ID: 1147757489

View in Genome Browser
Species Human (GRCh38)
Location 17:42778657-42778679
Sequence GAATGACACCATCTGCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 340}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147757489_1147757493 8 Left 1147757489 17:42778657-42778679 CCCTGAAGCAGATGGTGTCATTC 0: 1
1: 0
2: 4
3: 28
4: 340
Right 1147757493 17:42778688-42778710 CAGACACAAATGCTAGGTGTGGG 0: 1
1: 0
2: 0
3: 16
4: 159
1147757489_1147757495 10 Left 1147757489 17:42778657-42778679 CCCTGAAGCAGATGGTGTCATTC 0: 1
1: 0
2: 4
3: 28
4: 340
Right 1147757495 17:42778690-42778712 GACACAAATGCTAGGTGTGGGGG 0: 1
1: 0
2: 2
3: 58
4: 597
1147757489_1147757497 27 Left 1147757489 17:42778657-42778679 CCCTGAAGCAGATGGTGTCATTC 0: 1
1: 0
2: 4
3: 28
4: 340
Right 1147757497 17:42778707-42778729 TGGGGGAGGCTGAGTCTGAGAGG 0: 1
1: 1
2: 8
3: 83
4: 723
1147757489_1147757492 7 Left 1147757489 17:42778657-42778679 CCCTGAAGCAGATGGTGTCATTC 0: 1
1: 0
2: 4
3: 28
4: 340
Right 1147757492 17:42778687-42778709 TCAGACACAAATGCTAGGTGTGG 0: 1
1: 1
2: 1
3: 8
4: 168
1147757489_1147757494 9 Left 1147757489 17:42778657-42778679 CCCTGAAGCAGATGGTGTCATTC 0: 1
1: 0
2: 4
3: 28
4: 340
Right 1147757494 17:42778689-42778711 AGACACAAATGCTAGGTGTGGGG 0: 1
1: 0
2: 1
3: 10
4: 178
1147757489_1147757491 2 Left 1147757489 17:42778657-42778679 CCCTGAAGCAGATGGTGTCATTC 0: 1
1: 0
2: 4
3: 28
4: 340
Right 1147757491 17:42778682-42778704 GTGCATCAGACACAAATGCTAGG 0: 1
1: 0
2: 0
3: 11
4: 133
1147757489_1147757496 13 Left 1147757489 17:42778657-42778679 CCCTGAAGCAGATGGTGTCATTC 0: 1
1: 0
2: 4
3: 28
4: 340
Right 1147757496 17:42778693-42778715 ACAAATGCTAGGTGTGGGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147757489 Original CRISPR GAATGACACCATCTGCTTCA GGG (reversed) Intronic
902757747 1:18560276-18560298 GAATAACATTATCTCCTTCATGG - Intergenic
902905232 1:19551795-19551817 GCATGGCAGCATCTGCTTCTTGG + Intergenic
903929090 1:26851953-26851975 AAATGAGAGCATCTGTTTCAGGG + Intronic
906856236 1:49308133-49308155 GAATGGCAGCATCTGCTTCTGGG - Intronic
907253128 1:53156537-53156559 GCATGGCAGCATCTGCTTCTGGG - Intergenic
907448004 1:54521710-54521732 GCATGGCAGCATCTGCTTCTGGG + Intergenic
907567997 1:55455052-55455074 GCATGGCAGCATCTGCTTCTGGG - Intergenic
907971332 1:59384480-59384502 TAATGACAACACCTGCTCCATGG + Intronic
907971428 1:59385458-59385480 TAATGACACCACCTGCTGTAAGG - Intronic
908081789 1:60588623-60588645 GAGTGAAACTAGCTGCTTCAGGG + Intergenic
908260344 1:62335421-62335443 GCATGGCAGCATCTGCTTCTGGG + Intergenic
909773680 1:79457796-79457818 GCATGACAGCATCTGCTACTGGG - Intergenic
910138025 1:83995543-83995565 GCATGGCAGCATCTGCTTCTGGG - Intronic
910186206 1:84543429-84543451 GCATGGCATCATCTGCTTCTGGG + Intergenic
911152304 1:94607414-94607436 GAATAAAACCATCTCCTTGATGG + Intergenic
911565810 1:99462108-99462130 GAGTTACACCATCAGCTTCTTGG - Intergenic
913051308 1:115119239-115119261 GCATGGCAGCATCTGCTTCTGGG + Intergenic
915274474 1:154778674-154778696 CAATGGCACCATCTGCCTCCCGG + Intronic
916649151 1:166818910-166818932 GCATGACAGCATTTGCTTCTGGG + Intergenic
916735915 1:167606927-167606949 GCATAACAGCATCTGCTTCTGGG - Intergenic
916946308 1:169731719-169731741 ATATGACACCATCTGCACCAGGG + Intronic
917777241 1:178350946-178350968 GCATGGCATCATCTGCTTCTGGG + Intronic
919254745 1:195106320-195106342 GAATAACACCTTTTGCTTCTAGG + Intergenic
919816786 1:201446013-201446035 GCATGGCAGCATCTGCTTCTGGG - Intergenic
919882619 1:201910722-201910744 GAATGACACCATCTGCAAAAGGG - Intronic
