - Intergenic
1104887036 12:132116913-132116935 ACGGCGCAGGGCGGGCGCCGGGG - Intronic
1105796854 13:23863306-23863328 ACTGAGCAGGGGAGGGGCAGGGG + Intronic
1113655118 13:112063120-112063142 ACCGCGCGGGGGCGGGGCGGGGG - Intergenic
1114259380 14:21025856-21025878 GGGGCGCGGGGGAGGGGCCGGGG + Intronic
1115761576 14:36582265-36582287 GCGGCGCAGGGGTCGGGCTGGGG + Exonic
1116715279 14:48418269-48418291 GCAGCCCAGGGGTGGGGCCTGGG + Intergenic
1116895669 14:50312614-50312636 GCGGGGCGGGGGCGGGGCCGAGG - Intronic
1117338642 14:54775663-54775685 ACTGGGCAGGGGTGGGGCCTGGG - Intronic
1118600011 14:67465369-67465391 ATGGCACAGGGCTGGGGCAGAGG + Intronic
1119195322 14:72713401-72713423 GCGGGGTAGGGGTGGGGCCCAGG - Intronic
1121583208 14:95045984-95046006 ACAGCACAGGGGTGGGGCCCAGG - Intergenic
1121915381 14:97833058-97833080 ACGGAGACGGGGTGAGGCCGGGG + Intergenic
1122232477 14:100313645-100313667 AGGGGGCAGGAGTGGGGGCGGGG + Intergenic
1122291188 14:100681277-100681299 AGGGGGCATGGGTGGGGCAGTGG + Intergenic
1122847927 14:104510870-104510892 AGAGTGCAGGGGTGGGGCAGTGG + Intronic
1122885141 14:104707538-104707560 AGGGAGCAGGGGTGGGGGTGGGG - Exonic
1122889016 14:104724157-104724179 GCGGGGCAGGGGGCGGGCCGGGG - Intergenic
1122947839 14:105021290-105021312 CGGGCGCAGGGGCGGGGGCGGGG - Intergenic
1123065085 14:105614882-105614904 ACTGCGGCTGGGTGGGGCCGTGG - Intergenic
1123069286 14:105634316-105634338 ACTGCGGCTGGGTGGGGCCGTGG - Intergenic
1124942711 15:34232957-34232979 AAGGCGCGGGGGTGGGGGCGGGG + Intronic
1127293681 15:57591884-57591906 AAGGCCCGGGGGTGGGGCCGGGG - Intergenic
1128451334 15:67807458-67807480 GAGGAGCAGGGGTGGGGCTGGGG - Intergenic
1129457890 15:75685348-75685370 ACGGAGCAGTGGAGGGGCCAGGG + Exonic
1129682882 15:77667926-77667948 AGGGCCCAGGGCTGGGGCTGAGG + Intronic
1129724273 15:77893717-77893739 GCGGGGCAGGGGTGGGGTCGTGG - Intergenic
1131111759 15:89768798-89768820 AAGAAGCAGGGGTGGGGACGGGG - Intronic
1131160390 15:90101670-90101692 AAGGCGAAGGGGTGGGGGTGGGG + Intronic
1132453224 15:101979894-101979916 ACGGCGCCGGGCTGGGGCGGGGG - Intergenic
1132453667 16:10730-10752 ACGGCGCCGGCCTGGGGGCGGGG + Intergenic
1132719750 16:1309804-1309826 GCGGGGCGGGGGTCGGGCCGAGG + Intronic
1132730000 16:1356492-1356514 CAGGCGGAGGGGAGGGGCCGTGG + Intronic
1132741354 16:1414803-1414825 GCGGGGCTGGGGCGGGGCCGGGG - Intergenic
1132884439 16:2176427-2176449 ATGGAGCGGGGGTGGGGACGAGG + Intronic
1132928940 16:2448792-2448814 CTGGGGCAGGGGTGGGGCGGAGG - Intronic
1133014695 16:2933958-2933980 ACGGCGCAGCGGGGGAGCCCAGG + Exonic
1133046189 16:3089605-3089627 TGGGTGCAGTGGTGGGGCCGAGG + Exonic
1133156665 16:3880757-3880779 ACGGGGAGGGGGTGGGGGCGGGG + Intergenic
1133223172 16:4327905-4327927 AGGGCCCAGGGGTTGGGGCGAGG - Intronic
1133771394 16:8868888-8868910 GAGCCGCAGGGGTGGGGCCTCGG - Intronic
1134849795 16:17470602-17470624 CCGGCGCGGGGCCGGGGCCGGGG + Exonic
1136285338 16:29237265-29237287 ACGGCGGGGAGGTGAGGCCGCGG + Intergenic
1136377988 16:29876710-29876732 ACAGGGAAGGGGCGGGGCCGAGG + Intronic
1136544700 16:30948613-30948635 AGGCCGGAGGGGTGGGGCCTGGG + Exonic
1137019877 16:35414692-35414714 ACGGGGCGGGGGCGGGGACGGGG - Intergenic
1137295112 16:47084959-47084981 ACAGAACAGGGGTGGGGCAGGGG - Intronic
1138178596 16:54928375-54928397 ACGGGGCGGGGGCGGGGGCGGGG + Intergenic
1138206774 16:55131061-55131083 ACAGCCCAGGGGTGGGGCAGGGG + Intergenic
