ID: 1147765708

View in Genome Browser
Species Human (GRCh38)
Location 17:42834107-42834129
Sequence CAGGAGGAAGGGAGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25058
Summary {0: 4, 1: 63, 2: 681, 3: 4372, 4: 19938}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147765698_1147765708 19 Left 1147765698 17:42834065-42834087 CCTGTCTTTTGTCTGCTTATCAA 0: 1
1: 1
2: 2
3: 23
4: 248
Right 1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG 0: 4
1: 63
2: 681
3: 4372
4: 19938
1147765696_1147765708 28 Left 1147765696 17:42834056-42834078 CCCTAACTACCTGTCTTTTGTCT 0: 1
1: 0
2: 3
3: 28
4: 289
Right 1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG 0: 4
1: 63
2: 681
3: 4372
4: 19938
1147765697_1147765708 27 Left 1147765697 17:42834057-42834079 CCTAACTACCTGTCTTTTGTCTG 0: 1
1: 0
2: 0
3: 22
4: 234
Right 1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG 0: 4
1: 63
2: 681
3: 4372
4: 19938

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147765708 Original CRISPR CAGGAGGAAGGGAGGGAAGG GGG Intronic
Too many off-targets to display for this crispr