920035083 1:203060362-203060384 CAATGACACCATCTCCTGAATGG - Exonic
920246352 1:204590440-204590462 GCATGGCAGCATCTGCTTCTGGG + Intergenic
921399045 1:214700160-214700182 GCATGGCAGCATCTGCTTCCGGG - Intergenic
922947568 1:229530037-229530059 AAATGACACCTTCTGTTTGAGGG + Intronic
923059619 1:230458875-230458897 GAATGTAACCATCTGCCTCATGG + Intergenic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1063840397 10:10065299-10065321 GCATGACATCATCTGCTTCTGGG + Intergenic
1064993139 10:21273879-21273901 GACTTACAGCATCTGCTGCAGGG - Intergenic
1065393787 10:25212236-25212258 GCATGGCAGCATCTGCTTCTGGG + Intronic
1065430406 10:25648896-25648918 GTATGGCAGCATCTGCTTCTTGG - Intergenic
1066252750 10:33650236-33650258 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1067099022 10:43321367-43321389 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1067479495 10:46585689-46585711 CAATGAGACCTTCAGCTTCAAGG + Exonic
1067615243 10:47756109-47756131 CAATGAGACCTTCAGCTTCAAGG - Intergenic
1068310699 10:55270964-55270986 GAATGAAATCATGTGCTTCACGG + Intronic
1069982103 10:72260066-72260088 GAATGTCATCATCTGCCTCCAGG + Intergenic
1070989095 10:80715696-80715718 GAATGACTGCATCTGCTCCTTGG + Intergenic
1071602177 10:86963658-86963680 GAAAGTCACCATCTGCCCCAGGG - Intronic
1071630645 10:87216060-87216082 CAATGAGACCTTCAGCTTCAAGG - Intergenic
1072266074 10:93729133-93729155 GCATGGCAGCATCTGCTTCAGGG - Intergenic
1072507448 10:96082850-96082872 CAATGTCACCAGCTGCTTCTGGG - Intergenic
1074100694 10:110352850-110352872 GCATGACACCATCTACTGCAGGG - Intergenic
1074217436 10:111399382-111399404 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1075209170 10:120476394-120476416 AAATGACAGCATCTACATCATGG - Intronic
1075624473 10:123951782-123951804 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1077954603 11:7001838-7001860 GAATAATGCCAACTGCTTCATGG + Intronic
1077981136 11:7301996-7302018 TAATGACAGCATCTGCTACATGG - Intronic
1078589414 11:12626547-12626569 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1078841396 11:15078707-15078729 GAATAATAGCATCTACTTCATGG - Intronic
1079730519 11:23934787-23934809 GAATGCCACCCCCTGCTCCATGG - Intergenic
1082764870 11:57159292-57159314 AAATGACACCATCTGCATCCAGG + Intergenic
1084018934 11:66405535-66405557 GTATGGCAGCATCTGCTTCTGGG - Intergenic
1084495274 11:69499843-69499865 GAGCGACACCACCTGCTTCTTGG + Intergenic
1085859297 11:80213427-80213449 GCATGGCAACATCTGCTTCTGGG - Intergenic
1086084466 11:82940625-82940647 GCATGACAGCATCTGCTTCTGGG + Intronic
1087575182 11:99981256-99981278 GAGTTACACCATCAGCTTCCTGG - Intronic
1087621427 11:100547248-100547270 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1087743045 11:101911674-101911696 GCATGGCAGCATCTGCTTCTGGG - Intronic
1087967203 11:104431382-104431404 GTATGGCACCCTCTGCTTCTAGG + Intergenic
1088436798 11:109822664-109822686 GAACAACACCCTCTGTTTCATGG + Intergenic
1089745658 11:120615138-120615160 GAATAACAACACCTGCTTCATGG - Intronic
1090467039 11:126944002-126944024 GAATCTTACCACCTGCTTCAGGG - Intronic
1091995285 12:4988316-4988338 GCCAGACACCACCTGCTTCATGG + Intergenic
1092483917 12:8884836-8884858 GAATGAGACCATGTTTTTCATGG - Intronic
1093226921 12:16495866-16495888 AAATTTCACCATCTACTTCAAGG + Intronic
1094221114 12:27994701-27994723 GATTGACACAATCTTCTGCATGG + Intergenic
1096038692 12:48495085-48495107 GTATGACTGCACCTGCTTCATGG - Intronic
1097759611 12:63447715-63447737 GAATGACAACATCTGCTCCATGG - Intergenic
1098253362 12:68591315-68591337 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1098833781 12:75395562-75395584 CAATGACTCCATCTGGTTCTGGG + Intronic
