ID: 1147763931

View in Genome Browser
Species Human (GRCh38)
Location 17:42820182-42820204
Sequence TACCCACAGCTGCCAGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147763931_1147763935 21 Left 1147763931 17:42820182-42820204 CCAGTGACTGGCAGCTGTGGGTA 0: 1
1: 0
2: 3
3: 25
4: 223
Right 1147763935 17:42820226-42820248 GCTACTTGAGAAGAAATCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147763931 Original CRISPR TACCCACAGCTGCCAGTCAC TGG (reversed) Intronic
900880843 1:5380299-5380321 TTCCTACAGCGGCCAGTCTCGGG - Intergenic
900962564 1:5934605-5934627 TCCCCACTGCTCCCAGTCCCGGG + Intronic
901438794 1:9265030-9265052 TACACAGAGCTGCCGGTCAAAGG - Exonic
901690293 1:10968776-10968798 TAGTCACAGCGGCCAGCCACAGG - Intronic
902143600 1:14377959-14377981 TACCCCCAGCTGACAACCACTGG + Intergenic
902472505 1:16658448-16658470 CACCCACCGCTGCCCGGCACCGG - Intergenic
902486300 1:16748998-16749020 CACCCACCGCTGCCCGGCACTGG + Intronic
902771137 1:18646332-18646354 TGCCCAGAGCTGCCTGTTACAGG + Intronic
904928505 1:34067150-34067172 TACCCAGAGCTGTGAGTCATTGG - Intronic
905180158 1:36160735-36160757 TGCCCACACAGGCCAGTCACGGG - Intronic
905923619 1:41734726-41734748 GACCCACAGCAGCCAGCCCCGGG + Intronic
906580794 1:46933999-46934021 TACCCACCGGTGCCAGGCATTGG - Exonic
906602930 1:47144895-47144917 TACCCACCGGTGCCAGGCATTGG + Exonic
906687978 1:47774769-47774791 TACTCACAGCTTCTAGGCACAGG + Intronic
910281148 1:85502952-85502974 TATCCATAGCTACCAGTCAGTGG + Intronic
911704706 1:100997889-100997911 TACCCACAGCTGGCCTTAACTGG + Intronic
913297496 1:117336213-117336235 AAGCCCCAGCTGCCAGTCCCAGG + Intergenic
915251196 1:154589915-154589937 TCCCCACAGCTCCCTCTCACTGG - Exonic
918428470 1:184434632-184434654 AACCCAGTGCTGCCACTCACAGG - Intronic
920166135 1:204037332-204037354 TGACCTCAGCTGCCAATCACTGG + Intergenic
920778162 1:208961220-208961242 TACCCACAGCTGTCACTGAATGG + Intergenic
921057261 1:211552518-211552540 TCCCCGCAGCTCCCAGCCACTGG + Intergenic
921671955 1:217935179-217935201 TTACCACAGCTTCCAGGCACTGG + Intergenic
922113212 1:222583230-222583252 TCCTCACAGCTGCCGGACACTGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924938466 1:248792192-248792214 TCCCCAAAGCTCCCAGTCAGGGG + Intergenic
1063201311 10:3786746-3786768 TGCTCTCGGCTGCCAGTCACTGG - Intergenic
1064265089 10:13819597-13819619 TACTCACAGGTTCCAGTGACTGG - Intronic
1064519453 10:16186135-16186157 CACCCACAGGTGCCAGCCAAAGG + Intergenic
1065627390 10:27645654-27645676 TAACCACAGCTGACAATAACTGG - Intergenic
1066026332 10:31363087-31363109 CACCCAGAGCTGCCGGCCACAGG - Intronic
1067946959 10:50695749-50695771 CACCCAGAGCTGCCGGCCACGGG + Intergenic
1069519240 10:69105197-69105219 TGCCCACATCAGCCAGTCACTGG - Intergenic
1070323610 10:75373238-75373260 TGCCTCCATCTGCCAGTCACTGG - Intergenic
1070785840 10:79161875-79161897 TCCCCACACCTGCCAGTTACTGG - Intronic
1070882269 10:79860742-79860764 CACCCAGAGCTGCCGGCCACGGG + Intergenic
1071648839 10:87377053-87377075 CACCCAGAGCTGCCGGCCACAGG + Intergenic
