ID: 1147757748

View in Genome Browser
Species Human (GRCh38)
Location 17:42780006-42780028
Sequence TGGCAAACAGAAGGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147757741_1147757748 6 Left 1147757741 17:42779977-42779999 CCGGATGTGGACTTTGGTTTATT No data
Right 1147757748 17:42780006-42780028 TGGCAAACAGAAGGGGAGGAAGG No data
1147757737_1147757748 30 Left 1147757737 17:42779953-42779975 CCAAGGGGAGCTGAGGGGGGTAA No data
Right 1147757748 17:42780006-42780028 TGGCAAACAGAAGGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147757748 Original CRISPR TGGCAAACAGAAGGGGAGGA AGG Intergenic
No off target data available for this crispr