1099476676 12:83116096-83116118 GAATGACACAATGGACTTCAGGG - Intronic
1100016364 12:90015579-90015601 CAATTACAGGATCTGCTTCAGGG + Intergenic
1100559050 12:95729007-95729029 GCATGGCAGCATCTGCTTCTGGG - Intronic
1101571080 12:105954268-105954290 GCATGGCAACATCTGCTTCTGGG - Intergenic
1101998074 12:109539323-109539345 GAATGGCATCCTTTGCTTCACGG + Intergenic
1102374555 12:112411376-112411398 GATCGAAACCACCTGCTTCATGG + Intronic
1102448423 12:113022158-113022180 GCATGGCAACATCTGCTTCTGGG + Intergenic
1102711254 12:114929643-114929665 GCATGGCACCATCTGATTCTGGG + Intergenic
1104294182 12:127496535-127496557 GAAGGTCACTTTCTGCTTCAGGG - Intergenic
1104439387 12:128782527-128782549 GAATCTCACCAACTGCTTGACGG + Intergenic
1107650513 13:42540422-42540444 GAATGCCACCATCTGTAGCAAGG + Intergenic
1109009564 13:56923083-56923105 GCATGGCAGCATCTGCTTCTAGG + Intergenic
1109283051 13:60379412-60379434 GCATGGCAGCATCTGCTTCTAGG + Intergenic
1109961961 13:69643438-69643460 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1109962342 13:69646725-69646747 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1110614085 13:77521812-77521834 GAATGCCAGCATCTGCTTCACGG + Intergenic
1110914295 13:81002242-81002264 GCATGATGGCATCTGCTTCAGGG + Intergenic
1112068083 13:95816070-95816092 GCATGGCAGCATCTGCTTCTGGG - Intronic
1112096349 13:96136340-96136362 GCGTGGCACCATCTGCTTCTGGG + Intronic
1112299416 13:98216652-98216674 GAACCACACCATCTTCTCCATGG + Intronic
1112687211 13:101843684-101843706 TAATAACTACATCTGCTTCAGGG + Intronic
1112717361 13:102202132-102202154 GCATGGCAGCATCTGCTTCTGGG - Intronic
1113430034 13:110241861-110241883 GAATGACACCTTCAGCTTTCTGG + Intronic
1113711928 13:112471106-112471128 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1114188615 14:20423317-20423339 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1114437773 14:22722640-22722662 GCATGGCAGCATCTGCTTCTAGG + Intergenic
1116145419 14:41061671-41061693 GCATGTCAGCATCTGCTTCTGGG - Intergenic
1116673273 14:47871566-47871588 GAATGATACCATATGCTTTTTGG - Intergenic
1118416981 14:65550127-65550149 TAATGCCAGCATCTGCTTCTGGG + Intronic
1118742435 14:68749448-68749470 GAATTTCACCATCTTCTTCTTGG - Intergenic
1120694674 14:87631477-87631499 GAGTGTCACAATCTGCTGCAGGG - Intergenic
1120774305 14:88416072-88416094 CAATGCCAGCATCTGCTTCAGGG - Intronic
1121814014 14:96915280-96915302 GCATGGCAGCATCTGCTTCTGGG - Intronic
1125829592 15:42704785-42704807 GAAAGACACCATCTACTTTAGGG - Intronic
1126544186 15:49854275-49854297 GCATGTCAGCATCTGCTTCTGGG - Intergenic
1128243325 15:66116178-66116200 GAATGCTGCCACCTGCTTCACGG - Intronic
1129799549 15:78403749-78403771 GAATGAAACACTCTGCATCAAGG + Intergenic
1131364154 15:91823524-91823546 GCATGGCAGCATCAGCTTCAGGG - Intergenic
1131648662 15:94375061-94375083 GCATGACAGCTTCTGCTTCTTGG + Intronic
1133499079 16:6348321-6348343 AGATGACACCATATGCTTCTTGG + Intronic
1134218508 16:12335076-12335098 AAATGACATCATCTGCAGCAGGG + Intronic
1135161434 16:20100159-20100181 TAATGACACCATTAGCTCCAGGG - Intergenic
1135498183 16:22970770-22970792 GAAAGACAGCAGCTGCTGCAGGG + Intergenic
1135861541 16:26060240-26060262 AAATGACTGCACCTGCTTCATGG - Intronic
1136498358 16:30657751-30657773 GGCTGACAGCATCTCCTTCATGG + Intergenic
1137639754 16:50018312-50018334 GAATGACACGATGGACTTCAGGG + Intergenic
1138277175 16:55743519-55743541 CACTGACAGCATCTGCTGCAAGG + Intergenic
1138470544 16:57231974-57231996 GAAAGACTCCAGCTGCTTCCTGG + Intronic
1140343384 16:74188170-74188192 GCATGGCAGCATCTGCTTCGGGG + Intergenic
