ID: 1147757843

View in Genome Browser
Species Human (GRCh38)
Location 17:42780406-42780428
Sequence CCTCAGAGTGAGACTGCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147757840_1147757843 -9 Left 1147757840 17:42780392-42780414 CCACTCAGTTCTGGCCTCAGAGT No data
Right 1147757843 17:42780406-42780428 CCTCAGAGTGAGACTGCGGCCGG No data
1147757839_1147757843 -8 Left 1147757839 17:42780391-42780413 CCCACTCAGTTCTGGCCTCAGAG No data
Right 1147757843 17:42780406-42780428 CCTCAGAGTGAGACTGCGGCCGG No data
1147757837_1147757843 1 Left 1147757837 17:42780382-42780404 CCGCGGTCTCCCACTCAGTTCTG No data
Right 1147757843 17:42780406-42780428 CCTCAGAGTGAGACTGCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147757843 Original CRISPR CCTCAGAGTGAGACTGCGGC CGG Intergenic
No off target data available for this crispr