ID: 1147761806

View in Genome Browser
Species Human (GRCh38)
Location 17:42803056-42803078
Sequence AGATTTACCCAGCAAACTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147761802_1147761806 1 Left 1147761802 17:42803032-42803054 CCTGGGGAGAGGCTCAGCCACCA 0: 1
1: 0
2: 4
3: 54
4: 347
Right 1147761806 17:42803056-42803078 AGATTTACCCAGCAAACTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 134
1147761797_1147761806 25 Left 1147761797 17:42803008-42803030 CCACTTCACAGTAACACACTTGC 0: 1
1: 0
2: 0
3: 21
4: 148
Right 1147761806 17:42803056-42803078 AGATTTACCCAGCAAACTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147761806 Original CRISPR AGATTTACCCAGCAAACTGG TGG Intronic
900535420 1:3174680-3174702 AAATTTCCCCAGCAAAGAGGTGG - Intronic
901720630 1:11194299-11194321 AGGTTAACACAGTAAACTGGAGG + Intronic
905266537 1:36757756-36757778 ACATTTACCCAGCAACATAGGGG - Intergenic
906658479 1:47565803-47565825 AGCTGGACCCAGCAAGCTGGGGG + Intergenic
908896492 1:68906750-68906772 AGATTTACACAGCAATTTAGAGG - Intergenic
910653608 1:89597703-89597725 AGATTTACACAGTAAACCTGAGG - Exonic
911785946 1:101947978-101948000 AGATTTCCCAAACACACTGGTGG - Intronic
915087926 1:153400629-153400651 AGATTTCCCCAGCAAACAAGTGG + Intergenic
918254740 1:182739131-182739153 AGACTTTCCCAGCACACTTGTGG - Intergenic
922491609 1:226021510-226021532 TCATTTTCCCTGCAAACTGGGGG - Intergenic
922699262 1:227749072-227749094 AGGTTTTTCCAGGAAACTGGAGG - Intronic
923833116 1:237579969-237579991 TGATTTACCCAGCATATTGACGG + Intronic
923846020 1:237733693-237733715 TGCTTTCCCCAGCAAACTGGAGG + Exonic
1063616925 10:7608229-7608251 AGATTCACCGAGCAGCCTGGAGG - Intronic
1065112303 10:22452273-22452295 AGATTTACCCTTCAACTTGGTGG - Intronic
1069848889 10:71392312-71392334 AGATTCAACCAGAAGACTGGAGG + Intergenic
1070442565 10:76461420-76461442 AGATTTCCACAGCAACCTGTTGG + Intronic
1073492316 10:103861155-103861177 CTTTTTCCCCAGCAAACTGGGGG - Intergenic
1073574539 10:104611642-104611664 TGATATACCCAGATAACTGGTGG - Intergenic
1074530374 10:114293396-114293418 GGATTTAAACAGCAAACTGTGGG + Intergenic
1077385192 11:2266258-2266280 AGAACTACCCAGCAAGCTTGTGG - Intergenic
1078416603 11:11171338-11171360 GGATTTGCACAGCAATCTGGGGG + Intergenic
1078667123 11:13335001-13335023 AGATTTAAGCAGCAAAGTGAGGG + Intronic
1088498634 11:110459166-110459188 AGATTACCCATGCAAACTGGTGG - Intronic
1088538477 11:110887106-110887128 AGATTGGCCTAGCAAATTGGTGG - Intergenic
1089302750 11:117508385-117508407 TTATTCACCCAGCAAACTGTAGG + Intronic
1090689102 11:129158373-129158395 AGATTTACCAAGCAAATGGAAGG + Intronic
1091952795 12:4608849-4608871 ACATTAACCGAGCAATCTGGCGG + Intronic
1092585836 12:9900045-9900067 TGACATACCCAGCTAACTGGTGG + Intronic