1072608572 10:97002311-97002333 TTCCTACAGCTGCCAGTGCCAGG - Exonic
1073602836 10:104863667-104863689 GACCCACAGCTGCTAGACCCAGG - Intronic
1074957638 10:118407939-118407961 TACCCACTGCAGCCAGTGAGAGG + Intergenic
1077115113 11:880604-880626 TACCCACTGCTGCCACCCTCAGG + Intronic
1077494131 11:2877675-2877697 TACACACAGCTGTCTGACACTGG + Intergenic
1078012640 11:7584867-7584889 GAACCATAGCTGCCAGGCACAGG - Intronic
1078581705 11:12544007-12544029 TACCCACTGCTGCCAGCCCCAGG - Intergenic
1078606918 11:12785138-12785160 TCCCCACGGCTCCCAGGCACAGG - Intronic
1078905956 11:15687999-15688021 ATCCCACAGCTGCCAGCCTCAGG + Intergenic
1081644578 11:44780795-44780817 TATTCACAGCTACCATTCACAGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083944886 11:65918256-65918278 TAACTACAGATGCCAGGCACTGG + Intronic
1084486785 11:69452908-69452930 TACCCACAGCTGGCAGTTCAGGG - Intergenic
1085171379 11:74452583-74452605 TCCCCAAAGCAGCCAGTCATTGG - Intergenic
1085459855 11:76686994-76687016 TGCCCACAGGTGCCAGGAACAGG + Intergenic
1085465773 11:76722285-76722307 CACCCACTGCTGCCAGGCTCTGG + Intergenic
1085527585 11:77173261-77173283 GAACCACAGCTGCCAATCACTGG - Intronic
1086931214 11:92695049-92695071 TCCCCACAGCAGGCACTCACAGG + Intronic
1088471079 11:110187902-110187924 TACCCACAAGTGCCATCCACTGG + Intronic
1089063644 11:115645916-115645938 TCCCCACAGCTGCTACTCCCAGG - Intergenic
1089257334 11:117200793-117200815 TACCCCCAGCTTCCAGTCTCAGG - Intronic
1089602853 11:119625876-119625898 TACCCTCCCCTGCCAGGCACTGG - Intronic
1094246706 12:28305239-28305261 TACCTACCAGTGCCAGTCACAGG - Intronic
1094313502 12:29112756-29112778 AACCCACTGCTCCCAGTCACAGG - Intergenic
1097023476 12:56036686-56036708 TACACTCAGCTCCCAGACACAGG + Exonic
1099996932 12:89788158-89788180 CACCTACATCTGCCAGCCACTGG - Intergenic
1101217735 12:102601692-102601714 TATCAACAGCTTCCAGGCACTGG - Intergenic
1103939763 12:124495355-124495377 TTCCCGCAGGTGCCAGTGACGGG - Intronic
1104424372 12:128662947-128662969 TACCCACAGCTGACTGACCCTGG - Intronic
1107362283 13:39632552-39632574 TCCTCACAGCTGCCTGCCACAGG + Intergenic
1107925010 13:45250559-45250581 TACCCACTTCTGCCAGGCACTGG - Intronic
1109989625 13:70037953-70037975 TACTCACAGATGACAGTCATTGG - Intronic
1110626692 13:77661664-77661686 CACCCAAAGCTGCCGGCCACAGG - Intergenic
1113886271 13:113660193-113660215 CACCCACATCTGGCAGCCACCGG + Intergenic
1113969265 13:114176487-114176509 CACCCACAGCTGTCACCCACAGG - Intergenic
1113969284 13:114176566-114176588 CACCCACAGCTGTCACCCACAGG - Intergenic
1113969334 13:114176778-114176800 CACCCACAGCTGTCACCCACAGG - Intergenic
1113969399 13:114177084-114177106 CACCCACAGCTGTCACCCACAGG - Intergenic
1113969418 13:114177163-114177185 CACCCACAGCTGTCACCCACAGG - Intergenic
1113969463 13:114177363-114177385 CACCCACAGCTGCCACCCTCAGG - Intergenic
1114579955 14:23748381-23748403 TTCCCACCGCTGCCAGTCCTGGG + Intergenic
1118617843 14:67587150-67587172 TTCCCACAGCTGGCAGGCTCCGG - Exonic
1119946056 14:78695663-78695685 TACCCACAACAGCCAGACAGTGG - Intronic
