ID: 1147760094

View in Genome Browser
Species Human (GRCh38)
Location 17:42792320-42792342
Sequence CCCTGGGGATAGGGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 6, 3: 37, 4: 460}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147760094_1147760104 -6 Left 1147760094 17:42792320-42792342 CCAGCTTCCCCCTATCCCCAGGG 0: 1
1: 0
2: 6
3: 37
4: 460
Right 1147760104 17:42792337-42792359 CCAGGGTGGTATTCTGTCTTTGG 0: 1
1: 0
2: 0
3: 7
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147760094 Original CRISPR CCCTGGGGATAGGGGGAAGC TGG (reversed) Intronic
900094830 1:936133-936155 CCCTGTGGAAAGGGGGTGGCAGG - Intronic
900477406 1:2882426-2882448 CCCTGGTGCTATGGAGAAGCTGG - Intergenic
900610251 1:3541681-3541703 CCCTGGGGACAGTGGGAACCTGG + Intronic
900928124 1:5718856-5718878 CCATGGTGACAGGGGGACGCAGG + Intergenic
900934312 1:5755718-5755740 CCCTGGGCACAGGTGGCAGCTGG + Intergenic
901382449 1:8883601-8883623 CCCAGGGGAGCTGGGGAAGCTGG + Intergenic
902444225 1:16451906-16451928 CCCCTGGGGGAGGGGGAAGCAGG - Exonic
902487406 1:16758158-16758180 GCCTGGGGAAAGGGGAAAGTGGG + Intronic
902636950 1:17740886-17740908 GCCTGGGGAGAGGGGAAAGGCGG - Intergenic
902833685 1:19033836-19033858 TCCTGGGGATACGGGGATGAGGG - Intergenic
903277820 1:22232973-22232995 CTTGGGGGACAGGGGGAAGCTGG - Intergenic
903859127 1:26354549-26354571 CCCTGGGTATTGGGGGAGCCTGG + Intergenic
904252118 1:29232537-29232559 CACTGGGGAAAAGGGTAAGCAGG - Intergenic
904286193 1:29454580-29454602 CACAGGTGATAGGGTGAAGCAGG + Intergenic
904462740 1:30689927-30689949 CCCTAGGGGTGGGGGGCAGCGGG - Intergenic
904533259 1:31182494-31182516 CCCTGGGGAAGTGGGGAATCTGG - Intronic
904609263 1:31716003-31716025 ACCTGGAGATGGGGGGAAGAAGG - Intergenic
904884359 1:33725241-33725263 CCATGGGGATGGGGCCAAGCAGG + Intronic
904915202 1:33965217-33965239 CTCTGTGGAAAGTGGGAAGCAGG - Intronic
905275401 1:36814363-36814385 GCCTGGGGATAGGCAGGAGCAGG + Intronic
905369918 1:37477477-37477499 CCCTGGGGAGGGGGGGTGGCCGG - Intronic
905440929 1:37996328-37996350 CCTTGGGAAGAGGGGGAAGGGGG + Intergenic
905455427 1:38084924-38084946 GACTCTGGATAGGGGGAAGCTGG + Intergenic
905766349 1:40604819-40604841 CCATGGGGATAGGGTGCAGTTGG - Intergenic
905884376 1:41484016-41484038 CCATGGGGATTGGGGGCAGGGGG - Intronic
905907872 1:41631640-41631662 CCCTGGGGGTAGGAGGGGGCTGG - Intronic
906346713 1:45020035-45020057 CCCTGGGGGTAGAGGGAGGTGGG + Intronic
906416408 1:45623651-45623673 ACCTGGGGATAGGGTGTAGTAGG + Exonic
906662577 1:47593381-47593403 GCCAGGGGCTAGGGGGAGGCCGG + Intergenic
906678170 1:47708370-47708392 CACCGGGGAAACGGGGAAGCAGG + Intergenic
907651172 1:56296169-56296191 CCCTGCAGAGATGGGGAAGCAGG + Intergenic
911150113 1:94590342-94590364 CCCTGGGGAGAGAGGGAGGGCGG - Intergenic
912504614 1:110147780-110147802 CCCAGGGGACAGGTGGAGGCTGG + Intergenic
912776759 1:112510335-112510357 CCATGGGGAGAGGGCAAAGCAGG + Intronic
912806178 1:112758758-112758780 CCATGGGGAGAGGGAGAAGGTGG - Intergenic
912917386 1:113829099-113829121 ACATGGGAGTAGGGGGAAGCAGG - Intronic
913236999 1:116793879-116793901 ACCTGAGGTTAGGGGGAAGGAGG - Intergenic
913364852 1:118026104-118026126 CCCTGGGGCTATGGGCAACCAGG - Intronic
914846986 1:151288869-151288891 CCATGGAGATGGGGGGAAGCAGG + Intronic
914911571 1:151791289-151791311 CCCTGGGGATTCGAGGAAACGGG + Exonic
915491218 1:156250995-156251017 TCCTGGGGATGGGGGGCAGAGGG + Exonic
915860349 1:159437689-159437711 CCCTGGGGCTGGGAGGATGCAGG - Intergenic
915970728 1:160353302-160353324 CCCTGGGGGTTGGTGGAAACAGG - Intronic
916003377 1:160637273-160637295 CCCTGGGGATACGGGAAAGCAGG - Exonic
917979528 1:180260388-180260410 CCCTGTAGAAAGGGGGCAGCAGG - Intronic
918216030 1:182392217-182392239 CCCTGGGGAAATGCGGAACCAGG + Intergenic
918420497 1:184359871-184359893 GCCTGTGGGTAGGGGGAAGGAGG - Intergenic
919586818 1:199449266-199449288 CCCTGGGGAAAGAAGGAACCAGG + Intergenic
919802002 1:201359726-201359748 GCCTGGGGATGGGGAGAAGGGGG + Intronic
919914978 1:202133670-202133692 CCCTGGGGAGGGGCGGGAGCTGG + Exonic
919915307 1:202135269-202135291 GCCTGGGGCTAGGGGACAGCGGG + Intronic
920539504 1:206767476-206767498 TCCTGGGGGTAGGGGGTAGCTGG + Intergenic
921068833 1:211642482-211642504 CCTTGGGAACAGGGGGAGGCTGG + Intergenic
923273719 1:232379283-232379305 CACTGGGGAGAGGGGGTAGCGGG + Intergenic
923549955 1:234955598-234955620 CCCTGGGGGCAGGGGGCAGAGGG + Intergenic
924721667 1:246628728-246628750 CCCAGGGGATAGTGTGAAGAAGG - Intronic