1140966172 16:79968140-79968162 GGATGACACCAGCTGCTGAAAGG - Intergenic
1141751196 16:85959462-85959484 AAATGACACCATGGGCTCCATGG + Intergenic
1143532906 17:7516080-7516102 GAATTACACCACCAGCTTCCTGG - Intergenic
1144468484 17:15516074-15516096 GCATGAGAACATCTGCTTCTGGG - Intronic
1147490317 17:40859953-40859975 CAATGACTGCACCTGCTTCATGG - Intergenic
1147535024 17:41315276-41315298 GAAAGCCTCCATCTGCTCCAGGG - Exonic
1147757489 17:42778657-42778679 GAATGACACCATCTGCTTCAGGG - Intronic
1148069687 17:44901007-44901029 GAATGACATCATCAACTTCAAGG + Exonic
1148992378 17:51677458-51677480 GCATGGCAGCATCTGCTTCTGGG - Intronic
1149020701 17:51961016-51961038 GAATGTCTTCTTCTGCTTCAGGG - Intronic
1149914592 17:60597562-60597584 GAATGACTTGATCTGATTCATGG + Intergenic
1152213347 17:79016980-79017002 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1152630146 17:81407256-81407278 CAATGTCACCCTCCGCTTCAGGG - Intronic
1153946288 18:10020784-10020806 CAATGACACCAACTTCTTGAAGG - Intergenic
1155937800 18:31772347-31772369 GAATGACACAATGGGCTTCGGGG + Intergenic
1157127216 18:44968107-44968129 GTATGGTACCATCTCCTTCATGG - Intronic
1159522721 18:69546957-69546979 GCATGACAGCATCTGCTTCTGGG + Intronic
1162947671 19:14053747-14053769 GAATGCCAGCCACTGCTTCAGGG - Exonic
1164677898 19:30114132-30114154 GAATGACACAATGGACTTCAGGG - Intergenic
1167842412 19:52132705-52132727 GCATGGCAACATCTGCTTCTGGG - Intronic
925061941 2:898090-898112 GCATGGCAGCATCTGCTTCTGGG - Intergenic
925612363 2:5712457-5712479 GCATGACAGCATCAGCTTCTGGG + Intergenic
926395130 2:12433562-12433584 GCATTAATCCATCTGCTTCATGG - Intergenic
926547711 2:14262642-14262664 GCATGACAGCATCTGCTTTGGGG + Intergenic
926775767 2:16421360-16421382 GTATGCTGCCATCTGCTTCAAGG - Intergenic
926950962 2:18242956-18242978 GCATGGCAGCATCTGCTTCTGGG - Intronic
928719478 2:34102790-34102812 GCATGGCAGCATCTGCTTCTGGG + Intergenic
928892549 2:36220925-36220947 GAATTTCACCTTATGCTTCAAGG + Intergenic
930754797 2:54963384-54963406 ACATAACACCAGCTGCTTCATGG + Intronic
930832221 2:55757296-55757318 GCATGGCAGCATCTGCTTCTGGG + Intergenic
932334439 2:70922013-70922035 GAATGACATCATCTGCTTCTTGG - Intronic
934918061 2:98316904-98316926 GCATGGCAGCATCTGCTTCTGGG - Intergenic
935216201 2:100977072-100977094 AAATGAAACACTCTGCTTCACGG - Intronic
936474480 2:112827876-112827898 GCATGGCAGCATCTGCTTCTGGG + Intergenic
936719012 2:115226888-115226910 GAATGCAACCATATGCCTCATGG - Intronic
939830940 2:147069915-147069937 GAAATAGACCATCTGCCTCATGG - Intergenic
940269315 2:151874085-151874107 GCATGGCAGCATCTGCTTCTGGG - Intronic
940729907 2:157376596-157376618 GCATGGCAGCATCTGCTTCTTGG + Intergenic
941261681 2:163305897-163305919 GTATGGCAGCATCTGCTTCTGGG - Intergenic
941595319 2:167469304-167469326 GAATAACATTATCTGCTTTATGG + Intergenic
941962771 2:171269932-171269954 GCATGGCAACATTTGCTTCAGGG + Intergenic
942154866 2:173117834-173117856 GAATGACATCATCTGACACAGGG - Intronic
942597884 2:177609350-177609372 GGATGGCAGCATCTGCTTCTGGG - Intergenic
943104632 2:183529183-183529205 GCATGACAGCATCTGCTTGTAGG - Intergenic
943142702 2:184002572-184002594 GGATGGCAGCATCTGCTTCTGGG + Intergenic
943505471 2:188751119-188751141 GAATGAAACCATTTGATACATGG + Intronic
943557309 2:189421515-189421537 GAAAGCCACCATCTGCTTGGGGG + Intergenic
944516042 2:200512648-200512670 GAATGAAACCATCTGCAGAAAGG + Intronic
944785959 2:203070632-203070654 GCATGACAGCCTCTGCTTCTGGG + Intronic
945121948 2:206466843-206466865 GCATGGCAGCATCTGCTTCTGGG + Intronic
945122225 2:206468845-206468867 CCATGACAGCATCTGCTTCTGGG + Intronic