1122155451 14:99747729-99747751 TAAGGACACCTGCCAGTCACTGG + Intronic
1122366729 14:101198784-101198806 TAGCCACAGCTCCCAGTCATGGG + Intergenic
1124189107 15:27556357-27556379 TGCCCTCAGCTGTCAGTAACAGG + Intergenic
1124555716 15:30723917-30723939 TACACTCAGCTGCCATTAACTGG - Intronic
1124675552 15:31681802-31681824 TACACTCAGCTGCCATTAACTGG + Intronic
1126096792 15:45095814-45095836 TACCCAAAGGTGCCCGTCACTGG - Exonic
1127051633 15:55089914-55089936 TGCCCACAGCTGCCTGCCCCGGG + Intergenic
1128264593 15:66254978-66255000 GACACACAGCTCCCAGTCTCAGG - Intergenic
1129691604 15:77717112-77717134 TGCCCACAGCTGCCACCCAGAGG + Intronic
1130284751 15:82545697-82545719 TACCCACAGGTGTCAGCGACAGG - Intronic
1132295557 15:100731689-100731711 TCGCCACAGCTGCCATCCACTGG + Intergenic
1132989122 16:2784125-2784147 GACCCACAGCCGCAAGGCACTGG - Exonic
1133732534 16:8589584-8589606 CAGCCACAGCTCCCAGCCACGGG + Intronic
1134305026 16:13024246-13024268 TCCCTACAGCTGCCAGTAAGAGG - Intronic
1134444701 16:14321973-14321995 AACCCAGAGCTTCCAGTCCCTGG + Intergenic
1137622793 16:49887359-49887381 TACCCACAGATTCCAGAGACTGG + Intergenic
1141636415 16:85316452-85316474 CACCCACACCTCCCAGCCACTGG + Intergenic
1141645471 16:85365080-85365102 ACCCCACAGCTGCCAGTCACTGG - Intergenic
1142120603 16:88384730-88384752 TGCCCAGAGCTGCCAGCCTCGGG - Intergenic
1145814180 17:27783611-27783633 TACCCACATGAGCCAGGCACTGG + Intronic
1146553184 17:33799723-33799745 AAGCCACATCTGCCAGTCTCAGG + Intronic
1146597410 17:34182623-34182645 TTCACACAGCTGCCAATCAATGG + Intergenic
1147763931 17:42820182-42820204 TACCCACAGCTGCCAGTCACTGG - Intronic
1149689035 17:58558275-58558297 TTCCCACTGCTGCTAATCACTGG - Intronic
1150103925 17:62447928-62447950 TACCCATGGCAGCCAGGCACTGG + Intronic
1151621605 17:75248909-75248931 TAGCGACAGCTGCCAGGCAGAGG + Intronic
1151823618 17:76511333-76511355 TATCCACAGCTGACATCCACTGG + Intergenic
1155043191 18:22082271-22082293 TAGCCACTGCTCCCAGCCACTGG + Intergenic
1157519337 18:48334625-48334647 TGGCCAGAGCTGCCATTCACAGG + Intronic
1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG + Intergenic
1160661233 19:300064-300086 GTCCCACAGCCTCCAGTCACTGG - Intergenic
1161612928 19:5253390-5253412 TTGCCAGAGCAGCCAGTCACAGG - Intronic
1161723305 19:5915303-5915325 TGCTCACAGCTGCCAGGCACTGG - Exonic
1163826099 19:19525796-19525818 TGCACACAGCTGCCAGGGACAGG - Intronic
1164596887 19:29536123-29536145 CTCCCCCAGCAGCCAGTCACTGG + Intronic
1164839408 19:31381105-31381127 GACCCACTGCTGCCAGTCCAAGG - Intergenic
1167166624 19:47803433-47803455 TCCCCACCGCTGTCACTCACCGG - Intronic
1167175214 19:47860331-47860353 TCCCCACCGCTGTCACTCACCGG + Intergenic
1167853842 19:52222069-52222091 TACTCACCCCTGCCACTCACTGG + Intronic
1202704896 1_KI270713v1_random:15253-15275 CACCCACCGCTGCCCGGCACCGG - Intergenic
925340141 2:3130511-3130533 TACTCACAGGTGCCAGCAACTGG + Intergenic
925424456 2:3737110-3737132 TACCCCCAGGTGCCAGGCCCTGG + Intronic