1138575900 16:57907198-57907220 GCAGGGCAGGGGTGGGGCAGGGG - Intronic
1138829153 16:60357854-60357876 ACGGTGCAGGGGCTGGGCAGAGG + Intergenic
1140098677 16:71895937-71895959 ACGGGGTAGGGGTGTCGCCGAGG - Intronic
1140514910 16:75534879-75534901 ACTGCGCAGGGCAGGGGTCGGGG - Intronic
1141120277 16:81349184-81349206 ACGGGGTCGGGGTGGGGCAGGGG - Intronic
1141688333 16:85582706-85582728 AGGGCGTCGGGGTGGGGACGGGG + Intergenic
1141709410 16:85689162-85689184 GCGGGGCCGGGGTGGGGGCGGGG - Intronic
1142156329 16:88534292-88534314 AGCGCGCAGGGGCGAGGCCGGGG - Exonic
1142185302 16:88692069-88692091 ATGGGGCAGGGGTGGGGGCCGGG - Intergenic
1142227090 16:88882841-88882863 ACAGCCCACGGGTGGGGCCTGGG - Intronic
1142285867 16:89171356-89171378 GTGGGGCCGGGGTGGGGCCGGGG - Intergenic
1142809248 17:2387518-2387540 GAGGCGCAGGGGTGGTGCTGGGG + Exonic
1142848134 17:2691935-2691957 GCGGGGCGGGGGCGGGGCCGCGG - Intronic
1143471129 17:7176955-7176977 AGGGCGCTGGGGCGGGGCTGGGG - Intronic
1143628091 17:8122318-8122340 ACAGCGCGGGGGTGGGGCAGCGG - Intronic
1143644757 17:8223121-8223143 GCGGCGCGGGGGCGAGGCCGAGG - Intergenic
1143697609 17:8631392-8631414 GCTGCGCGGGGTTGGGGCCGCGG + Intergenic
1145031385 17:19507582-19507604 TCGGGGCGGGGGTGGGGACGCGG - Intronic
1145266686 17:21383060-21383082 ACTTGGCAGGGGAGGGGCCGGGG + Intronic
1145956953 17:28861282-28861304 ACAAGGCAGGGGTGGGGGCGTGG - Intergenic
1146125679 17:30229388-30229410 ACGGCTTAGGGGTGGGGAGGGGG + Intronic
1147330602 17:39696826-39696848 GCAGGGCAGGGGTGGGGCCTGGG + Intronic
1147752552 17:42745055-42745077 ACGGCGCAGGGGTGGGGCCGCGG - Intergenic
1148491286 17:48025340-48025362 GCGGGGCCGGGGTGGAGCCGGGG + Intergenic
1148547066 17:48527116-48527138 TCGGCGGAGGCGGGGGGCCGGGG - Intergenic
1150228727 17:63538358-63538380 ACGCGGCCGGGGTGGGGCTGGGG - Intronic
1150597240 17:66616880-66616902 AGCTAGCAGGGGTGGGGCCGTGG + Intronic
1151570471 17:74923168-74923190 ACGGGGCCGGGCAGGGGCCGGGG + Exonic
1151939031 17:77281370-77281392 GCGGGGCGGGGGCGGGGCCGGGG + Intronic
1152138899 17:78524973-78524995 ACGCCGCGTGGGTGGGGCCCGGG - Intronic
1152298725 17:79483367-79483389 GTGGTGCAGGGGTGGGGTCGGGG - Intronic
1152325255 17:79632287-79632309 ACAGATGAGGGGTGGGGCCGGGG + Intergenic
1152345272 17:79747511-79747533 CCGGGGCAGGGGTCGGGACGCGG - Intergenic
1152573552 17:81130721-81130743 ACGGGGCAGGGGTGGGCACTGGG - Intronic
1152617890 17:81346173-81346195 ACGGCGCTGGGGGAGGGGCGCGG - Intergenic
1152654209 17:81512574-81512596 ACGGGGCTGGGGGGGCGCCGGGG - Exonic
1152655322 17:81516758-81516780 ACTCCGCAGGGGTGGGGTGGGGG - Intronic
1152732092 17:81977481-81977503 GCGGCCCAAGGGCGGGGCCGGGG + Intronic
1152739038 17:82011127-82011149 ACTGGGCATGGGTGGGGCAGAGG + Intronic
1152926433 17:83089911-83089933 ACGGCAGGGGTGTGGGGCCGGGG - Intronic
1153615574 18:6930051-6930073 GCTGCGAAGGGGTGGGGCCGTGG - Intergenic
1154132896 18:11751659-11751681 GCGGCGCAGCGGAGGGGCTGCGG + Intronic
1154210846 18:12377369-12377391 ACGGAGCAGCGTTGGGGGCGCGG + Intergenic
1155746561 18:29361978-29362000 AACGCGCAGGGGAGGGGCTGGGG - Intergenic
1158648928 18:59269549-59269571 CCGGCTCAGGGTTGGGGACGCGG - Intronic
1160711069 19:551142-551164 CCGGGGCTGGGGTGGGGACGGGG - Intergenic
1160722589 19:604057-604079 ATGGTGCATGGGTGGGGCCAAGG + Intronic
1160771197 19:831945-831967 CGGGGGCAGGGGCGGGGCCGTGG - Exonic
1160779793 19:872648-872670 CCGGCGGGGGGGTGGGGGCGAGG + Intronic