945178245 2:207065044-207065066 GAATTACACGATTTGATTCATGG - Intergenic
946648119 2:221861493-221861515 CAATGAAACCATCTGGTTCCTGG + Intergenic
1169984942 20:11433800-11433822 GATTCACACCATCTGCTCCCCGG + Intergenic
1170067859 20:12334074-12334096 GATTAACCCCATCTGTTTCAAGG - Intergenic
1172230011 20:33330267-33330289 GAATTACAGCATCAACTTCATGG - Intergenic
1172306837 20:33886706-33886728 ATATGACACTCTCTGCTTCATGG - Intergenic
1173145801 20:40523142-40523164 GAATCACACCTGATGCTTCAAGG + Intergenic
1174159491 20:48540847-48540869 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1176516679 21:7789508-7789530 GAATGACACCAACTCCACCAGGG - Intergenic
1176898047 21:14406204-14406226 GCATAACAGCATCTGCTTCCTGG - Intergenic
1178450213 21:32691380-32691402 GAATGGCAGCATCTGCTTCTGGG - Intronic
1178650707 21:34419520-34419542 GAATGACACCAACTCCACCAGGG - Exonic
1180757092 22:18169662-18169684 GCATGGCAGCATCTGCTTCTAGG - Intronic
1180990724 22:19934145-19934167 GAATGACAACACCTGCTGCCAGG - Intronic
1181074686 22:20367803-20367825 GCATGGCAGCATCTGCTTCTAGG + Intronic
1181913583 22:26260309-26260331 GAATGATACCATAGACTTCAGGG - Intronic
1182995970 22:34812733-34812755 ACATGACAGCATCTGCTTCTGGG - Intergenic
1183041243 22:35179757-35179779 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1183094657 22:35544826-35544848 GAATAACACCACCTGCTTTCTGG + Intronic
1183788013 22:40042754-40042776 AAAAGAAACCATCTGCTTCAAGG + Exonic
1183831405 22:40420182-40420204 GAATGACACCAGCTTCCTCGTGG - Intronic
1184644629 22:45889312-45889334 GAAAGAGTCCATGTGCTTCAGGG - Intergenic
1184802705 22:46771536-46771558 GAATGACACAATAGACTTCAGGG - Intronic
1185018512 22:48359499-48359521 GGATGGCACCCTCTGCTCCAAGG + Intergenic
949285301 3:2395755-2395777 GAATGACATCATGTCATTCATGG - Intronic
949449600 3:4170882-4170904 GACTGACTTCATCTGCTTCTGGG - Intronic
949515429 3:4803042-4803064 GCATGGCAGCATCTGCTTCTGGG + Intronic
949607946 3:5675180-5675202 GTATGGCAGCATCTGCTTCTGGG + Intergenic
950320882 3:12051786-12051808 GTATAACAACATCTGCTTCAAGG + Intronic
950598474 3:14008224-14008246 GTATGACAGCATCTGCTTCTGGG - Intronic
951212466 3:19990540-19990562 GAATCTCACCCTCTGCTTCCTGG - Intronic
952074298 3:29676970-29676992 GCATGACAGTATCTGCTTCTGGG + Intronic
952357194 3:32595276-32595298 CACTGACAGCATCTGCTACAAGG + Intergenic
952870866 3:37899973-37899995 GAATGACATGACCTACTTCATGG - Intronic
953706642 3:45236142-45236164 GCATGGCAGCATCTGCTTCTGGG - Intergenic
953992008 3:47491322-47491344 GCATGGCAGCATCTGCTTCTGGG + Intergenic
955636137 3:61031729-61031751 AAATGCCATCATCAGCTTCAAGG + Intronic
956888705 3:73587806-73587828 GAATGACATCATGTCATTCAAGG - Intronic
957768695 3:84659379-84659401 GCATGGCAGCATCTGCTTCTGGG - Intergenic
957803533 3:85117519-85117541 GAATGACACTATAAGCCTCAGGG + Intronic
959105102 3:102056896-102056918 GCATGGCAGCATCTGCTTCTGGG + Intergenic
960150531 3:114244658-114244680 GCATGGCAGCATCTGCTTCTGGG - Intergenic
960150784 3:114246694-114246716 GCATGGCAGCATCTGCTTCTGGG - Intergenic
960959714 3:123061728-123061750 GTATGGCAGCATCTGCTTCTGGG + Intergenic
963096316 3:141545337-141545359 GCATGGCAGCATCTGCTTCTGGG + Intronic
963217656 3:142767791-142767813 GAATGACATCTTTTGCTTAATGG + Intronic
963433897 3:145243762-145243784 GAATTTCACCATCTGCTTTAGGG + Intergenic
964563968 3:158029520-158029542 TAATGCCAGCACCTGCTTCATGG - Intergenic
964718926 3:159752522-159752544 GCATGACAGCATCTGCTTCTGGG + Intronic
969625387 4:8302343-8302365 GAATGACACCTGCTGCTTCCTGG + Intronic
969696551 4:8738260-8738282 GAATGAGACCCTCTGCCTCCCGG - Intergenic