926116712 2:10218079-10218101 TCCCCACTGCTGCCAGTGCCCGG + Intergenic
928410242 2:31048916-31048938 TTCCCACAGGTGCCCGTCACTGG + Intronic
930570891 2:53085543-53085565 TTCCCACACCTCCCAGTCCCTGG - Intergenic
931636342 2:64343922-64343944 TGCCAACAGCTGCCGGACACAGG - Intergenic
932063248 2:68528502-68528524 CACCCAGAGCTGCCGGCCACAGG - Intronic
933346050 2:81086944-81086966 TACCCACAGGTGCTACTCACTGG + Intergenic
934848232 2:97677137-97677159 TCCACACTGCTGCCCGTCACAGG - Intergenic
936499580 2:113055344-113055366 TACACAAAGCTGCCAGGCCCTGG + Intergenic
937173654 2:119903616-119903638 TGCCCACAGGTGCCAGTGGCAGG - Intronic
937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG + Intergenic
937605597 2:123798144-123798166 TCTCCACAGCTGCCTGCCACTGG + Intergenic
939250739 2:139678985-139679007 AACACACATTTGCCAGTCACTGG + Intergenic
940362699 2:152813305-152813327 TACCCCCAGCTGCCTGCCAATGG - Intergenic
946711743 2:222513778-222513800 TACCTACAGCTACCAGAAACTGG + Intronic
946724316 2:222647223-222647245 TGCCCACAGCTGATGGTCACTGG + Intronic
948135789 2:235635200-235635222 GACCCACTGCTGCCACACACAGG - Intronic
948452398 2:238084236-238084258 GACCCACACCTGTCAGTCACAGG + Intronic
949045820 2:241872246-241872268 GCCTCACAGCTGCCAGTCACAGG - Exonic
1169268204 20:4180507-4180529 TGCCCACAGCTGTCATTCCCAGG - Intronic
1170548005 20:17451422-17451444 TGCTGACAGCTGCCAGACACAGG - Intronic
1172625833 20:36346210-36346232 TACCCACAGCCGTCAGTCCTTGG - Intronic
1172765686 20:37349569-37349591 TACCTACCGGTGCCAGACACTGG - Intronic
1173416501 20:42861231-42861253 TTCCCAAAGTTGCCAGTCCCTGG + Intronic
1174388303 20:50200103-50200125 TAGACTCAGCTGCCAGTAACAGG - Intergenic
1175536938 20:59721419-59721441 CACCCAGAGCTGGGAGTCACTGG - Intronic
1177996419 21:28105103-28105125 TACTCACAGCTGCCAATTTCAGG - Intergenic
1178588901 21:33892902-33892924 AAACCACAGCTGCCATTCACGGG + Exonic
1178790326 21:35693665-35693687 TTCCCACAAATGCCAGTCAAGGG + Intronic
1179821926 21:43942118-43942140 TACCCACAGGTGCCATTTAGTGG + Intronic
1181302299 22:21889405-21889427 TCCCCACAGCTGCCTGTCATGGG - Intergenic
1181532569 22:23525265-23525287 CACCTAGAGCTGCCAGACACTGG + Intergenic
1182302796 22:29347209-29347231 TACCCACACTTGCCAGCTACCGG + Intronic
1182447507 22:30398094-30398116 TCCCCACTGCTGCCAGTGGCAGG - Intronic
1183597620 22:38822095-38822117 TTCCACCAGCTGCCAGTCAAGGG - Exonic
949544465 3:5060716-5060738 TCACCACATCTGCCAGTCACTGG - Intergenic
950046196 3:9949903-9949925 ACCCCAGAGCTGACAGTCACAGG - Exonic
951232087 3:20191140-20191162 TGCCGACAGCTGCCAGAAACTGG + Intergenic
951481080 3:23163194-23163216 CACTCACAGCAACCAGTCACTGG - Intergenic
952827311 3:37535145-37535167 TATCCACATGTGCCAGGCACTGG + Intronic
953475770 3:43204740-43204762 TACCCGCAGCTGTCAGTTATAGG + Intergenic
955599430 3:60629188-60629210 TCCCCTCAGCTTCCAGTCAAGGG - Intronic
956588110 3:70885217-70885239 CACCCTCACCTGCCTGTCACTGG - Intergenic
956706136 3:72000776-72000798 TTCTCACATCTGTCAGTCACTGG + Intergenic
957926219 3:86815361-86815383 TCCCAACAGCTGCCAGTCACAGG - Intergenic