1160822525 19:1065178-1065200 ACGGCGCCGGGGTCGGGCTGGGG + Intronic
1160826347 19:1082228-1082250 ACGTGGCAGGGGTGTGGCCACGG + Intronic
1160930715 19:1568358-1568380 GCGGGGCCGGGGCGGGGCCGCGG - Intergenic
1160930719 19:1568369-1568391 ACGTCGCGGGGGCGGGGCCGGGG - Intergenic
1160975337 19:1790083-1790105 AAGGGGCAGGGGTGGGGGAGTGG - Intronic
1161237698 19:3206079-3206101 TGGGGCCAGGGGTGGGGCCGGGG - Intronic
1161398725 19:4058507-4058529 AGGGCGGAGGGGTGGGGACAGGG - Intronic
1161793285 19:6373305-6373327 ACAGCGCAGGGATGGGGCGGGGG + Intronic
1162131104 19:8526668-8526690 TTGGGGCAGGGGCGGGGCCGCGG + Intronic
1162459852 19:10808220-10808242 ATTGGGCAGGGGTGGGGGCGGGG + Intronic
1162548122 19:11343201-11343223 ACAGCACAGGGGTGGGGGTGGGG + Intronic
1162578160 19:11511385-11511407 ACGGTGAAGGGGTGGTGCCTTGG + Intronic
1163264148 19:16208153-16208175 AGTGGGCAGGGGTGGGGCCTGGG + Intronic
1163692072 19:18743541-18743563 ATGGGGATGGGGTGGGGCCGAGG + Intronic
1163697025 19:18769141-18769163 AGGGCGCAGGCCGGGGGCCGGGG + Intronic
1165058139 19:33191871-33191893 AGGGAGCAGTGGTGGGGCAGAGG - Intronic
1165744843 19:38224351-38224373 ACGGCGCGGAGGAGGGGCCCGGG + Intronic
1165778406 19:38418169-38418191 AGGGCCAAGGGGTGGGGCCACGG + Intronic
1165780855 19:38433599-38433621 CCGGCGAAGGGGAGTGGCCGGGG + Intergenic
1165939172 19:39406781-39406803 ACGGGGCGGGGCCGGGGCCGGGG - Intergenic
1166105709 19:40597155-40597177 CGGGGGCAGGGGCGGGGCCGGGG + Intronic
1166304092 19:41928000-41928022 CCGGCGCAGGGGCGGGGAGGGGG - Intronic
1166304260 19:41928603-41928625 GCGGCGCGGGGGAGGGGGCGGGG + Intronic
1166529376 19:43533525-43533547 AGGGCGCAGGGGTTCGGGCGCGG + Intronic
1166785429 19:45364223-45364245 ACGGTGCTCAGGTGGGGCCGGGG - Exonic
1166815081 19:45539668-45539690 ACTGGGCGGGGGTGGGGCTGAGG + Intronic
1166873148 19:45882830-45882852 AGGCCGCAGGGGTGGGGGCTGGG + Intergenic
1167015983 19:46841537-46841559 GCAGGGCAGGGGTGGGGCAGTGG - Intronic
1167077307 19:47257409-47257431 ATGGCCCATGGGTGGGGGCGGGG + Intronic
1167115629 19:47487716-47487738 AAGGAGCAGGTGTGGGGCTGGGG + Exonic
1167383738 19:49152437-49152459 AGGGTGCAGGGGTGGGCCAGGGG - Intronic
1167457644 19:49605787-49605809 ACGGGGCAGGGGAGGGGGCCAGG + Intronic
1167538766 19:50072291-50072313 CCTGGGCAGGGCTGGGGCCGTGG + Intergenic
1167792330 19:51689960-51689982 GAGGCGCAGGGATGGGGCTGCGG + Intergenic
1167889346 19:52527518-52527540 GCGGGGCCGGGGCGGGGCCGGGG - Intergenic
1167940565 19:52942712-52942734 GCGGGGCGGGGGCGGGGCCGGGG + Intronic
1168150949 19:54448445-54448467 AGGGCGCAGGGGAGGGGGCACGG - Intergenic
1168403687 19:56100026-56100048 AGGCCACAGGGCTGGGGCCGTGG + Intronic
925069615 2:956223-956245 GCGGGGCAGGGGTGGGGCAGGGG - Intronic
925269148 2:2590094-2590116 ATGGGGCAGGGGTGGGGTTGGGG - Intergenic
925730556 2:6917367-6917389 TCGGCGCGGGGGCGGGGCCGGGG + Intergenic
925752773 2:7104706-7104728 ACTGTGCTGGGGTGGGGCAGGGG + Intergenic
926125779 2:10270793-10270815 ACGGCGCAGGGCTGGCACTGAGG - Intergenic
926215178 2:10901849-10901871 AAGGAGCGGGGGTGGGGACGGGG + Intergenic
927151927 2:20201151-20201173 ACAGCGGAGGTGTGGAGCCGAGG - Exonic
928094258 2:28394141-28394163 GCGGGGCAGGGGTGGGGGGGGGG - Intronic
928490502 2:31778255-31778277 GCGATGCAGGGGTGTGGCCGTGG - Intergenic
928996938 2:37303025-37303047 ACAGGACAGGGGTTGGGCCGTGG - Intronic
929454861 2:42058325-42058347 CTGGGGCGGGGGTGGGGCCGGGG + Exonic