970399759 4:15705917-15705939 GAATGGCAACATCTACTTCTGGG + Intronic
971405046 4:26314685-26314707 GCATGACAGCATCTGCTTCTGGG - Intronic
971712237 4:30129270-30129292 GCATGGCAGCATCTGCTTCTGGG - Intergenic
971755081 4:30697210-30697232 GCATGGCAGCATCTGCTTCTAGG + Intergenic
973335757 4:48954963-48954985 GAATGACTCCATCTGGATAAAGG - Intergenic
974215750 4:58844258-58844280 AAGTGACACCATCTATTTCAGGG + Intergenic
975028010 4:69576409-69576431 GAGCGCCACCCTCTGCTTCATGG - Intergenic
976306116 4:83560920-83560942 GCATGGCAGCATCTGCTTCTGGG - Intronic
977034185 4:91928382-91928404 GTATGGCAGCATCTGCTTCTGGG - Intergenic
978226904 4:106346927-106346949 GCATGGCAGCATCTGCTTCTGGG + Intronic
978808651 4:112826832-112826854 GAATGGAACAATATGCTTCAGGG + Intronic
979027833 4:115598796-115598818 GCATGACAGCATCTGTTTCTGGG - Intergenic
979166544 4:117539679-117539701 GTATGGCAGCATCTGCTTCTGGG - Intergenic
979669503 4:123347173-123347195 GGATGCCACCATCTGCATCTGGG - Intergenic
980630037 4:135418913-135418935 GTATGAAGCCAACTGCTTCAGGG - Intergenic
980910817 4:138992811-138992833 TAATGAAACCTTCTGCTTCTAGG - Intergenic
980953354 4:139403861-139403883 GCATGGCAGCATCTGCTTCTGGG + Intronic
983010529 4:162540150-162540172 GCATGGCAGCATCTGCTTCTGGG + Intergenic
983804924 4:171982971-171982993 GAATGTAACCATCTGCTTCATGG + Intronic
984717818 4:182942250-182942272 GAGTTACACCATCAGCTTCCTGG + Intergenic
986684442 5:10263844-10263866 GAATGACAGCTTTTGCTTAAAGG + Intronic
986975575 5:13389453-13389475 GCATGGCATCATCTGCTTCTGGG + Intergenic
987342431 5:16950668-16950690 GCATGGCAGCATCTGCTTCTGGG - Intergenic
987601433 5:20077064-20077086 GAATGTCAACATCAGTTTCAAGG - Intronic
990095486 5:52107175-52107197 GCATGGCAGCATCTGCTTCTAGG + Intergenic
990560871 5:56981550-56981572 GTATAACAGCATCTGCTTCTGGG - Intergenic
991566993 5:68015435-68015457 GACTGACAGTATCTGCTACAAGG - Intergenic
993005553 5:82425036-82425058 GCATGGCAGCATCTGCTTCTAGG + Intergenic
993551747 5:89281746-89281768 GAAGGATACGCTCTGCTTCAAGG + Intergenic
994583013 5:101671834-101671856 AAAGGACAAAATCTGCTTCACGG + Intergenic
994739999 5:103606172-103606194 GCATGGCACCATCTCCTTCTGGG + Intergenic
995017438 5:107326816-107326838 CAGTGACAACATCTGCTACAGGG + Intergenic
996096576 5:119405607-119405629 GAATGACACCATATATCTCATGG - Intergenic
996120005 5:119660680-119660702 GCTTGACACAATCAGCTTCAAGG - Intergenic
998760727 5:145429061-145429083 TAATGTCACCCTCTGCTTAAGGG - Intergenic
999677874 5:154023592-154023614 GAATGACACAATGGGCTTCGGGG + Intronic
1000561221 5:162791894-162791916 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1001323589 5:170702713-170702735 TAATCACATCATCTGCTTGATGG - Intronic
1001535859 5:172497447-172497469 AATTGACAGCATCTGCTCCATGG - Intergenic
1003168849 6:3704441-3704463 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1003745943 6:9002221-9002243 GCATGACAGTATCTGCTTCTGGG - Intergenic
1004143012 6:13038158-13038180 TAATAACAGCATCTGCTTCATGG - Intronic
1005221327 6:23592092-23592114 GAAGGATAGCATCTGCTTCTGGG - Intergenic
1005260757 6:24056776-24056798 GAATTATACCATCGGCTTCCTGG + Intergenic
1010249306 6:73691904-73691926 GCATGTCAGCATCTGCTTCTAGG + Intergenic
1010320661 6:74504979-74505001 GAATGACTCCTTCTGCTTGGGGG + Intergenic
1010935129 6:81851349-81851371 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1011176216 6:84563785-84563807 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1012017835 6:93874435-93874457 GCATGACAGTATCTGCTTCTGGG - Intergenic
1013080278 6:106806080-106806102 GAATGACGCCCCCTGCTCCATGG + Intergenic