924787140 1:247209448-247209470 CCCTGGGGCTGAGAGGAAGCTGG - Intergenic
1062978529 10:1702661-1702683 CCCTGGGGAATGGGGGCAGAAGG - Intronic
1065488599 10:26258542-26258564 TCCTGGGGATAGTGGGGAGGGGG - Intronic
1065549843 10:26860108-26860130 CCCGGAGGAGAGGAGGAAGCGGG - Intronic
1065957337 10:30705283-30705305 CGCTGGGGAAAGGGGGAGTCCGG + Intergenic
1066331048 10:34423305-34423327 ACCTGGGGTTAGGGGGATGGTGG + Intronic
1067510364 10:46889939-46889961 CCCTGGGTATAGGTACAAGCTGG + Intergenic
1067573564 10:47389115-47389137 CCCTGGGGAGAGGAGGAAACTGG + Intergenic
1067651889 10:48161918-48161940 CCCTGGGTATAGGTACAAGCTGG - Intronic
1067660753 10:48234880-48234902 CCCTGCAGAGCGGGGGAAGCTGG + Intronic
1069078080 10:64059350-64059372 CCCTGGGGATAGTGGGGTGTGGG + Intergenic
1069204625 10:65666489-65666511 CCCTGGGCTTAGAGGGAAGGTGG - Intergenic
1071858017 10:89645182-89645204 GCCTGGGGATCAGGGGAAGGCGG - Exonic
1073001238 10:100287559-100287581 GGCTGGGGATAAGGGGTAGCTGG - Intergenic
1073062032 10:100738964-100738986 CCTCGGGGAAAGGGGGAAGGAGG - Intronic
1073101354 10:101008411-101008433 TCCTGGGGATAACGGGATGCTGG + Intronic
1073249978 10:102115223-102115245 GCCTGGGGCTCGGGGGAGGCGGG - Intronic
1073424064 10:103445780-103445802 ACCTGGGGATTGTGGGCAGCAGG + Exonic
1075103911 10:119524654-119524676 CCCAGGGGAAAGTGAGAAGCAGG - Intronic
1077026512 11:442227-442249 ACCTGGTCCTAGGGGGAAGCAGG + Intergenic
1077069291 11:660586-660608 CCCTGGGGACACGGGGATGGCGG + Intronic
1077113640 11:873068-873090 CCCTGGGGACGAGGAGAAGCTGG + Intronic
1077192789 11:1262421-1262443 CCCAGGGGACAGGGGGCAGGGGG + Intergenic
1077257847 11:1596852-1596874 CCCAGAGGAGAGCGGGAAGCTGG + Intergenic
1077330669 11:1982630-1982652 CCCTGGGGCTTGGGGAAAGCCGG - Intronic
1077522572 11:3045068-3045090 CCCGGGGGGTAGGGAGAGGCCGG + Intronic
1077637354 11:3852549-3852571 GACTGGGGAGAGGGGAAAGCTGG - Intergenic
1078205940 11:9229501-9229523 CCTTGGGGAAAGGGGGATTCTGG - Intronic
1081694178 11:45098179-45098201 CCCTGGGGATGAGGGGAACGAGG - Intronic
1083121453 11:60516675-60516697 CCCTGGGGGCAGGGGGTAGGCGG + Intronic
1083171300 11:60925187-60925209 CCCTGGGGGAAGGGGGAGGGAGG - Intronic
1083306170 11:61762962-61762984 CCCTCGGGATAGGGGGCCTCAGG - Intronic
1083823152 11:65183603-65183625 CCCTGGGGAGGAGGGGCAGCAGG + Intronic
1084171836 11:67404651-67404673 GCTTGGGGAAAGGGGGAAGGAGG - Intronic
1084338578 11:68476448-68476470 CCGTGGGGAGAGGGGGGAGGGGG + Intronic
1084667429 11:70583964-70583986 CCCAGAGGTTAGAGGGAAGCAGG - Intronic
1084698903 11:70773045-70773067 CCCTGGGGATGGGCGGAGACTGG - Intronic
1084804135 11:71567039-71567061 CCCAGAGGAGAGCGGGAAGCTGG - Intronic
1084806298 11:71581530-71581552 CCCAGAGGAGAGCGGGAAGCTGG + Intronic
1085261258 11:75205925-75205947 TGCTGGGGGTGGGGGGAAGCTGG + Exonic
1085273458 11:75283717-75283739 CCCTGGGGAGAGGTGGGAGGGGG - Intronic
1085317753 11:75555607-75555629 CCCTGGGGAAGGTGGGAGGCTGG - Intergenic
1085322701 11:75584392-75584414 CCCTGGGGCTGGGGGGAGGATGG - Intergenic
1085478908 11:76805834-76805856 CTCTGGGGATGAGTGGAAGCTGG - Intergenic
1085505385 11:77055959-77055981 CCCTGGGGATGGTGGGGAGGTGG + Intergenic
1087111629 11:94475963-94475985 CCTTTGGGATAGGGGGAAGCAGG + Intronic
1087128400 11:94648116-94648138 CAATGGGGATTTGGGGAAGCAGG + Intergenic
1088907832 11:114168255-114168277 TCCTGGGGCTGGAGGGAAGCAGG - Intronic
1088917513 11:114238753-114238775 CCCTGGGGATGGAGACAAGCTGG - Intronic
1089340448 11:117753929-117753951 TCCTGGGGACAAGGTGAAGCAGG + Intronic
1089395791 11:118135863-118135885 CCCTGGGGTTGGGGAGGAGCAGG - Exonic
1089654185 11:119935134-119935156 CCCTGAGGATAGGTGGAAGCTGG - Intergenic
1089709151 11:120302469-120302491 CTCTGGGGAGAGGGGATAGCAGG + Intronic
1089722283 11:120437733-120437755 GCCAGGGGCTAGGGGGAAGGGGG - Intronic
1089800706 11:121024462-121024484 CCCTGGGGCTAGAGGGAGGATGG + Intronic
1090237261 11:125158521-125158543 CCCTGGGTACAGGGAGAAGAGGG + Intergenic
1090836201 11:130455871-130455893 GCCTGGGGAGAGGGAGAGGCAGG - Intronic
1091062233 11:132474392-132474414 CCCAGGGGATATGGAAAAGCAGG + Intronic
1091347696 11:134866359-134866381 TCCTGGCGAGAGGGGGAAGCAGG - Intergenic
1202813647 11_KI270721v1_random:37809-37831 CCCTGGGGCTTGGGGAAAGCCGG - Intergenic
1091545264 12:1497484-1497506 CTCTGGGGCTGGGGGGAAGCTGG + Intergenic
1091724173 12:2834250-2834272 ACCTGTGGTTCGGGGGAAGCAGG + Intronic
1092742216 12:11640848-11640870 CACTGGGGATAGTGGGATACTGG - Intergenic