929610676 2:43268705-43268727 GCAGGGCAGGGGTGGGGCCCAGG - Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
932036429 2:68251845-68251867 GCGGCGCGGGGGTGGGGCGACGG + Intronic
932062940 2:68527090-68527112 ACGGTGCAGGGGCTGGGCAGAGG + Intronic
932692575 2:73925879-73925901 AGGGGGCTGGGGAGGGGCCGGGG - Intergenic
934973945 2:98787179-98787201 AGGGCTCAGGGGTGGGGCTGGGG + Intergenic
934992730 2:98932955-98932977 GAGGAGCAGGGGTGGGGCTGAGG + Intronic
936122663 2:109760357-109760379 GCGGCGCAGGGCCGGGGGCGGGG + Intergenic
936222030 2:110611116-110611138 GCGGCGCAGGGCCGGGGGCGGGG - Intergenic
936343766 2:111659791-111659813 CTGGGGCAGGGGTGGGGGCGGGG - Intergenic
937951075 2:127388186-127388208 CCGGGGCAGGGGCGGGGGCGGGG - Intronic
937989191 2:127653046-127653068 ACGGTGCAGTGCAGGGGCCGAGG - Intronic
939365966 2:141231604-141231626 GCGGGGCAGGGGTGGGGGTGGGG - Intronic
940009534 2:149038975-149038997 GCGGCGCAGTGGCGGGGTCGGGG + Intronic
940420604 2:153476880-153476902 GCTGCCCACGGGTGGGGCCGGGG - Intergenic
942067289 2:172283773-172283795 AGGCCTCGGGGGTGGGGCCGGGG + Intergenic
943185129 2:184598198-184598220 TCGGCGTGGGGGTGGGGGCGAGG - Intergenic
944206711 2:197164616-197164638 CCGGGGCAGGGGTTGGGGCGCGG - Intronic
944676019 2:202034517-202034539 ACGGCGCCGGGGCCGGGCCGTGG - Intergenic
944852375 2:203733112-203733134 GCAGGGCAGGGGTGAGGCCGAGG - Intronic
946044232 2:216807901-216807923 TCAGGGCAGGGGTGGGGCTGCGG - Intergenic
947729015 2:232417996-232418018 AGGGGGCAGGGGAGGGGCCTGGG + Intergenic
948162324 2:235835045-235835067 ACGGGGGAGGTGTGAGGCCGAGG - Intronic
948202860 2:236142372-236142394 ACGGGGCAGGGGCCGGGGCGGGG - Intergenic
948223521 2:236291434-236291456 AGGGGGCAGGGGTGGGACCAGGG + Intergenic
948353506 2:237359778-237359800 ACGGTCCAGGGCCGGGGCCGTGG + Intronic
948445059 2:238026151-238026173 GCCGGGCAGGGGTGGGGGCGGGG - Intronic
948468540 2:238163613-238163635 CGGGCGCAGGGGTGGGGCGAGGG - Intronic
948876430 2:240832275-240832297 GCGGGGCAGGGGCGGGGACGAGG - Intergenic
948918471 2:241050552-241050574 ACAGAGCAGGGGAGGGGCCGTGG - Intronic
949045096 2:241869030-241869052 AGGGGGTGGGGGTGGGGCCGCGG + Intergenic
1168769801 20:408024-408046 GCGGGGCCGGGGCGGGGCCGGGG - Intronic
1169073759 20:2749566-2749588 ACCGCGCTGAGGTGGGGCCTGGG - Intronic
1169207937 20:3750355-3750377 AGGGCGTCGGGGTGGGGCGGCGG + Intronic
1169208740 20:3754194-3754216 GGGCCGCATGGGTGGGGCCGGGG - Intronic
1171011510 20:21511869-21511891 CCGCCGCCGGGGTGGGGCCTGGG + Exonic
1171079152 20:22160450-22160472 ACTGCGCAGGCGTGGGGCAGGGG + Intergenic
1171847744 20:30287715-30287737 AGGGCGCAGGGCTAGGGCCCAGG - Intergenic
1172026336 20:31951495-31951517 ACCGGGCAGGGGTGGGGACGTGG - Intronic
1172793442 20:37521555-37521577 ACGGCGCAGGGAATGGGCAGGGG - Intronic
1173185552 20:40837216-40837238 AGGGAGCAGGGGTGGGGGCCAGG - Intergenic
1173279948 20:41618700-41618722 ACGGGGGCGGGGCGGGGCCGGGG + Intergenic
1173759177 20:45544896-45544918 AAGGCTCAGTGGTGGGGCCTTGG - Intronic
1174380803 20:50154101-50154123 AGGGCGCCGGGCTGGGGCCGAGG + Intergenic
1174804657 20:53594387-53594409 TGGGCGCTGGGGCGGGGCCGGGG - Intronic
1174843218 20:53919209-53919231 AGGGCGAAGGGGAGGGGTCGCGG - Intergenic
1175781559 20:61685536-61685558 ACAGCGGGGTGGTGGGGCCGAGG - Intronic
1175941376 20:62539015-62539037 GCGGGGCAGGGGTGGGGGCTGGG - Intergenic