1014044023 6:116862728-116862750 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1014281246 6:119444499-119444521 GCATGACAAGATCTGCTTCTGGG - Intergenic
1015937216 6:138415938-138415960 GAGGGACACCTTTTGCTTCATGG - Exonic
1016670434 6:146699295-146699317 GAGTTACACCATCAGCTTCCTGG - Intronic
1017363637 6:153605952-153605974 TAATGCCAGCATCTGCTTCTGGG + Intergenic
1017511500 6:155118265-155118287 GAAAGACCCCAGCTCCTTCAGGG - Intronic
1017812901 6:157996853-157996875 GCATGGCAGCATCTGCTTCTTGG - Intronic
1019617524 7:1972475-1972497 GCATAACACCCTCTGCTTAATGG + Intronic
1021607224 7:22420301-22420323 GGAGGACACCATCTGGTTCTAGG - Intronic
1021615287 7:22497791-22497813 GCATGGCAACATCTGCTTCTGGG + Intronic
1023770497 7:43552545-43552567 GAGTGAGAGCAACTGCTTCATGG - Intronic
1024839671 7:53571055-53571077 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1025937492 7:66048944-66048966 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1026205920 7:68257323-68257345 GAATGAGCCCATCTCCTTCTGGG - Intergenic
1026509351 7:71015648-71015670 CGATGACCTCATCTGCTTCAGGG - Intergenic
1026612894 7:71876041-71876063 AAGTGACTCCCTCTGCTTCATGG + Intronic
1028206738 7:88026226-88026248 GCATGGCATCATCTGCTTCTGGG + Intronic
1028292705 7:89086689-89086711 TAATTCCACCATCTGCTGCATGG - Intronic
1028377206 7:90156841-90156863 GCATGGCAACATCTGCTTCTGGG - Intronic
1029034348 7:97503366-97503388 GCATGGCAGCATCTGCTTCCGGG + Intergenic
1029162488 7:98562619-98562641 GAATGAAGCCAGGTGCTTCATGG + Intergenic
1029917736 7:104229793-104229815 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1031565890 7:123296553-123296575 GAGTGACTCCTTCTGCTTGAGGG + Intergenic
1032288058 7:130558419-130558441 GCATGGCAGCATCTGCTTCTGGG - Intronic
1033822039 7:145146731-145146753 GAATTACACCACCAGCTTCTTGG + Intergenic
1034108482 7:148513225-148513247 GCATAACAGCATCTGCTTCTAGG + Intergenic
1034875351 7:154720387-154720409 GAATGATAACATCTGCTTTGTGG - Intronic
1035865230 8:3075160-3075182 GTATGGCAGCATCTGCTTCTGGG - Intronic
1036123778 8:6045097-6045119 GAGTGCCACCACCTGCTCCAGGG - Intergenic
1038172122 8:25145125-25145147 GCATGACAGCATTTGCTTCTGGG + Intergenic
1038823681 8:30977541-30977563 GCATGACAGCATCTGCTTCCGGG + Intergenic
1039195243 8:35023835-35023857 AAGTGAAACCATCTGCCTCAGGG + Intergenic
1042197264 8:66241709-66241731 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1042312090 8:67388878-67388900 GCATGGCAGCATCTGCTTCTAGG - Intergenic
1042733833 8:71965491-71965513 GCACGACAGCATCTGCTTCTGGG - Exonic
1042749234 8:72140026-72140048 GCATGGCAGCATCTGCTTCAGGG - Intergenic
1044430351 8:92101577-92101599 GAATGAGACCATGGGCTGCACGG + Intronic
1046267338 8:111847567-111847589 GCATGGCAGCATCTGCTCCAGGG + Intergenic
1046659758 8:116937227-116937249 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1049589085 8:143447640-143447662 GCATGGCAGCATCTGCTTCTGGG + Intronic
1049929615 9:443795-443817 GAATGACAAAATCTACTTCCAGG - Intronic
1050360098 9:4821978-4822000 GAATGACACTCTGTGCCTCAGGG + Intronic
1051845048 9:21442226-21442248 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1052768439 9:32665625-32665647 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1053387507 9:37706130-37706152 GAAAGACTCCCTCTGCTTCTAGG + Intronic
1053613620 9:39741381-39741403 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1053871661 9:42499337-42499359 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1054239894 9:62601016-62601038 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1054554027 9:66635543-66635565 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1054812134 9:69443316-69443338 GAATGACCTCATCTGCATCCAGG + Intronic