1092947882 12:13473707-13473729 CTCTGGGGAGAGGAGGAAGATGG + Intergenic
1093225077 12:16473186-16473208 TCCTGGGGATGGGGGGAATGTGG - Intronic
1096303294 12:50451218-50451240 AGCTAGGGATAGGGGGAGGCAGG - Intronic
1096500299 12:52060580-52060602 AGCTGTGGATGGGGGGAAGCAGG + Intergenic
1096746781 12:53733896-53733918 CTATGGGAATCGGGGGAAGCGGG + Intergenic
1097191704 12:57222506-57222528 GCATGGGGATAGGGGGGACCTGG + Intronic
1097322736 12:58244229-58244251 CCCTGGGTCTAGGGGGTAGTTGG + Intergenic
1097333813 12:58360081-58360103 CCCTGGGGATATAGGCAAGTGGG + Intergenic
1097806482 12:63970051-63970073 GTCTGGGGAAAGGGGGAAGGTGG - Intronic
1098166532 12:67704282-67704304 CTCTGGGGAGAAGGGGCAGCTGG - Intergenic
1100373628 12:93992301-93992323 CCCTGGGAATGGGGGGAATGTGG + Intergenic
1101018277 12:100524941-100524963 TCTTGGGGATATGGGGAAGATGG + Intronic
1101874421 12:108589290-108589312 CCCTGGGGCTGGGGGGCAGTGGG - Intergenic
1102191641 12:110993156-110993178 CCCTAGGGATAGGGGGACTCTGG + Intergenic
1102370023 12:112375084-112375106 ACCTGGGGATAGAGGCAGGCAGG - Intronic
1102527507 12:113522176-113522198 CTCTGGGGATGAGGGGTAGCTGG - Intergenic
1102992949 12:117327839-117327861 CCCTGGGCAGAGGGGAAACCAGG - Intronic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1104720991 12:131045192-131045214 CCCTGGGGACTGGGGGACGAGGG - Intronic
1104764087 12:131315310-131315332 CCCTGGGGATGGGGAGCAGGTGG + Intergenic
1106665505 13:31846949-31846971 CCCCGGGGCGAGGGGCAAGCGGG - Intergenic
1107612561 13:42130805-42130827 CCCTGGGGATCAGGGGAGACGGG - Intronic
1107742314 13:43464419-43464441 CCCTGGGGACCTGGGGAAGGAGG + Intronic
1108179772 13:47829231-47829253 CCCTGGGAATGGAGGTAAGCTGG - Intergenic
1113631059 13:111884153-111884175 CCCTGGGAACAGGTGGAATCTGG + Intergenic
1113715323 13:112501815-112501837 CCCTTGTGAAAGTGGGAAGCGGG - Intronic
1113913812 13:113858073-113858095 CCCTGGGGGTCTGAGGAAGCTGG + Intronic
1113947186 13:114050976-114050998 CGCTGGGGAAAGGGGGCAGCCGG + Intronic
1114246763 14:20921654-20921676 TCCTGGAGATAGGGAGTAGCTGG + Intergenic
1114432274 14:22671608-22671630 CCCTGGGGCTAGAGGAAATCAGG + Intergenic
1116043456 14:39714318-39714340 CCATGGGGATAGAGGGATGTGGG + Intergenic
1116660719 14:47707087-47707109 GGCTGGGGATAGGGAGAAGTGGG + Intergenic
1117736966 14:58777528-58777550 CCCTGGGCAGGGGTGGAAGCGGG - Intergenic
1117837025 14:59818385-59818407 CCCTGGGGATTGGAGAAGGCAGG - Intronic
1118112304 14:62735320-62735342 CCCTGGTTATAGGGCAAAGCAGG + Intronic
1119086056 14:71739847-71739869 TCCTGGGGAAAGGGAGAAGCAGG - Exonic
1121102497 14:91259739-91259761 CCATGGGCATCGGGGGAAGAAGG - Intergenic
1121530714 14:94651430-94651452 GCCTGGGGAAAGGGGGAAAGCGG + Intergenic
1122078967 14:99253935-99253957 CTCTGGGGATGGGGCGAAGCTGG - Intronic
1122778425 14:104133352-104133374 CCCTGGGGGAAGAGGGAAGGAGG + Intergenic
1122894287 14:104748316-104748338 TCCTGGGGAGAGGGGGCTGCGGG + Intergenic
1123072688 14:105649389-105649411 CCCTGGGGCCTGGGGGATGCTGG + Intergenic
1123092715 14:105748914-105748936 CCCTGGGGACCGGGGGATGCTGG + Intergenic
1123103021 14:105818580-105818602 CCCTGAGGATGGTGGGAACCTGG - Intergenic
1124837689 15:33211248-33211270 CCCTGTGGATAAGGGAAAACAGG + Intergenic
1125609367 15:40960368-40960390 CACTGGAGATAGAGGCAAGCAGG + Intergenic
1125828162 15:42693160-42693182 CCCTGGGGAATGAGGGGAGCTGG - Exonic
1125831296 15:42718731-42718753 CCCTGGGGACAGAGGGAAATGGG - Exonic
1126089729 15:45040883-45040905 TCCTGGGGAGTGGGGAAAGCTGG - Intronic
1127790313 15:62392518-62392540 CTCTGGAGTGAGGGGGAAGCGGG + Intronic
1128136360 15:65266522-65266544 CCCTGCTGATGTGGGGAAGCAGG - Intronic
1128545618 15:68565849-68565871 CCCAGGGGAGAGGGGGAAACTGG - Intergenic
1129390192 15:75216420-75216442 AGCTGGGGGCAGGGGGAAGCTGG - Intergenic
1129732279 15:77939270-77939292 AGCTGGGGGCAGGGGGAAGCTGG + Intergenic
1130458952 15:84143933-84143955 CCCTGGGGGTAGGGGTAGGAGGG + Intergenic
1131029616 15:89175582-89175604 CCCTTGGGATAAGAGGAAACAGG - Intronic
1132294136 15:100722973-100722995 CCCTGGGTAGAGGGAGAAGAGGG - Intergenic
1132514534 16:360044-360066 CGCTGGGGATAGTGGGCAGAAGG - Intergenic
1132558328 16:582463-582485 CCCTGGGGGTAAGGGGGAGGGGG - Intronic
1133277149 16:4645857-4645879 CCCAGGGGATGTGGGGAGGCTGG + Intronic
1134052212 16:11145088-11145110 GCCTGAGGATAGGGGTCAGCAGG + Intronic
1134428906 16:14182236-14182258 CCCGTGGGAGAGGGGGAGGCAGG + Intronic
1135135258 16:19882601-19882623 CCATGGGGATAGAGAGACGCTGG - Intronic