1175941392 20:62539052-62539074 GCGGGGCAGGGGTGGGGGCTGGG - Intergenic
1175975210 20:62707565-62707587 AGGGAGCAGGGGAGGGGGCGGGG + Intergenic
1176148046 20:63574144-63574166 AGGGCGGAGGGGCGGGGGCGCGG - Intronic
1176150525 20:63588611-63588633 ATGGCGCAGAGGTGGGGTCTGGG + Exonic
1176159764 20:63642088-63642110 AAGGTGCGGGGGCGGGGCCGGGG - Exonic
1178493923 21:33071216-33071238 ACGTCCCAGGGGTGGGGGCGGGG - Exonic
1178534909 21:33403352-33403374 ACGGGGCGGGGGCGGGGGCGCGG + Exonic
1178680497 21:34669522-34669544 AGGGCGCAGAGGAGGCGCCGAGG + Exonic
1179658754 21:42861526-42861548 ATGGTGAAGGGGAGGGGCCGGGG + Intronic
1180064364 21:45405231-45405253 ATGGCGCCGAGGTGAGGCCGGGG + Intronic
1180110087 21:45643479-45643501 AAGGGGCGGGGGTGGGGCTGGGG - Intergenic
1180177432 21:46097666-46097688 ACGGGGTAGGGGAGGGGTCGGGG + Intergenic
1180559170 22:16601791-16601813 GCGGCCCGGGGGAGGGGCCGCGG + Intergenic
1180891459 22:19291819-19291841 GCGGGGCAGGGGCGGGGCAGGGG - Intergenic
1180997187 22:19971398-19971420 ACAGGGCAGGGGCAGGGCCGAGG + Intronic
1181057850 22:20268307-20268329 GCGGCGCGGGGGTTGGGGCGTGG + Exonic
1181566614 22:23742627-23742649 AATGCACAGGGGTGGGGCAGGGG + Exonic
1181783509 22:25209341-25209363 ACGGGTGAGGGGTGGTGCCGGGG - Intergenic
1181956360 22:26590135-26590157 CCCGCGCGGGGGCGGGGCCGCGG + Exonic
1182447296 22:30397242-30397264 ACGGGGCTGGGTGGGGGCCGAGG + Intronic
1183353021 22:37344152-37344174 ACGGGGCATGGGTGGGGGCATGG - Intergenic
1183740178 22:39664716-39664738 CTGGGGCGGGGGTGGGGCCGGGG - Intronic
1183862294 22:40679007-40679029 AGGGCACAGGGAAGGGGCCGAGG + Exonic
1184153032 22:42649391-42649413 CCGGAGCAGGGGCGGGGCCGAGG + Intronic
1184236911 22:43187432-43187454 GCGGGGCAGGGGAGGGGTCGGGG - Intergenic
1184388933 22:44192119-44192141 AGGGCCCATGGGTGGGGCTGGGG + Intronic
1184412170 22:44331705-44331727 GCGGCGCGGAGCTGGGGCCGGGG + Intergenic
1184439200 22:44498241-44498263 CCGGGGCAGGGGCGGGGCCGGGG + Exonic
1184464458 22:44660640-44660662 AGGGCTCAGGGGTGAGGCCGAGG + Intergenic
1184557465 22:45240979-45241001 AGGGGACAGGGGCGGGGCCGGGG - Intergenic
1184697987 22:46150440-46150462 CCGGGGCAGGGGGCGGGCCGAGG + Intergenic
1184766915 22:46576989-46577011 GCGGGGCGGGGGCGGGGCCGGGG + Intronic
1184769163 22:46587865-46587887 CGGGCGTCGGGGTGGGGCCGCGG + Intronic
1184806562 22:46798396-46798418 AGGGGGCAGGGGTGAGGCTGGGG + Intronic
1185024264 22:48398683-48398705 ATGGGGCAGGGGTGTGGCCCAGG - Intergenic
1185082952 22:48719635-48719657 ACGGCGCAGGGGTGGGTACTTGG + Intronic
1185315655 22:50178188-50178210 CGGGGGCAGGGGCGGGGCCGGGG - Exonic
1185374391 22:50475313-50475335 ACGGCCCAGGGGTGGGGTTCGGG - Intergenic
950580721 3:13860303-13860325 AGGGAGCTGGGGTGGGGCTGAGG - Intronic
950650206 3:14402532-14402554 GCGGGGCCGGGGCGGGGCCGGGG - Intergenic
952241008 3:31532059-31532081 TCGGCGCGTGGGTCGGGCCGAGG - Intergenic
953484944 3:43286486-43286508 TCAGCGCTGGGGCGGGGCCGCGG - Intergenic
953890849 3:46750653-46750675 GCGGAGCAGGGCTGGGGCCGGGG + Intronic
954004018 3:47578317-47578339 GCGGGGCCGGGGCGGGGCCGGGG - Intronic
954882625 3:53846140-53846162 GCGGGGCAGGGGCCGGGCCGCGG - Exonic
954998814 3:54907258-54907280 AAGGCACAGGGGTGAGGCCTGGG - Intronic
957210058 3:77247992-77248014 ACGGGGGTGGGGTGGGGCTGTGG - Intronic
961551556 3:127672866-127672888 CCGGGGCAGGGGCGGGGCCGCGG + Intergenic
961780443 3:129317394-129317416 AGGGCACAGGAGTGGGGCTGGGG + Intergenic