961415756 3:126755371-126755393 TGCCCACATCTGCAAGTCCCTGG + Intronic
962462002 3:135622820-135622842 TACCTGCTGCTGTCAGTCACAGG - Intergenic
964374615 3:156036869-156036891 AAAGCCCAGCTGCCAGTCACTGG - Intergenic
964444436 3:156744007-156744029 TGCCCAGAGCTGCCACACACAGG - Intergenic
968186023 3:196634130-196634152 TCCCCACAGAGGTCAGTCACCGG + Intergenic
968705302 4:2074840-2074862 TCCCCACAGCACCCAGCCACTGG - Intronic
968912817 4:3484595-3484617 AAGCCCCAGCTGCGAGTCACGGG - Intronic
969391735 4:6895903-6895925 CCCCCACTGCTGCCACTCACAGG + Intergenic
971349412 4:25843097-25843119 TCCCCACTGCTTCCAGCCACAGG - Intronic
981245256 4:142528969-142528991 TAGACACTGCTGCCAGTTACAGG - Intronic
982060479 4:151599627-151599649 TACTCAGTGCTTCCAGTCACTGG + Intronic
983077360 4:163343300-163343322 CACCCACAGCTGCCACTCCTTGG + Intronic
983206475 4:164915641-164915663 TGCCCACAGCTGATGGTCACTGG - Intergenic
983212149 4:164969905-164969927 TGCCCACAGCTGATGGTCACTGG + Exonic
984130929 4:175875204-175875226 TTCCCACAGCTCCCAGTTTCTGG + Intronic
984155711 4:176194475-176194497 TATCCACAGTTGCCATCCACTGG + Intronic
985768702 5:1795776-1795798 TATCCACAGATGCTCGTCACTGG - Intergenic
986152289 5:5139556-5139578 TGCACCCAGCAGCCAGTCACCGG + Intergenic
986321587 5:6636351-6636373 TACCCACAGCCTCCTCTCACCGG - Intronic
986679585 5:10221138-10221160 TACCCCCAGTTGCCACCCACAGG + Intergenic
993598725 5:89892525-89892547 TGCCCACAGATCCCAGTAACTGG + Intergenic
994954269 5:106507193-106507215 TCCCCACAGCTCCCAGCCTCTGG - Intergenic
996516972 5:124381557-124381579 TGCACACAGCTGCCTGCCACAGG - Intergenic
997728726 5:136146968-136146990 TGCCCACAACTGCCCGTAACAGG - Intronic
999136710 5:149325325-149325347 TTCCCCCAGCTGCCAGTCAAGGG + Intronic
1000976256 5:167767841-167767863 TAAACACATCTGCCAGTCAAAGG - Intronic
1001473810 5:172035160-172035182 CTCCCACACCAGCCAGTCACTGG + Intergenic
1001722687 5:173869493-173869515 TGAACTCAGCTGCCAGTCACAGG - Intergenic
1003142299 6:3481643-3481665 TTCCCACTGCTGCCAGACTCTGG + Intergenic
1003642779 6:7889249-7889271 AACCCACATCTTACAGTCACAGG - Intronic
1004105028 6:12659640-12659662 CACTGACAGCTGTCAGTCACTGG - Intergenic
1004632615 6:17436518-17436540 TACCCAGGACTGCCAATCACAGG + Intronic
1005243292 6:23855150-23855172 CACCCAGAGCTGCCGGCCACAGG + Intergenic
1006814871 6:36843336-36843358 TACCAACTTCTGCCAGTCATTGG + Intergenic
1007095103 6:39208084-39208106 TACCCTAAGCTGCCAGCCACAGG - Intronic
1009398549 6:63229374-63229396 CACCCAGAGCTGTCAGCCACAGG - Intergenic
1012959944 6:105611731-105611753 TACCTCTAGCTGCCAGTCATAGG + Intergenic
1014814906 6:125924831-125924853 TTCCCACAGCTGCCAGTCAAGGG + Intronic
1016932525 6:149425120-149425142 TAGCCACAGCTGTCTGTCAGAGG + Intergenic
1018971567 6:168533044-168533066 GACCTACTGCTGCCTGTCACAGG - Intronic
1023378979 7:39586950-39586972 TCCCCACAGCTGCAGGTCATGGG + Intronic
1024087007 7:45902117-45902139 TCCTCCCAGCTGCCAGTCAGTGG + Intergenic
1026846613 7:73702355-73702377 TCACCTCAGCTGCCAGTCTCTGG + Intronic