1136104319 16:28018678-28018700 GCCTGGGGGTGGGGGGAAGGTGG - Intronic
1136135718 16:28255821-28255843 CCATGGGGCTGGGGGGAGGCGGG + Intergenic
1136188348 16:28601065-28601087 GCCTGGGGCTAGGCTGAAGCCGG - Intergenic
1136190820 16:28614059-28614081 GCCTGGGGCTAGGCTGAAGCCGG - Intronic
1136497171 16:30651575-30651597 GCCTGGGGTAAGGGGGGAGCGGG - Exonic
1137566857 16:49538650-49538672 CCCTTGGGCCAGGAGGAAGCTGG - Intronic
1138174583 16:54884960-54884982 ACCTGGTGATAGGGGGTAGGGGG + Intergenic
1138350716 16:56344979-56345001 CCCTGGGGACAGAGGACAGCAGG + Exonic
1138481368 16:57305493-57305515 CCCAGGGGAATGGGGGAATCTGG + Intergenic
1138638371 16:58362226-58362248 GCCTGGGGCTAGGGGAAAGGTGG + Intronic
1139477922 16:67212133-67212155 CTCTGGGGAGAGGGAGAAGAGGG + Intronic
1139489351 16:67278412-67278434 CCCTGGGGAGAGGGGGCACCGGG - Exonic
1140046584 16:71443646-71443668 CCTTGGGGAGAGGGGAGAGCAGG - Intergenic
1141220493 16:82065067-82065089 CCCTGTGGGGAAGGGGAAGCTGG + Intronic
1142414874 16:89935894-89935916 CCCTAGGGCGAGGGGAAAGCAGG - Exonic
1142624263 17:1181739-1181761 CCCAGGGGAAAGGTGGAAACGGG + Intronic
1142758297 17:2028616-2028638 CCCTGGGGATCCAGAGAAGCTGG + Intergenic
1143102582 17:4512553-4512575 CCCAGGGTACAGAGGGAAGCAGG - Intronic
1144166875 17:12620860-12620882 TCCTGGGGTTAGGGTGAAGAAGG - Intergenic
1144462167 17:15467058-15467080 CCCAGGGGATGGGGGGGAACGGG + Intronic
1144560267 17:16315478-16315500 CCCTGGGGACAGGGGGACCAAGG - Intronic
1144873147 17:18382722-18382744 CCCTGGGGATAGGGGTGGGTGGG + Intronic
1144949081 17:18984429-18984451 CCCCGGGGAACGGGGGAACCTGG + Intronic
1145014016 17:19385280-19385302 CCCTGGGGAGGAGGGGCAGCTGG + Exonic
1146487399 17:33254517-33254539 ACCTGGGGGTAAGAGGAAGCTGG - Intronic
1147211560 17:38875141-38875163 CTGTGGGGGTAGGGGGAGGCAGG + Intronic
1147253558 17:39167693-39167715 TCCTGGGGTTAGTGGGATGCGGG + Intergenic
1147446848 17:40479885-40479907 CCCTGGGCAGAGGGAGAACCTGG - Intronic
1147760094 17:42792320-42792342 CCCTGGGGATAGGGGGAAGCTGG - Intronic
1147993628 17:44349911-44349933 CACTGGGGATAGGAGGGTGCGGG + Intronic
1149821754 17:59786688-59786710 CCCTGTGGTTACAGGGAAGCTGG - Intronic
1151507346 17:74538450-74538472 CACTGGAGATAGGGGCAAGGTGG - Intergenic
1151748095 17:76022309-76022331 CCCTGGGGATAGGGGTGGGTGGG - Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152422832 17:80203411-80203433 CCCTGGGGATCGGAGCCAGCAGG + Intronic
1152747695 17:82048898-82048920 CCGTGGGTACAGGGAGAAGCCGG + Intronic
1152755813 17:82086557-82086579 CCCTGGGGAGGGAGGGAGGCAGG + Exonic
1152903077 17:82956486-82956508 CCCTGGGGGCAGGAGGCAGCTGG - Intronic
1156125799 18:33903886-33903908 CCCTGGGCATAGAGGGAGGGTGG - Intronic
1156987189 18:43362000-43362022 AGCTGGGGAAAGGGAGAAGCTGG + Intergenic
1157691123 18:49682709-49682731 CCCTGGGCACTGGGGGAAGTAGG + Intergenic
1159003255 18:62991616-62991638 CCCTGAGGTTAGTGGGAAGGAGG + Intergenic
1159226487 18:65544352-65544374 CCCGGGGGCTAGGGAGAAGGGGG - Intergenic
1160300348 18:77672409-77672431 GCCTGGGGAGACGGGGGAGCGGG + Intergenic
1160338292 18:78062669-78062691 CCCTGGGGAAAGGAGGAAGGTGG + Intergenic
1160624313 18:80192534-80192556 CCCAGGGGATGGGGGAGAGCAGG + Intronic
1160710337 19:548521-548543 TCCTGGGGACAGAGGGAATCAGG - Exonic
1161267256 19:3370039-3370061 CCCTGGGGATAGGTGGGGGTGGG + Intronic
1161426918 19:4208743-4208765 GGCTGGGGAGAGAGGGAAGCAGG - Exonic
1161698349 19:5782566-5782588 TCCTGGGGACAGGAGGCAGCTGG + Intergenic
1161719241 19:5894150-5894172 CCCTGGGGCTAGGGCAGAGCGGG - Intronic
1161964280 19:7539829-7539851 CCCTGGGGAAAGGGGTATGCGGG + Intronic
1161981891 19:7634187-7634209 CCCTGGGGACAGAGGCAGGCGGG + Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162745058 19:12793474-12793496 CCCTGGAGATCTGGGGACGCGGG - Intronic
1163376409 19:16935172-16935194 CCATGGGGAGAGGGGGAAACGGG - Intronic
1163537552 19:17885736-17885758 AGCTGGGGAGAGGGGGAAGTGGG - Intronic
1163814909 19:19458880-19458902 CTCTGGAGAGAGGGGGAAGCTGG - Intronic
1165015851 19:32879545-32879567 CCCTGGGAATGGGGAGCAGCAGG + Intronic
1165015868 19:32879610-32879632 CCCTGGGAATGGGGAGCAGCAGG + Intronic
1165353881 19:35292052-35292074 CCCCGGGGGTAGGGAGGAGCTGG + Intergenic
1165426161 19:35746556-35746578 GGCAGGGGAGAGGGGGAAGCGGG + Intronic
1166727776 19:45039158-45039180 GCCTGAGGAAAGGGAGAAGCTGG - Intronic
1167105363 19:47427307-47427329 CACTGGGGATAGCGGGGCGCCGG - Intergenic
1167426031 19:49430158-49430180 CCCTGGAGATAAAGGAAAGCGGG + Exonic