962587957 3:136861515-136861537 ACGGCGCGGGGGCGGGGAAGGGG + Intergenic
963253006 3:143119700-143119722 GCGGCGGAGGGGAGGAGCCGCGG + Exonic
964438085 3:156674873-156674895 CCGGCGCGGGGCCGGGGCCGGGG - Exonic
965003549 3:162987590-162987612 ACGGAGCGGGGGTGGGGGGGAGG - Intergenic
966200822 3:177358714-177358736 ACGGGGCGGGGGTGGGGGTGGGG - Intergenic
966362736 3:179148163-179148185 CCGGAGGAGGGGGGGGGCCGAGG + Intronic
966869093 3:184278404-184278426 CGGGGGTAGGGGTGGGGCCGGGG - Intronic
967224603 3:187278971-187278993 GTGGCGGAGGGGTGGGGCAGTGG - Intronic
967916724 3:194583907-194583929 GCGGCGGCGGGGCGGGGCCGCGG + Intergenic
968440822 4:623681-623703 AGGGCCCTGGGGTGGGGCTGGGG - Intergenic
968514714 4:1011350-1011372 AGGGCGCGCGGGCGGGGCCGGGG + Intronic
968562976 4:1294790-1294812 AGGGGACGGGGGTGGGGCCGGGG + Intronic
968584384 4:1409344-1409366 ATGGGGGAGGGGTGGGGCAGGGG - Intergenic
968601605 4:1512501-1512523 GGGGCGCCGGGGTGGGGCCTGGG + Intergenic
968699246 4:2047000-2047022 ACGGGGCGGGGGGCGGGCCGAGG - Intergenic
969288646 4:6224290-6224312 AAGGAGCAGTGGTGGGGTCGGGG - Intergenic
969295660 4:6269589-6269611 GCGGGGCGGGGGCGGGGCCGGGG + Intergenic
970456391 4:16227183-16227205 GACGCGCAGGGGAGGGGCCGCGG + Intronic
972768199 4:42171284-42171306 ATGGCTCAGGGGTGAGGCCAGGG + Intergenic
973374189 4:49276443-49276465 ACCGCGGAGAGGTGGGGCCTGGG + Intergenic
973383223 4:49333796-49333818 ACCGCGGAGAGGTGGGGCCTGGG - Intergenic
973941523 4:55915901-55915923 ACGGTGTAGGGGTGGGGTGGGGG - Intergenic
974188040 4:58465358-58465380 ACAGGGCAGGGGTGGGGACTTGG + Intergenic
976226334 4:82798068-82798090 ACCGCGGCGGGGTGGGGGCGGGG + Intronic
976390332 4:84499087-84499109 AGGGAGCGGGGGTGGGGCGGGGG - Intergenic
977173388 4:93790106-93790128 ACGGGGTAGGGGTGGGGTGGGGG - Intergenic
977607225 4:98995555-98995577 GCGGGGCGGGGGCGGGGCCGGGG + Intergenic
981270883 4:142846390-142846412 ACGGCGCAGGGCGCCGGCCGCGG + Intronic
984206327 4:176792348-176792370 CGGGGGCAGGGGTGGGGGCGCGG + Exonic
984771016 4:183436309-183436331 GCGGCGGTGGGGTGGGGCGGGGG + Intergenic
984995428 4:185425947-185425969 ACGGCCCAGGGGCGGGGCCCGGG + Exonic
985068349 4:186144717-186144739 TCGGCGCGGGGCCGGGGCCGGGG + Intronic
985566395 5:620477-620499 AGGGCGCAGGGCTGGGGCCGTGG + Intronic
985790884 5:1926375-1926397 AAGGCGCAGGGGTTGGGGCAGGG - Intergenic
985988770 5:3538469-3538491 AGGATGCAGGGGTGGGGCTGTGG - Intergenic
986242391 5:5972806-5972828 ATGGTGCAGAGGTGGGGCCAGGG - Intergenic
987258461 5:16180089-16180111 AGGGGGCAGGGGAGAGGCCGCGG + Intronic
988482207 5:31639771-31639793 ACGGCCCAGGGATGGGGACCCGG - Intronic
988577742 5:32443977-32443999 ACGGCGGAGGTGTAGGGACGTGG - Intronic
989982632 5:50662759-50662781 ACGGCACAGGGGTGGTGTTGAGG - Intergenic
990753115 5:59039424-59039446 GCGGGGCGGGCGTGGGGCCGCGG - Intronic
993476859 5:88376965-88376987 ATGGTGCAGGGGTGAGGCAGAGG - Intergenic
996407201 5:123117260-123117282 AGGGGGTAGGGGTGGGGCCTGGG + Intronic
998128022 5:139637439-139637461 ACGGTGCGGGGGAGGGGCGGCGG - Intergenic
1001382203 5:171312189-171312211 CCGCCGCAGGGGTGGGGCGCAGG - Intergenic
1001420050 5:171579316-171579338 ACGCAGCAGGGGCGGGGCCCAGG - Intergenic
1001556526 5:172641145-172641167 ACAGTGCAGGGGCGGGGCCGCGG - Intergenic
1002300145 5:178253244-178253266 CCGGGGCAGGGGTGGGGCAGGGG - Intronic
1002532841 5:179858935-179858957 AGTGCGCAGGGGCGGGGCCGCGG - Intronic