1102822884 12:115923402-115923424 AGCTTTTCCCAGCACCCTGGGGG + Intergenic
1103867503 12:124064544-124064566 TGCTTTACCCAGCAAACTCTTGG - Intronic
1105013436 12:132771420-132771442 AGATTTTCTTAGCAAACTAGGGG + Exonic
1106608322 13:31252519-31252541 AGATTTACCAAGCAAATGGAAGG + Intronic
1110337532 13:74348874-74348896 AAATTTACCAAGCAAATTGAGGG + Intergenic
1112907981 13:104447402-104447424 AGATTAACCCAACAATCTGGAGG + Intergenic
1114785764 14:25596722-25596744 AGAATTACAGAACAAACTGGAGG - Intergenic
1114953535 14:27788280-27788302 AAATTGAGCCAGCAAAGTGGTGG + Intergenic
1115529130 14:34310665-34310687 AAATAAACCTAGCAAACTGGTGG - Intronic
1118747076 14:68781920-68781942 AGACTTACCATGCACACTGGGGG - Intergenic
1120512806 14:85435980-85436002 AGACTTAGCCAGAAAAATGGTGG + Intergenic
1121765882 14:96485011-96485033 AGTTTGACCCAGCAAACTTTAGG - Intronic
1126775553 15:52097339-52097361 AGATTGGCCCAGCCAACTGCTGG + Intergenic
1133844563 16:9441938-9441960 AGATTCTCCCAGCTAACAGGAGG - Intergenic
1134749819 16:16617177-16617199 GAATGTCCCCAGCAAACTGGTGG - Intergenic
1134995654 16:18736438-18736460 GAATGTCCCCAGCAAACTGGTGG + Intergenic
1141766488 16:86063019-86063041 AAAGTCACCCAGCAAACCGGTGG - Intergenic
1143799589 17:9367594-9367616 TGATTTACACAGCAAAATGTGGG + Intronic
1145786201 17:27595500-27595522 AGAGTCACCCAGCTAAGTGGTGG + Intronic
1147761806 17:42803056-42803078 AGATTTACCCAGCAAACTGGTGG + Intronic
1151136313 17:71948836-71948858 AGAAATAACCAGCACACTGGAGG + Intergenic
1152121744 17:78423185-78423207 AGAATTAACTAGCAACCTGGGGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1155920686 18:31600161-31600183 ATATTTAGCCAGCAGACTGAGGG + Intergenic
1157738715 18:50073480-50073502 GGAGCTACCCAGCAAACAGGTGG - Intronic
1159976924 18:74725062-74725084 AAATTTACCCAAAAAACTGTAGG - Intronic
1160346704 18:78138103-78138125 ACATGTGTCCAGCAAACTGGGGG - Intergenic
1162268992 19:9598753-9598775 AGATTTCCCCAGGGAGCTGGTGG + Intergenic
1166163486 19:40969311-40969333 AGATTTACCAAGCAAATGGAAGG - Intergenic
1166455673 19:42938022-42938044 AGAGTTACCCAGGAAACCCGCGG + Intronic
925887358 2:8404296-8404318 AGATTTATCCAGCACGCTGTAGG - Intergenic
931132653 2:59354834-59354856 AGATTAAATCAGCAGACTGGGGG - Intergenic
933057178 2:77684887-77684909 AGATTTACACTGCATGCTGGAGG - Intergenic
933927316 2:87106087-87106109 AGATTTACACTGCATGCTGGAGG - Intergenic
934048024 2:88187946-88187968 AGAACTACACACCAAACTGGAGG - Intergenic
934483778 2:94680976-94680998 AAATTGAGCCAGCAAAGTGGTGG - Intergenic
935214631 2:100966273-100966295 GGATGTACACAGCATACTGGGGG + Intronic
936144281 2:109969204-109969226 AGATTTAGCCACAAAATTGGTGG + Intergenic
936180963 2:110267164-110267186 AGATTTAGCCACAAAATTGGTGG + Intergenic