1031594761 7:123637293-123637315 AACCCACATCTGCCAGTTGCTGG + Exonic
1033446262 7:141424976-141424998 TTCCCAGAGCTGCCTGTTACTGG + Intronic
1033576550 7:142690796-142690818 TGCCCACAGAAGCCAGACACTGG - Intergenic
1034642462 7:152615174-152615196 GACACTCAGCTGCCAGGCACAGG - Intergenic
1034961056 7:155364639-155364661 TACCCACAGCTGTCAATCCCAGG - Intronic
1035132433 7:156668490-156668512 GACCCACAGGTGCAAGTCACTGG - Intronic
1035566153 8:642865-642887 TACCCAGAACTGCCTGCCACAGG - Intronic
1035737936 8:1902376-1902398 GACGCACTGCTGCCAATCACAGG - Intronic
1036168901 8:6464246-6464268 TACCCAGAGCTGGCAGTGGCGGG + Intronic
1037435157 8:18854935-18854957 CACACACAGCTGTCAGACACAGG + Intronic
1037808283 8:22070315-22070337 TACCCACAACAGCCAGAGACGGG - Exonic
1038372927 8:27011409-27011431 CACCCAGAGCTGCCGGCCACAGG - Intergenic
1041123642 8:54612342-54612364 TCCCCACAGCTGCCTGCCATGGG + Intergenic
1041175675 8:55193811-55193833 TACCCAGAGCTCCCAAACACTGG - Intronic
1042226866 8:66521096-66521118 TACCCACAGCTGCTGATCCCTGG - Intergenic
1043543143 8:81285502-81285524 TAGCCACAGCTAGCAGTCAGTGG + Intergenic
1044533709 8:93336891-93336913 TTCCCCCAGCTGCAAGACACTGG + Intergenic
1046675241 8:117100844-117100866 TACCCAGAGCTGCCATTTTCTGG + Intronic
1046821456 8:118638270-118638292 TAGCCTCAGCTACCTGTCACAGG + Intergenic
1048557505 8:135494837-135494859 TCCCCACAGCTTCCAGCCAAAGG - Intronic
1049491989 8:142910014-142910036 TACCCAGGGCTGCGAGTCACAGG - Intronic
1050358760 9:4807806-4807828 GACCCATAGCTGCCAGGCGCGGG - Intronic
1051638428 9:19202587-19202609 GACCCACAGCTGCCTGACCCAGG - Intergenic
1053202686 9:36163493-36163515 CAGCCACAGCTGCCAGGAACAGG - Exonic
1056020194 9:82432177-82432199 CACCCAGAGCTGCCAGCCACAGG - Intergenic
1056572252 9:87825865-87825887 CACCCAGAGCTGCCAGCCACAGG + Intergenic
1057071704 9:92105141-92105163 CACCCAGAGCTGCCGGCCACAGG + Intronic
1057770714 9:97965298-97965320 TTCCCACATCAGCCTGTCACTGG - Intergenic
1059710744 9:116865604-116865626 TCCCCACAGTAGCCAGTCATTGG + Intronic
1059778194 9:117498046-117498068 TATGCACAGCTGCCTGCCACTGG + Intergenic
1060115587 9:120937504-120937526 TTGGCACAGCTGCCAGTCCCAGG - Intergenic
1185708693 X:2284793-2284815 TTCCCACAGCAGCCAGACAGAGG + Intronic
1188041322 X:25372581-25372603 TACTCACACCTGTCAGTCATTGG - Intergenic
1189197759 X:39166380-39166402 TACCCAGAGCTGCCAGCAGCAGG - Intergenic
1189260122 X:39672550-39672572 CACCAACACCTGTCAGTCACTGG - Intergenic
1189741064 X:44117617-44117639 CACCAACTTCTGCCAGTCACTGG + Intergenic
1192144635 X:68673453-68673475 CTCCCTCAGCTGTCAGTCACTGG + Intronic
1193076988 X:77364881-77364903 TAGGGACAGCTGGCAGTCACAGG - Intergenic
1197174040 X:123465908-123465930 TTCCCAAAGCTGCCAGGCAGGGG - Intronic
1198209865 X:134506794-134506816 CACCCCCAGTTGCCAGTGACTGG - Intronic
1199778605 X:151037717-151037739 TTCCCACATCAACCAGTCACTGG + Intergenic
1199848108 X:151706300-151706322 TACCCACAGCTGGGAATCTCTGG - Intergenic
1201077198 Y:10196997-10197019 CACTCACAGCTGCCACGCACGGG + Intergenic