1003218407 6:4135711-4135733 GGGGCTCGGGGGTGGGGCCGGGG + Intergenic
1003218466 6:4135876-4135898 GGGGCTCGGGGGTGGGGCCGGGG + Intergenic
1005832396 6:29681154-29681176 GCGGGGCCGGGGTGGGGCCGCGG - Intergenic
1006396000 6:33788346-33788368 CCGGCGCAGGGGAGGGCCCTGGG - Intronic
1010786239 6:80004487-80004509 GCGCCGCACGGGTGGGGTCGCGG + Intronic
1011035449 6:82969214-82969236 ACAGGGCAGGGGTGGGGGTGGGG + Intronic
1012410149 6:98947733-98947755 TTGGCGCCGGGGCGGGGCCGGGG - Intronic
1012476699 6:99621515-99621537 AGGGGGCAGAGGTGGGGCTGGGG + Intergenic
1014523283 6:122471413-122471435 ACGAAGCAGGGGTGGGGGAGGGG + Intronic
1015244791 6:131063378-131063400 CCCGCGCAGGGGCGGGGCCTGGG - Intergenic
1016010819 6:139135715-139135737 ACGGCGCGGTGGCGGGGCCCTGG + Intronic
1018628725 6:165804784-165804806 ACGGCCCCGGGGCCGGGCCGCGG + Intronic
1018813742 6:167316406-167316428 GGGGGGCAGGGGTAGGGCCGGGG - Intergenic
1018971881 6:168535863-168535885 ACGGCACAGGGGCGCCGCCGGGG + Intronic
1019198455 6:170295974-170295996 GCGGCGCAGAGGAGGGGGCGGGG - Intronic
1019312941 7:371620-371642 AGGATGCAGAGGTGGGGCCGTGG + Intergenic
1019341532 7:511040-511062 TCAGCCCTGGGGTGGGGCCGTGG - Intronic
1019448030 7:1081484-1081506 ACGGCGCAGGGGTGGCGGCAAGG + Intronic
1019472998 7:1231208-1231230 ACGGCGCAGGGTTGAGGACCAGG - Intergenic
1019575213 7:1734516-1734538 AGGGCTCAGGGCTGGGGCTGGGG - Intronic
1020067279 7:5198203-5198225 ACAGCACAGGGGTGGAGCCACGG + Intronic
1020142832 7:5621949-5621971 ACGGGGCAGGGGTGGCACCCAGG + Intronic
1020280774 7:6648964-6648986 AAGGCTCAGGGCTGGGGCTGGGG - Intronic
1021958859 7:25852743-25852765 TGGGCGCTGGGGTGGGGGCGGGG + Intergenic
1023418110 7:39950660-39950682 ACGGCGCTGGGGGGAGGCGGGGG + Exonic
1026955289 7:74372889-74372911 ACGGTGGGGGGGTGGGGGCGGGG - Intronic
1029110551 7:98211370-98211392 GCGGGGCCGGGGCGGGGCCGGGG - Intergenic
1029537535 7:101165090-101165112 ATGGCTCAGGGAAGGGGCCGAGG - Intronic
1029711260 7:102301222-102301244 CCTGCGCAGGGCTGTGGCCGAGG + Exonic
1032074528 7:128830233-128830255 GCGGCGCGGGGGAGGGGCGGCGG + Intergenic
1032086111 7:128884751-128884773 AGGGCACAGTGGTGGGGCTGGGG - Intronic
1032845155 7:135745761-135745783 ACGGGGTAGTGGTGGGGCTGGGG + Intronic
1033227391 7:139572772-139572794 ACGGGGCAGGGGCGGGGGGGGGG - Exonic
1034491862 7:151397111-151397133 ACCGCCAAGGGGTGCGGCCGTGG + Intronic
1034618115 7:152436138-152436160 GCGGCTCGGGGGAGGGGCCGCGG - Intergenic
1035169758 7:157010792-157010814 GCGGCGCGGGGGCGGGGCGGCGG - Intergenic
1035358014 7:158290461-158290483 ACTGGGCAGGTGTGGGGCCTGGG + Intronic
1036768663 8:11564449-11564471 AGGGCGCAGAGGCGGGGACGCGG - Exonic
1037562707 8:20089010-20089032 TGGGGGCAGGGGTGGGGGCGGGG + Intergenic
1038348501 8:26754828-26754850 ATGGAGCAGAGGTGGGGCAGGGG - Intronic
1038544041 8:28412079-28412101 GGCGCGCAGGGGTGGGGCGGAGG - Intronic
1039212688 8:35235335-35235357 GCGGCGCTGGGCTGGGGCCCGGG - Intergenic
1041464569 8:58145805-58145827 GCCGCGCAGGGGCGGGGCGGGGG + Intronic
1045432129 8:102124099-102124121 CGGGCGCAGGGGTGGGTTCGAGG - Intronic
1046357031 8:113100901-113100923 ATGGAGCAGAGGTGGGGCAGAGG + Intronic
1048308061 8:133297287-133297309 GAGGCGCGGGGGCGGGGCCGCGG - Exonic
1049040361 8:140108107-140108129 ATGGAGAAGGGGTGGGGGCGGGG + Intronic
1049193490 8:141302405-141302427 TGGGGGCAGGGGTGGGGTCGGGG - Intronic
1049379586 8:142305339-142305361 AGGGCGCAGGGGTGGGAGGGGGG + Intronic