1168474704 19:56667484-56667506 CCCTCGGGAGAAGGGGAGGCTGG - Intronic
925361965 2:3285998-3286020 CCCTGAGGACATGGGGCAGCCGG + Intronic
925824831 2:7837492-7837514 GCCTGGGGAGAGTGGGAAGCTGG - Intergenic
926117695 2:10223804-10223826 CCATGGGGGTCGGGGGATGCAGG - Intergenic
927152414 2:20203665-20203687 CCCTGGGGGTAGGGGAAGGCGGG + Intronic
928003914 2:27546232-27546254 CACTGGGGATAGGGGTAGGGAGG - Intronic
928458400 2:31446583-31446605 GCCAGGGGATAGGGGGAGGAGGG - Intergenic
928595695 2:32856977-32856999 CCCTGGGGATAGGTGGGCACTGG - Intergenic
929452272 2:42046128-42046150 CCCTGGGGAAAACGGGGAGCTGG - Intergenic
929769232 2:44878229-44878251 CCCTGGGGCTAGAAGGAGGCAGG - Intergenic
929892468 2:45929712-45929734 TCCTGGGGGTGGGGGGAAGATGG - Intronic
929901943 2:46012523-46012545 TGCTGGGGACAGGGGGAAGTGGG - Intronic
930099625 2:47592872-47592894 GCCAGGGGATAGGGGGAGGAGGG + Intergenic
931355756 2:61537220-61537242 CCCTGGGGCTGGGGAGAAGTTGG - Intronic
931758483 2:65395363-65395385 CCCTGGAGAGAAGGGGAAGGGGG - Intronic
932751406 2:74373905-74373927 TCCTGGGGATTGGGGGATACTGG + Intronic
932854633 2:75220376-75220398 ACCAGGGGCTAGGGGGAAGAGGG - Intergenic
933332315 2:80909442-80909464 CCCTATGGATATGGGGATGCAGG - Intergenic
933748113 2:85585298-85585320 CCCTAGGGAAAGGGAGAAACTGG - Intronic
934562553 2:95320729-95320751 CCCTGGAGTTTGGGGGATGCAGG - Intronic
934950945 2:98575012-98575034 CCCTGGGGATAAGGGGTTGTGGG + Intronic
936045508 2:109184676-109184698 TCCTGGTGGCAGGGGGAAGCAGG - Intronic
936531369 2:113278800-113278822 CCCAGGGGTTAGCTGGAAGCTGG - Intronic
936614311 2:114033042-114033064 CCATGGGGGTTGGGGGCAGCAGG - Intergenic
941580560 2:167292631-167292653 CGCTGGGGCGAGGGGGGAGCGGG - Intergenic
941773090 2:169363901-169363923 CCCTGGGGAAGGGAGGCAGCGGG - Intergenic
945146080 2:206739467-206739489 CCCTGGGGAATGTGGGAAGTGGG + Intronic
946156188 2:217808234-217808256 CCCTGGGGAATGGGGGAATGGGG - Intronic
946180371 2:217945437-217945459 CCTTGGGGATAGGGGAGAGAAGG + Intronic
946870289 2:224078669-224078691 CCCTGGGGGTGTGGGGAAGGTGG + Intergenic
947715989 2:232339058-232339080 CCCTGGACCTAGGGGGAAGATGG + Intronic
947735009 2:232449800-232449822 CCCTGGACCTAGGGGGAAGATGG + Intergenic
947736534 2:232458145-232458167 CCCTGGGGAGTGGAGGAAGGCGG + Intronic
948844575 2:240676940-240676962 CCATGGGGACGGGGGCAAGCCGG + Intronic
948849285 2:240697939-240697961 CCATGGGGACGGGGGCAAGCCGG - Intronic
1169143223 20:3237714-3237736 CCCTAGGGAGAAAGGGAAGCAGG + Intronic
1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG + Intronic
1169470306 20:5879310-5879332 TCCTGGGGATAGGTGGTAACAGG - Intergenic
1169574610 20:6944069-6944091 CCCTGGGTATGAGGGGAGGCAGG + Intergenic
1170154184 20:13254633-13254655 CTCTGGGCAAAGGGAGAAGCTGG + Intronic
1170653643 20:18265918-18265940 TCCTGGGGATAGGTGGAAGAAGG - Intergenic
1170653814 20:18267642-18267664 CCCTGGGGATAGGTGGAAGAAGG + Intergenic
1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG + Intergenic
1171891626 20:30723589-30723611 CCCAGGGGCTGCGGGGAAGCCGG + Intronic
1172113554 20:32561203-32561225 CCCTGGTGACAGGGGGCTGCTGG - Intronic
1172167789 20:32909481-32909503 GCCTGGGGCAAGGGGGAGGCAGG + Intronic
1172603268 20:36197997-36198019 CCCTTGGGGGAGGGGGAGGCGGG - Exonic
1172612845 20:36264640-36264662 GCCTGGGGATTGCGGGATGCAGG - Intronic
1172974107 20:38893882-38893904 CCCTGGGGTCAGGGGCAAGAGGG - Intronic
1173664982 20:44757036-44757058 CGCTGGGGATAGAGGCCAGCAGG + Exonic
1174452648 20:50629438-50629460 CCCTGGAGCGAGGGGGCAGCAGG + Intronic
1175238517 20:57529056-57529078 CCCTGGGGATAAGGAGGAGATGG - Intergenic
1175952595 20:62591325-62591347 CCCTGCGGATGTTGGGAAGCTGG + Intergenic
1176218255 20:63958204-63958226 CCCTGGGGAATGGGGGAGGGTGG + Exonic
1176257447 20:64159662-64159684 CCCTCGGCATCAGGGGAAGCTGG + Intronic
1177013397 21:15755224-15755246 CCTTGGGGATAGGTGTAAGGCGG - Intronic
1177774085 21:25549092-25549114 GTCTGGGGAGAGTGGGAAGCAGG - Intergenic
1178352287 21:31880868-31880890 CACTGGGCAGAGGGAGAAGCTGG + Intronic
1178959937 21:37056343-37056365 CCCTGGGGATAGTGGAGAGAGGG + Intergenic
1179050999 21:37888578-37888600 CCATGGGGATGGGAGGAAGGTGG + Intronic
1180636434 22:17266111-17266133 CCCTGGGGGAAAGGGGAAGGTGG - Intergenic
1180919489 22:19513580-19513602 CCATGGGGACAGTGGAAAGCAGG - Intronic
1181727245 22:24820117-24820139 CTCTGGGGATAGAAGGAGGCTGG + Intronic
1182231231 22:28838955-28838977 GCCTGGGGGCAGGGGCAAGCTGG - Intergenic
