ID: 1147754813

View in Genome Browser
Species Human (GRCh38)
Location 17:42761271-42761293
Sequence CTCCGGGTGGAGCGCGCCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147754807_1147754813 -2 Left 1147754807 17:42761250-42761272 CCTTGCTGCACGATGGCCTCGCT 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1147754813 17:42761271-42761293 CTCCGGGTGGAGCGCGCCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 84
1147754802_1147754813 14 Left 1147754802 17:42761234-42761256 CCGCCGCTCCTCGCCTCCTTGCT 0: 1
1: 0
2: 5
3: 79
4: 961
Right 1147754813 17:42761271-42761293 CTCCGGGTGGAGCGCGCCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 84
1147754800_1147754813 28 Left 1147754800 17:42761220-42761242 CCGGCTCAGCGCCGCCGCCGCTC 0: 1
1: 0
2: 11
3: 46
4: 369
Right 1147754813 17:42761271-42761293 CTCCGGGTGGAGCGCGCCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 84
1147754799_1147754813 29 Left 1147754799 17:42761219-42761241 CCCGGCTCAGCGCCGCCGCCGCT 0: 1
1: 1
2: 5
3: 56
4: 375
Right 1147754813 17:42761271-42761293 CTCCGGGTGGAGCGCGCCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 84
1147754806_1147754813 1 Left 1147754806 17:42761247-42761269 CCTCCTTGCTGCACGATGGCCTC 0: 1
1: 0
2: 1
3: 12
4: 161
Right 1147754813 17:42761271-42761293 CTCCGGGTGGAGCGCGCCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 84
1147754804_1147754813 6 Left 1147754804 17:42761242-42761264 CCTCGCCTCCTTGCTGCACGATG 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1147754813 17:42761271-42761293 CTCCGGGTGGAGCGCGCCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 84
1147754801_1147754813 17 Left 1147754801 17:42761231-42761253 CCGCCGCCGCTCCTCGCCTCCTT 0: 1
1: 1
2: 3
3: 42
4: 500
Right 1147754813 17:42761271-42761293 CTCCGGGTGGAGCGCGCCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 84
1147754803_1147754813 11 Left 1147754803 17:42761237-42761259 CCGCTCCTCGCCTCCTTGCTGCA 0: 1
1: 0
2: 7
3: 38
4: 485
Right 1147754813 17:42761271-42761293 CTCCGGGTGGAGCGCGCCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147754813 Original CRISPR CTCCGGGTGGAGCGCGCCGG CGG Exonic