1049545240 8:143227778-143227800 CCAGGGCAGGGGTGGGGCCCAGG - Intergenic
1049545250 8:143227796-143227818 GCAGGGCAGGGGTGGGGCCCAGG - Intergenic
1049580373 8:143408102-143408124 ACCGGGAAGGGGCGGGGCCGAGG - Intergenic
1049745427 8:144261228-144261250 GCGGCGTGGGGGTGGGGCAGGGG - Intronic
1049814266 8:144590906-144590928 ACGGGGCAGGGGTGAGGGCTGGG - Intronic
1049883076 9:11153-11175 ACGGCGCCGGGCTGGGGGCGGGG + Intergenic
1052413680 9:28150177-28150199 ACGGTGCAGGGGCTGGGCAGAGG - Intronic
1053001086 9:34577750-34577772 AGGTCCCAGGGATGGGGCCGGGG - Intronic
1053785865 9:41652358-41652380 AGGGCGCAGGGCTAGGGCCCAGG - Intergenic
1054159177 9:61661819-61661841 AGGGCGCAGGGCTAGGGCCCGGG + Intronic
1054174580 9:61866321-61866343 AGGGCGCAGGGCTAGGGCCCAGG - Intergenic
1054449438 9:65395369-65395391 AGGGCGCAGGGCTAGGGCCCAGG - Intergenic
1054478951 9:65592824-65592846 AGGGCGCAGGGCTAGGGCCCGGG + Intergenic
1054662958 9:67714470-67714492 AGGGCGCAGGGCTAGGGCCCAGG + Intergenic
1056009640 9:82313706-82313728 AGGGAGCAGGGGTGGGGACTTGG + Intergenic
1056659743 9:88535094-88535116 AGGGCGCAGGAGTGTGGGCGGGG + Exonic
1056807602 9:89740982-89741004 AGGGGGCAGGGGTGGGGACGGGG - Intergenic
1056965141 9:91159245-91159267 AAGGGGAAGGGGTGGGGCAGGGG + Intergenic
1057071901 9:92106068-92106090 ACGGTGCAGGGGCTGGGCAGAGG - Intronic
1057928112 9:99170749-99170771 GGGGAGCAGGGGTGGGGCTGGGG + Intergenic
1059258851 9:112956464-112956486 AAGGCGGGGGGGTGGGGGCGGGG + Intergenic
1060552697 9:124492997-124493019 GGGGCCCAGGGGCGGGGCCGAGG + Intronic
1060665137 9:125428241-125428263 AGTGCTCAGAGGTGGGGCCGCGG + Intergenic
1060897128 9:127225179-127225201 GCGGCGCCGGGGCGGGGCCTGGG + Intronic
1061288415 9:129637348-129637370 AAGGGGCAGGGGTGGGGCCTTGG + Exonic
1061524185 9:131144572-131144594 ACGCTGCAGGGGTGGGGGCTAGG - Exonic
1061680682 9:132241231-132241253 ACGGGGCAGGGCCGGGGCAGTGG + Intronic
1061817725 9:133206622-133206644 AGAGCTCTGGGGTGGGGCCGGGG + Intronic
1061918932 9:133771707-133771729 ACAGTGCAGGGGTGGGGTAGGGG - Intronic
1062021394 9:134321043-134321065 ACGGAGAGGGGGTGGGGCCAGGG + Intronic
1062242670 9:135548562-135548584 AGAGCTCAGGGGTGGGGCTGGGG - Intronic
1062309805 9:135929639-135929661 ACTGGGCAGGGCTGGGGGCGGGG - Intergenic
1062398868 9:136363741-136363763 ATGGCGGCGGGGCGGGGCCGGGG - Exonic
1062453834 9:136626626-136626648 GCGGGGCAGGGGTGGGGGCAGGG + Intergenic
1062532534 9:137008183-137008205 ACAGAGCAAGGGTGGGGCAGAGG - Intronic
1062595188 9:137296091-137296113 AGGGCGGGGGGCTGGGGCCGGGG - Intergenic
1062721606 9:138047103-138047125 AAGGGGCTGGGGTGGGGCTGAGG + Intronic
1203551342 Un_KI270743v1:166632-166654 ACCGCGGAGAGGTGGGGCCTGGG - Intergenic
1185506379 X:634580-634602 AGGGCACAGGGCTGAGGCCGGGG - Intronic
1187518197 X:19991084-19991106 GCGGGGCCGGGGTGGGGGCGGGG - Intergenic
1189331709 X:40148298-40148320 AGCCCGCGGGGGTGGGGCCGTGG - Intronic
1189778301 X:44489883-44489905 AGTGCGCAGGGGTGGGGACGTGG - Intergenic
1192148492 X:68697561-68697583 CAGGCGCAGGGGAGGGGCCTAGG - Intronic
1192152428 X:68720454-68720476 ATGGTGCAGGGGTGGGGTGGTGG + Intronic
1195625026 X:106999143-106999165 ACTGCGGAGGGCTGGGTCCGTGG - Intronic
1199947252 X:152679603-152679625 ATGGAGGAGGGGTGGGGGCGAGG - Intergenic
1199962428 X:152788851-152788873 ATGGAGGAGGGGTGGGGGCGAGG + Intergenic
1200402725 X:156028988-156029010 ACGGCGCCGGGCTGGGGGCGGGG - Intergenic