936200408 2:110402265-110402287 AGATTTAGCCACAAAATTGGTGG - Intergenic
939819407 2:146938001-146938023 AGCTTCACAGAGCAAACTGGAGG - Intergenic
946000183 2:216475794-216475816 AGATTTTCACAGCAACCTGTAGG + Intronic
1172540294 20:35709223-35709245 AGACTTTCCCAGCAGACTGAAGG - Exonic
1173212490 20:41046457-41046479 GGAATTACCCATCAGACTGGGGG + Intronic
1175745074 20:61450888-61450910 GGATTTATTCAGCAAACTGCTGG - Intronic
1179105170 21:38393619-38393641 AGATTGACCCATCAAATTGCTGG - Intronic
1181327301 22:22059596-22059618 AGAGTTCCCCAGCACACTTGAGG - Intergenic
949419418 3:3849998-3850020 GGTTTTTCCCAGCAAACTGTTGG - Intronic
949792032 3:7803047-7803069 ACATCTACCCATCAAGCTGGAGG - Intergenic
950078907 3:10207335-10207357 AGATTTATCCAGTAATCTTGGGG + Intronic
950156101 3:10722843-10722865 TGCTTTCCCAAGCAAACTGGAGG + Intergenic
951291831 3:20880244-20880266 AAGTTCACCCAGCAAACTGGAGG + Intergenic
951815468 3:26749109-26749131 AGATTCACCCAGAAGACTGCTGG + Intergenic
959428444 3:106222240-106222262 AGATTTACCAAGCAAATGGAAGG - Intergenic
963285628 3:143431865-143431887 AGATGTACCTGGCAAATTGGAGG - Intronic
963484067 3:145913926-145913948 GGATTTACTCACAAAACTGGTGG - Intergenic
966776462 3:183546856-183546878 AGATTTACACAGCCAACAAGTGG + Intronic
967893182 3:194377727-194377749 ACATTTCACCAGCAAAATGGTGG - Intergenic
970070899 4:12158981-12159003 ATATTTACCAAGCAAATTGAAGG - Intergenic
971359170 4:25921235-25921257 ATATTTAAGAAGCAAACTGGTGG + Intronic
975546706 4:75567900-75567922 AAATTGACACAGCACACTGGTGG + Intergenic
979297546 4:119050960-119050982 AGCCTTGCCCAACAAACTGGAGG + Intronic
984190277 4:176597086-176597108 AAATTTACCCAACAAAATGTTGG + Intergenic
985745159 5:1642674-1642696 AGCTCTGCCCAGCAAACTGTGGG + Intergenic
986523275 5:8644111-8644133 AGACTTACAAAGCACACTGGGGG - Intergenic
986971780 5:13345219-13345241 AGATTATGCCAGGAAACTGGTGG - Intergenic
988631166 5:32933438-32933460 AGCTCTACCCAGCAAGCTGAGGG + Intergenic
988981113 5:36570276-36570298 ATATTTAACAAGCTAACTGGTGG + Intergenic
989295262 5:39818113-39818135 AGAATTAGCTAGAAAACTGGGGG - Intergenic
990658708 5:57987755-57987777 AGATTTACTGAGCAAACTCAAGG + Intergenic
995458205 5:112374281-112374303 AGATTAATCCAGGAAACTGTTGG - Intronic
996914425 5:128695196-128695218 AGATTTACTCAAGAAACTGAGGG - Intronic
996994863 5:129683573-129683595 AGAATTTCTAAGCAAACTGGAGG - Intronic
998257301 5:140598044-140598066 AGATTTTCCTAGAAAAATGGAGG + Intergenic
999641759 5:153679672-153679694 GGATTTACCCAGCTCCCTGGTGG - Intronic
1005000517 6:21235655-21235677 ACATATACACAGCAAAATGGTGG - Intergenic
1008869291 6:56252948-56252970 CGATTTATCCATCAAACTGGAGG - Intronic
1014544535 6:122717923-122717945 AGATTTGCCCCTCAAACTGGAGG + Exonic