1182236475 22:28881004-28881026 GCCAGGGGATAGGGGGAGGCAGG - Intergenic
1183264189 22:36815635-36815657 TCCTGGGGTTAGGGGGAGGAGGG + Intronic
1183492288 22:38123061-38123083 CCCTGGGGATGGGGCCAGGCGGG - Intronic
1183649545 22:39145924-39145946 CCCGGGGGGTCGGGGGAAGCGGG + Intronic
1183858807 22:40654103-40654125 CACGGGGTATGGGGGGAAGCAGG + Intergenic
1184694982 22:46134082-46134104 CTGTGGGGAGAGGGGGCAGCAGG - Intergenic
1184807034 22:46801991-46802013 CCTTGGTGACAGGAGGAAGCAGG + Intronic
1185183597 22:49378829-49378851 ACCTGGGGGTAGGTGCAAGCGGG - Intergenic
949376138 3:3392501-3392523 CACTGGGGATGGGGTGATGCAGG - Intergenic
950566462 3:13772470-13772492 CCCTGGGTAGTGGTGGAAGCTGG + Intergenic
950684567 3:14607177-14607199 CCCTGGGGAGAGGAGGGAGAGGG + Intergenic
950688217 3:14634334-14634356 CCATGGGGATGGGTGGAGGCAGG - Intergenic
951433420 3:22634574-22634596 GGCTGGGGAGAGGGGGAAGTGGG - Intergenic
952308239 3:32164164-32164186 CCTTGGGGAAAGGGAGAAGCAGG + Intronic
952954324 3:38547773-38547795 CCCTGGGGCTGGGGGAAGGCAGG + Intergenic
952998121 3:38904951-38904973 ACCTGGGTAGAGGTGGAAGCTGG - Intronic
953280320 3:41548323-41548345 CACTGGGGATTGGGGTAGGCTGG - Intronic
954332987 3:49900760-49900782 TCCTGGGGCTAGGGACAAGCAGG - Intronic
954421829 3:50422979-50423001 CCCTGGGTCTGGGGGGAACCTGG - Intronic
954681876 3:52350283-52350305 GTCTGGGGGTAGGGGGGAGCTGG + Intronic
954692312 3:52402147-52402169 CCCTGGGAATGGGAGGAACCAGG - Exonic
955341417 3:58128220-58128242 CCATGTGGTAAGGGGGAAGCAGG - Intronic
959207988 3:103337347-103337369 CCAAGGGGAAAGGGGGGAGCAGG + Intergenic
959975557 3:112454776-112454798 CCCTGGGAATAGCGGGAAGAGGG - Intergenic
960945533 3:122963955-122963977 CCCTGGGGAGAGAGGGAGGGAGG - Intronic
961620511 3:128220512-128220534 ACCAGGGAATGGGGGGAAGCAGG - Intronic
961781899 3:129325388-129325410 CCCTGGTGATAGGTGGGTGCTGG - Intergenic
963541174 3:146590712-146590734 CTTTGGGGATAGGGTGAAGTTGG + Intronic
964592645 3:158382578-158382600 GACTGGGGGTAGGGGGTAGCTGG - Intronic
965543789 3:169895234-169895256 CCCTGGGGAGACGGGCAACCAGG - Intergenic
966878859 3:184338539-184338561 CCCTGGTGGTGGGGGGAAGGAGG + Intronic
967202504 3:187084894-187084916 TCCTGGGAATAGGGAGGAGCAGG - Intergenic
968077645 3:195825226-195825248 CTCTGGGGCCAGAGGGAAGCTGG - Intergenic
968236703 3:197035780-197035802 CCCTGGGGATGGGCGGGAGGAGG + Intergenic
968534079 4:1112967-1112989 CCGTGGGGAGAGGGGGACACTGG - Intronic
968566955 4:1318108-1318130 GCCTGTGCATTGGGGGAAGCCGG - Intronic
968684014 4:1944105-1944127 CCCTGGGGACATTGGGAAGGTGG + Intronic
968808324 4:2788852-2788874 CCCTGGGGATAGGAGGGGACAGG - Intergenic
969206618 4:5652034-5652056 ACCAGGGAACAGGGGGAAGCTGG + Intronic
969691261 4:8705407-8705429 GCCTGGGGAGAGAGGGAAGCTGG + Intergenic
969704133 4:8782864-8782886 CCCTGGTGAGAGGGGCAAGCGGG + Intergenic
971412754 4:26392650-26392672 TCCTGGGGATAGGGGGAGGCAGG + Intronic
973539783 4:51924470-51924492 CCCTGGAAATATGGGGAAGAGGG - Intergenic
976149741 4:82079952-82079974 CCCTGGGGTTGGGTGGAAGGTGG - Intergenic
976203019 4:82598507-82598529 TCCTGGGGATGGGGAGAACCTGG + Intergenic
976389101 4:84491665-84491687 CCCTGGGGTTGGGGGGCAGTTGG - Intergenic
976607238 4:86995297-86995319 CCGTGGGGAGAGGGGGAGGGAGG - Intronic
977371614 4:96144504-96144526 CCATGGGGATATTGGGAAGAGGG - Intergenic
978473983 4:109105048-109105070 TCCTGGTGGTAGGGGGAAGTGGG + Intronic
981907269 4:149935937-149935959 ACCTGGGGATAGGGGAAATGGGG - Intergenic
982107876 4:152026426-152026448 CCCCGGGGGGAGGGGGGAGCTGG + Intergenic
984702233 4:182825781-182825803 TCCTGGGGAAAGGGAGAAGGAGG - Intergenic
985293390 4:188408831-188408853 GCCTGGGGATATTGGAAAGCAGG - Intergenic
985912932 5:2897247-2897269 AGCTGGGGATTGGGAGAAGCTGG + Intergenic
986746699 5:10751093-10751115 CCCTGGGGAAAGGTGGAAGAGGG - Intronic
986904845 5:12484277-12484299 ATCTGGGGAGAGGGGGAAACAGG + Intergenic
988163964 5:27559465-27559487 CACTGGGGATAGGGCCAAGAAGG + Intergenic
988913512 5:35869800-35869822 CCCTGGACTTAGAGGGAAGCAGG - Intronic
989099196 5:37808704-37808726 CCCTGGGGAGCAGGGGAGGCGGG - Intergenic
990727710 5:58774954-58774976 CTCTGGGGAAAATGGGAAGCTGG + Intronic
991191439 5:63878917-63878939 CCCTGAGGATAGGGGGGAAGGGG - Intergenic
992552144 5:77868984-77869006 CACTGGGGAGAAGGGGAAGCTGG + Intergenic
992810709 5:80385624-80385646 CCCTGGCTATAGTGAGAAGCTGG + Intergenic
994088113 5:95782368-95782390 GGCTGGGGAAAGGGGGAAACAGG + Intronic