1055089485 9:72348155-72348177 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1055633909 9:78255276-78255298 GAATGTAACCAGCTGATTCAGGG + Intronic
1055651419 9:78410318-78410340 GAGTGCCACCACCTGCTCCACGG + Intergenic
1056468204 9:86879533-86879555 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1057872157 9:98726469-98726491 GACTGGCACCATCTGGTTCTGGG + Intergenic
1057937482 9:99253074-99253096 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1058414347 9:104770302-104770324 GAATAAAACCATCTCCTTGAGGG + Intronic
1058667671 9:107335605-107335627 GGCTGACACCACCTGCCTCAGGG - Intergenic
1059434892 9:114270208-114270230 GGCTGACACCACCTTCTTCAAGG - Intronic
1060338236 9:122748313-122748335 GAATGACACCCTTTCATTCAGGG - Intergenic
1060625883 9:125110888-125110910 GCATGGCAGCATCTGCTTCTGGG - Intronic
1060789051 9:126473489-126473511 GCATGGCAGCATCTGCTTCTGGG + Intronic
1061643828 9:131982568-131982590 GGATAACAGTATCTGCTTCATGG - Intronic
1061680028 9:132238397-132238419 GTATGAAACCATGTGCTTCCAGG + Intronic
1061861768 9:133472054-133472076 GAAGGACTCGATCTGCTCCAGGG + Exonic
1061993364 9:134172172-134172194 CTAAGACACCATCTACTTCAAGG - Intergenic
1185775106 X:2796939-2796961 GATTGAGACCATCTGCTGGAAGG + Intronic
1185788964 X:2914017-2914039 GCATGGCAGCATCTGCTTCTGGG - Intronic
1185935796 X:4256485-4256507 GCATGACATCATCTCCTTCTGGG + Intergenic
1186003269 X:5038801-5038823 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1186120649 X:6357677-6357699 GCATGGCAGCATCTGCTTCATGG + Intergenic
1186413824 X:9366191-9366213 GAATGACAGCATTCCCTTCAAGG - Intergenic
1186455274 X:9705912-9705934 GCATGGCAGCATCTGCTTCTGGG + Intronic
1186621806 X:11249240-11249262 GAATGACACAATAGACTTCAGGG + Intronic
1187083399 X:16015500-16015522 TAATGCCATCATCTGCTTCTGGG + Intergenic
1187217283 X:17289419-17289441 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1187633947 X:21205943-21205965 GAAAGACACCATGTGCTTGTGGG + Intergenic
1187718649 X:22129455-22129477 GATTGAGACCTTCTGCTTAAAGG - Intronic
1188665410 X:32813494-32813516 AAATGACAGCATCTACGTCATGG + Intronic
1192090596 X:68151887-68151909 GCATGGCAGCATCTGCTTCTGGG + Intronic
1192936870 X:75869615-75869637 CTATGACAGCATCTGCTTCTGGG - Intergenic
1192937122 X:75871671-75871693 GTATGGCAGCATCTGCTTCCGGG - Intergenic
1194134354 X:90121449-90121471 GCATGGCATCATCTGCTTCTGGG - Intergenic
1194362576 X:92971740-92971762 TAATGAAGCCATCTGCTCCAGGG + Intergenic
1196126692 X:112108993-112109015 GAGAGATACCATCTGCTTGAGGG - Intergenic
1196546764 X:116972579-116972601 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1196705866 X:118716974-118716996 GAATGCCACCCCCTGCTCCACGG - Intergenic
1197460699 X:126737042-126737064 GAGTGTCAGCATCTGCTTCTGGG + Intergenic
1198841846 X:140865511-140865533 GCATGACACCAGCTGGTGCAGGG - Intergenic
1198995430 X:142568524-142568546 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1199242004 X:145557637-145557659 GAATGGCAGCATCTGCTTCTAGG - Intergenic
1200050451 X:153426957-153426979 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1200670830 Y:6087960-6087982 TAATGAAGCCATCTGCTCCAGGG + Intergenic
1200758516 Y:7014367-7014389 GCATAACACCTTCTGCTTCTGGG - Intronic
1201295259 Y:12456543-12456565 GATTGAGACCATCTGCTGGAAGG - Intergenic
1201477404 Y:14397456-14397478 GCATGGCAGCATCTGCTTCTTGG - Intergenic
1201573070 Y:15434166-15434188 GAATGCCACCCCCTGCTCCACGG + Intergenic