1015322662 6:131893815-131893837 AAATTTACCATTCAAACTGGGGG - Exonic
1016096188 6:140040680-140040702 AGATTTACTCATGAACCTGGTGG - Intergenic
1017277766 6:152589838-152589860 AGGTTCAAACAGCAAACTGGTGG - Intronic
1021625004 7:22584353-22584375 ATATTTACCCAGCACAGTGAAGG + Intronic
1022588145 7:31635334-31635356 AGATTCACCAAGCAAAATGTGGG - Intronic
1024827449 7:53407986-53408008 AGATTTTCCCAGCTAACTTCTGG - Intergenic
1027578357 7:79960362-79960384 GGAGTTACCCAGAAAACTGGGGG - Intergenic
1028806492 7:95032421-95032443 AGATTTACTCATCAAACTAAGGG + Intronic
1030334797 7:108313907-108313929 AGATTTATCCAGTGAATTGGCGG - Intronic
1032480660 7:132244151-132244173 AAGTTTACCCAGGAAACTGGGGG - Intronic
1034679284 7:152916137-152916159 ATATTTACCCAGGAAGATGGCGG - Intergenic
1039181741 8:34874348-34874370 AGTTTTACCCAGCATGCTGTTGG + Intergenic
1039246692 8:35616441-35616463 AGACATGCCCAGCAAAATGGAGG - Intronic
1040672796 8:49712861-49712883 AGATTTCCCCAGAAAAGGGGAGG + Intergenic
1045005335 8:97912563-97912585 AGAGTTTCCAAGCAAATTGGAGG + Intronic
1045477105 8:102562496-102562518 AGACTTACTGTGCAAACTGGAGG - Intergenic
1048360773 8:133695420-133695442 AGAGTCACTCAGCAAACTTGTGG + Intergenic
1048478378 8:134764181-134764203 ACATTTACCCAGCAAAGTCCAGG + Intergenic
1049132519 8:140860394-140860416 AGGGTCACCCAACAAACTGGAGG + Intronic
1052828701 9:33197341-33197363 AGATCTAGCCAGGAAAATGGGGG + Intergenic
1053651059 9:40170430-40170452 TGAATTACCCATGAAACTGGGGG + Intergenic
1053674006 9:40403415-40403437 AAATTGAGCCAGCAAAGTGGTGG + Intergenic
1053901448 9:42799782-42799804 TGAATTACCCATGAAACTGGGGG + Intergenic
1053923808 9:43029781-43029803 AAATTGAGCCAGCAAAGTGGTGG + Intergenic
1054385110 9:64543484-64543506 AAATTGAGCCAGCAAAGTGGTGG + Intergenic
1054510619 9:65972875-65972897 AAATTGAGCCAGCAAAGTGGTGG - Intergenic
1054533521 9:66205773-66205795 TGAATTACCCATGAAACTGGGGG - Intergenic
1055590598 9:77809234-77809256 TGATTTACCCAGCTCCCTGGAGG + Intronic
1186523081 X:10222803-10222825 AGATTTACCCAGAGAACTCCTGG + Intronic
1186929371 X:14371478-14371500 AGATTTACCGAGCAAATGGAAGG + Intergenic
1188944781 X:36286479-36286501 AGATTTACCCAGAAATCAGGTGG - Intronic
1189460307 X:41236938-41236960 AGATTTCCTCAGAAACCTGGAGG + Intergenic
1190446674 X:50532571-50532593 AGATTTACCCAGAAAAGAGGTGG - Intergenic
1190548974 X:51559056-51559078 ACATTTATCCATGAAACTGGAGG + Intergenic
1190806525 X:53843274-53843296 AGATTGACCCATTAAAATGGTGG + Intergenic
1192899560 X:75481709-75481731 AGAATTACCCAGCAAAGTTATGG + Intronic
1194797172 X:98226041-98226063 AGATTCACTCAGTAAACTGCGGG - Intergenic
1198406852 X:136321654-136321676 ATATTTACCTAGTAGACTGGGGG + Intronic
1202190300 Y:22235636-22235658 AGATTTACACAGAAAGATGGTGG + Intergenic