994093356 5:95827444-95827466 CCCTGGGCACAGGGAGCAGCAGG - Intergenic
994588186 5:101738315-101738337 CCATGGGAATAGTGGGAATCCGG + Intergenic
996808303 5:127483118-127483140 GCCTGGAGGTAGGGGGAACCAGG - Intergenic
997298124 5:132782354-132782376 CCGGGGGGAGATGGGGAAGCAGG - Intronic
997783148 5:136680193-136680215 GCCTGGTGCTGGGGGGAAGCAGG - Intergenic
997835309 5:137187262-137187284 CCCTGGGGAGGAGGAGAAGCAGG - Intronic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998392311 5:141795284-141795306 TGCTGTGGAGAGGGGGAAGCTGG - Intergenic
998483533 5:142482636-142482658 CCCTGAGGGTATGGGGAAGTGGG - Intergenic
999037996 5:148375054-148375076 AGCAGGGGATAGGGGGAAGAGGG + Intergenic
999186532 5:149714758-149714780 CCCTGTGGATCGGGGCATGCGGG + Intergenic
1001984561 5:176061933-176061955 CCCAGGGGCTGCGGGGAAGCCGG - Exonic
1002232953 5:177782264-177782286 CCCAGGGGCTGCGGGGAAGCCGG + Exonic
1002263038 5:178007555-178007577 CCCAGGGGCTGCGGGGAAGCCGG - Intronic
1002276433 5:178107125-178107147 CCCTGGGGGTGGGGGGACCCAGG + Intergenic
1002805237 6:567305-567327 CACAGAGGATGGGGGGAAGCAGG - Intronic
1003860660 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG + Intergenic
1003860669 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG + Intergenic
1004145513 6:13062381-13062403 CCCTGTGGGAAAGGGGAAGCCGG - Intronic
1004350240 6:14884346-14884368 GCCTGGGGGTAGGAGGAAGGAGG + Intergenic
1006239003 6:32661315-32661337 CCCAGGGGAAAAGGGGAAGATGG - Intronic
1006374336 6:33663591-33663613 CCCTGGGGGTAGGCGGGGGCAGG + Intronic
1008068870 6:47079346-47079368 CCCTGAGATTAGGGTGAAGCCGG - Intergenic
1010263452 6:73842211-73842233 TCATGGGGATGGGGGGAAGTGGG - Intergenic
1011784728 6:90830992-90831014 CCCTGGGAATTGGGGGAATAGGG - Intergenic
1012718960 6:102716557-102716579 ACCTGGGGATAGGAGGGAGCTGG + Intergenic
1013204385 6:107933699-107933721 CCGTGGGGAGAGGGAGAGGCAGG - Intronic
1013289665 6:108709133-108709155 CCCTGGGAATGGTGGGGAGCAGG + Intergenic
1016243307 6:141956384-141956406 CACTGGGGGTAGGGTGAAGGAGG - Intergenic
1017522835 6:155216865-155216887 CACCGGTGATTGGGGGAAGCTGG - Intronic
1018176713 6:161183844-161183866 CTCTGGGGACATGGGGAAGCAGG + Intronic
1018804153 6:167245958-167245980 CCCTGGGGATGAGGTGGAGCTGG + Intergenic
1018812578 6:167308464-167308486 CCCTGTGGATGTGGGGGAGCAGG + Intronic
1019036424 6:169063349-169063371 GCCTGGGGATGGGGTGATGCAGG + Intergenic
1019503175 7:1375740-1375762 CCCTGGGGAGGTGGGGAGGCAGG - Intergenic
1019921621 7:4166955-4166977 GCCTGGGGGTAGGAGGAGGCAGG - Intronic
1020097721 7:5377853-5377875 CCCTGGGGGTGAGGGGCAGCTGG - Intronic
1020801444 7:12737616-12737638 CCTTGGTGATAGGAGGCAGCTGG - Intergenic
1020862185 7:13507689-13507711 CCCTGGAGAAAGCTGGAAGCAGG + Intergenic
1021100517 7:16583583-16583605 CCCTGGGGAAAGGGGGGATGGGG + Intergenic
1022031996 7:26500278-26500300 CCCAGAGGCTAAGGGGAAGCGGG - Intergenic
1022063528 7:26826033-26826055 CCATGGGGATCAGGTGAAGCTGG + Intronic
1023039621 7:36160756-36160778 CTCTGGGGAGATGGGGAAGTGGG + Intronic
1023616486 7:42025263-42025285 CCCAGGGGCTCGGGGGCAGCAGG - Exonic
1023621468 7:42077596-42077618 GACTGGGGAAAGGTGGAAGCAGG - Intronic
1024556149 7:50605076-50605098 CCCAGGGGACAGGGGACAGCGGG + Intronic
1025035562 7:55590882-55590904 CCCTGGGGAAGGAGAGAAGCAGG - Intergenic
1026709300 7:72723104-72723126 CCCTGGGGGTAGGGGGCAAGAGG - Intronic
1026991163 7:74586613-74586635 CCCTGGGAAAAGGAGGAACCAGG + Intronic
1027134988 7:75617682-75617704 CCTTGGGGAAAAGGAGAAGCGGG + Intronic
1027725642 7:81802177-81802199 GCCTGGGGTTAGGGGTAAGGAGG + Intergenic
1028864577 7:95692968-95692990 CCCTTGGGAAAGGGGGAAAAGGG - Intergenic
1029110748 7:98212005-98212027 TCCTGGGGGAAGGGGGACGCAGG + Intronic
1030021499 7:105279482-105279504 TCCTGGGGGTAGGGGGAATAGGG - Intronic
1032020850 7:128406349-128406371 CCCTGGGGAGAAGGGCAAGGTGG - Intronic
1032086158 7:128884942-128884964 CCCTGGGATCAGGGGGAGGCTGG - Intronic
1032549598 7:132772010-132772032 CCGTGGGGATGGGGGGAACTTGG + Intergenic
1032676027 7:134130281-134130303 CTCTGGGGGGGGGGGGAAGCTGG - Intronic
1033281350 7:140008782-140008804 CCAAGGGGATTGTGGGAAGCTGG + Intronic
1033685019 7:143630988-143631010 CACTGGAGACAGGGAGAAGCCGG + Intronic
1033688192 7:143710207-143710229 CACTGGAGACAGGGAGAAGCCGG + Intronic
1033699594 7:143826633-143826655 CACTGGAGACAGGGAGAAGCCGG - Intergenic
1034213385 7:149384108-149384130 CCCTGGGAAGAGTGGGAAGTTGG - Intergenic
1034276885 7:149827775-149827797 CCCTGGGGAAACGTGGCAGCAGG + Intergenic
1034748179 7:153542737-153542759 ACCTGGGGAGAAGGGGAAACAGG + Intergenic
1035251047 7:157597176-157597198 GCCGGGGGCTGGGGGGAAGCAGG + Intronic
1035373099 7:158391734-158391756 CCCTGGGGATGGGAGGAGGCAGG + Intronic
1036756754 8:11476298-11476320 GACTGGGGATGGGGGAAAGCCGG - Intergenic
1037193518 8:16156977-16156999 CCCAGGGGAGGGGGGCAAGCAGG + Intronic
1037444130 8:18947488-18947510 CCCCTGGGACAAGGGGAAGCCGG + Intronic
1037509094 8:19563599-19563621 CTGTGGGAATAGGAGGAAGCAGG - Intronic
1037579439 8:20235971-20235993 CCCTGGGGGTGGGGGGAGCCGGG - Intergenic
1038024328 8:23575598-23575620 CCCTGGGGAAATGGGGTTGCAGG - Intergenic
1040105565 8:43539683-43539705 CCCTGGGAATTGGGAGAGGCAGG + Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1041079710 8:54204589-54204611 GACTGGGGATAGGGGAAAGTGGG - Intergenic
1041104414 8:54427321-54427343 CCCAGGGGAGCGGGGGGAGCGGG - Intergenic
1042915379 8:73869991-73870013 CACTGGGGAAAGGGGGAAATAGG + Intronic
1045060084 8:98403539-98403561 CCCTGGGGTTAGGGAGATGGGGG - Intronic
1045109875 8:98930195-98930217 CCCTGGGGAGGAGGGGAAGGCGG + Intronic
1045271649 8:100667280-100667302 CCCTTGGGAAAGGGGTAAGAAGG + Intergenic
1048319606 8:133388088-133388110 CCCTGGGGATAGGGAGGTGATGG - Intergenic
1048459742 8:134611569-134611591 GCCTGGGGAGGGGGAGAAGCTGG + Intronic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1049261293 8:141640572-141640594 CCCTTGGGCTAGTGGGGAGCAGG + Intergenic
1049575845 8:143389241-143389263 CCCTGTGAGGAGGGGGAAGCCGG - Intergenic
1049963753 9:760341-760363 CCCTGAGGATGAGGGGAAGGAGG + Intergenic
1050027092 9:1346705-1346727 CCCTGGGGATATGGTAGAGCTGG + Intergenic
1050330182 9:4537764-4537786 CCTTGGGGGTAGGGAGAAGTGGG + Intronic
1050475364 9:6034979-6035001 CAGTGGGGAGAGGGGGAAGCGGG - Intergenic
1050495276 9:6234425-6234447 GACTGGGGATGAGGGGAAGCAGG - Intronic
1051357632 9:16254374-16254396 ACCTGGGGAGAAAGGGAAGCTGG - Intronic
1051910952 9:22154190-22154212 CCCAGGGTACAGGAGGAAGCTGG + Intergenic
1053131413 9:35617736-35617758 CCCTGGGGAAAGGAGGAGGGCGG - Intronic
1053201010 9:36151598-36151620 CCCAGGGGAGAGGGAGAAGGTGG + Intronic
1054357209 9:64072152-64072174 CCCAGGGGCTGCGGGGAAGCCGG - Intergenic
1055541303 9:77308451-77308473 CACTAGGGATAGGGAGAAGATGG - Intronic
1056277526 9:85007537-85007559 CCCAGGGGACAGGGGGAGGAGGG + Intronic
1056578409 9:87872808-87872830 CCCTGGGGCTGGGAGGAAGGTGG - Intergenic
1056948047 9:91017566-91017588 CCAGGGAGATAGGGGAAAGCTGG - Intergenic
1057575437 9:96238687-96238709 TCCTGGAGATAGTGGGAAGTGGG + Intronic
1058528000 9:105879232-105879254 CCCTGGGGGTAAGGGGAAGCTGG - Intergenic
1060036951 9:120263900-120263922 CCTGGGGGACATGGGGAAGCAGG - Intergenic
1060298025 9:122356221-122356243 CCCAGGAGAGAGGAGGAAGCAGG - Intergenic
1060396379 9:123319613-123319635 CCCTGGGGATAGGGAGCAAAAGG + Intergenic
1060750509 9:126165470-126165492 CCTTGGTGACAGAGGGAAGCGGG + Intergenic
1060818413 9:126647930-126647952 CCCTGGGGACAGGAGGATGGAGG - Intronic
1060982331 9:127800565-127800587 CCCTGGGGAGACAGGGAAGGAGG + Intronic
1061134402 9:128724913-128724935 CCCTGGGGACACAGGGAAGGAGG - Intergenic
1061138600 9:128751010-128751032 CCCTGGGGACAGGGTGCAGAAGG + Intronic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061681847 9:132246328-132246350 CCCTGGGGAGACAGGGAGGCGGG - Intergenic
1061715898 9:132518722-132518744 CTCTGGGGATGGGTGGAAGGTGG - Intronic
1062276708 9:135734821-135734843 CCCTGGGGCGGGGAGGAAGCTGG - Intronic
1062291769 9:135798516-135798538 CCCAGGGGACAGGAGGAGGCAGG - Intergenic
1186659144 X:11650533-11650555 CCCTGGGGAGAGCCGGATGCAGG - Intronic
1188449322 X:30292586-30292608 CCCTGGCGATAGTAAGAAGCTGG + Intergenic
1189355218 X:40305267-40305289 GCCTGGGGTAAGGGGGCAGCAGG - Intergenic
1189768031 X:44392014-44392036 TCCTGGGGATTTGGGAAAGCAGG + Intergenic
1194436522 X:93874130-93874152 CCCAGAGGAGAGGGGGAAGGAGG - Intergenic
1195364217 X:104112163-104112185 ACCTTTGTATAGGGGGAAGCGGG - Intronic
1196708260 X:118736404-118736426 TCCTGGGGGAAGGGGGAATCTGG - Intronic
1199542560 X:148973307-148973329 CCCTGGGGAGAGGGGGCATCTGG - Intronic
1200003696 X:153074357-153074379 CCCTGGAGACAGGCGGAGGCGGG + Exonic
1200004028 X:153075652-153075674 CCCTGGAGACAGGCGGAGGCCGG - Intergenic
1200091344 X:153637536-153637558 ACCCGGGGATGGGGGGCAGCAGG + Intergenic
1200118415 X:153779256-153779278 CAATGGGGAGAGGGGGAAGGAGG - Exonic
1200838514 Y:7756168-7756190 TTCTGGCTATAGGGGGAAGCCGG + Intergenic