ID: 1147766683

View in Genome Browser
Species Human (GRCh38)
Location 17:42841484-42841506
Sequence TAGAGTGACCTGAGAGAAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 1, 2: 0, 3: 31, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147766683_1147766687 22 Left 1147766683 17:42841484-42841506 CCCTCTTCTCTCAGGTCACTCTA 0: 1
1: 1
2: 0
3: 31
4: 285
Right 1147766687 17:42841529-42841551 TCGAGAAGATCAAACGGCCCCGG 0: 1
1: 0
2: 0
3: 0
4: 33
1147766683_1147766686 16 Left 1147766683 17:42841484-42841506 CCCTCTTCTCTCAGGTCACTCTA 0: 1
1: 1
2: 0
3: 31
4: 285
Right 1147766686 17:42841523-42841545 AAAATATCGAGAAGATCAAACGG 0: 1
1: 0
2: 0
3: 28
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147766683 Original CRISPR TAGAGTGACCTGAGAGAAGA GGG (reversed) Exonic
900805575 1:4765473-4765495 GAGAGAGACATGAGTGAAGAAGG + Intronic
906866138 1:49422695-49422717 AAGAGTGAGCTGGGTGAAGAAGG - Intronic
909046546 1:70717324-70717346 TACAGTGCACTGAGAGAAAATGG - Intergenic
909305073 1:74063963-74063985 TAGAGTGACCCCTGAGAATATGG - Intronic
910575964 1:88764153-88764175 TAGAGTGTAATGAGAGAGGAAGG - Intronic
910677306 1:89827592-89827614 AAGAGTCATCTGAGAGGAGATGG + Intronic
910679029 1:89843744-89843766 GAGAGCGCCCTGAGAGAACAGGG + Exonic
910887602 1:91982122-91982144 TAGAGTGATCTGATAGATCATGG - Intronic
911438127 1:97888696-97888718 CAGAGAGACCAGAGAGAAGTGGG + Intronic
912041952 1:105401558-105401580 TAGAGTGGCCTGAAAGAAGTAGG + Intergenic
912468059 1:109887502-109887524 CAGAGTGGCCAGAGACAAGAGGG - Intergenic
913106065 1:115615152-115615174 TGGAGTGAGCAGAGAGAGGATGG - Intergenic
913324853 1:117618349-117618371 TAGAATGAGATGAGAGGAGATGG + Intronic
913482593 1:119303230-119303252 TAGAGTCCCATGAAAGAAGAAGG + Intergenic
913523237 1:119666076-119666098 TATACTGGCCAGAGAGAAGAGGG + Intronic
915995119 1:160554011-160554033 TGGAGTCCCCTGGGAGAAGAGGG - Exonic
917530592 1:175831490-175831512 GAGAGTGGGCTGAGGGAAGATGG + Intergenic
918817830 1:189212075-189212097 TAAAGTGATCTGAGAGAATCTGG + Intergenic
920261255 1:204689464-204689486 TAGAGTGTCCTAGGTGAAGAGGG + Intergenic
920748333 1:208650301-208650323 TAGAGAGACCTGGCAGACGAGGG + Intergenic
920803277 1:209208755-209208777 AGGAGTGATCTGAGAGAAGCAGG + Intergenic
922221086 1:223609163-223609185 GAGAGTGTTCTCAGAGAAGAAGG - Exonic
923362337 1:233223951-233223973 TAGAGAGACCTGAGAGGGAAGGG - Intronic
924639269 1:245817554-245817576 TTTGATGACCTGAGAGAAGAAGG + Intronic
1063115212 10:3067778-3067800 TGGGGTGACCGGAGAGAAGAGGG + Intronic
1063352356 10:5367256-5367278 TAGAGTCACTTGAAAGATGAGGG - Intronic
1063814848 10:9759845-9759867 AAGAGTAACCTGAGAAAACAGGG - Intergenic
1064244084 10:13655677-13655699 CAGAGTGACCTGAGATAATGGGG - Intronic
1064478674 10:15719127-15719149 TACAGTGAGATGAGAGAAGGGGG + Intronic
1064505006 10:16019170-16019192 TTGAGTTACATGAGAGAAGGAGG - Intergenic
1065999921 10:31095123-31095145 AATAGTGATCTGAGAGGAGATGG + Intergenic
1066696551 10:38084240-38084262 GTGAGTGACCTGAGTGAACAAGG + Intergenic
1067203203 10:44192684-44192706 GAGAGTGTCCAGACAGAAGATGG - Intergenic
1067797053 10:49328243-49328265 CACAGAGACCTCAGAGAAGAGGG - Intergenic
1071316561 10:84406489-84406511 TAGAGTGAACTGTGAGACGGTGG - Intronic
1071519756 10:86322294-86322316 AAAAGAGACCTGAGAGAATATGG + Intronic
1072186656 10:93046511-93046533 AAGAGCTACCTGAGTGAAGAAGG + Intronic
1073516353 10:104078923-104078945 CGGAGTGACTTGAGACAAGAGGG - Intronic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1076504653 10:130963826-130963848 TTGAGTGACTCAAGAGAAGAGGG + Intergenic
1076697242 10:132252873-132252895 CAGAGTGACCTGGGAGGAGGCGG - Intronic
1078000940 11:7495080-7495102 TATAGTGACCTGTCAGACGAGGG - Intronic
1079536946 11:21526456-21526478 TAGAGCTAGCTGTGAGAAGAGGG - Intronic
1079615641 11:22489379-22489401 TATAGTGAAATGAGAGGAGAGGG + Intergenic
1080985407 11:37457947-37457969 TGAAGAGACCTGAGAGTAGAAGG - Intergenic
1081273978 11:41123655-41123677 TTGAGTGAACTCAGAGAAGCTGG - Intronic
1081757605 11:45555809-45555831 TAGAGGGACAAGAGAGAAGATGG + Intergenic
1082054379 11:47801072-47801094 TGGAGTGACCAGAGGAAAGAGGG + Intronic
1082108174 11:48243197-48243219 CAAAATGTCCTGAGAGAAGAGGG + Intergenic
1082751722 11:57026114-57026136 CAGAGAGAGCTGAGAGAAAATGG - Intergenic
1085060303 11:73439861-73439883 AAAAGTGACCTGAGAGACAAAGG - Intronic
1088343230 11:108793173-108793195 GAGTGTCACCTGAGAGAAAAAGG - Intronic
1088638330 11:111846301-111846323 TAGAGTGACCAGACAGAAAAGGG + Intronic
1090239462 11:125171892-125171914 TACACAGACCTGAGAGATGATGG + Intronic
1090652824 11:128822600-128822622 TAGAGTGGCTTCATAGAAGATGG + Intergenic
1092086433 12:5766764-5766786 TAGTCTGGCCTGAGAGCAGAGGG - Intronic
1092891194 12:12970800-12970822 TAGAGTGAATTAAGAGAAAAAGG - Intergenic
1094283025 12:28761112-28761134 AAAAGTAAGCTGAGAGAAGAAGG + Intergenic
1094468394 12:30779109-30779131 TAGAGCGCCCTGACAGAGGAGGG + Intergenic
1094692671 12:32785418-32785440 TACAGTGACCTGAGAGGAGCCGG - Intergenic
1094737133 12:33247415-33247437 TGGAGTTACCTGAGAAAAAAAGG - Intergenic
1095050419 12:37549011-37549033 TAGAGTGACCTCAAAAAAGATGG + Intergenic
1097918127 12:65041564-65041586 TAGAGAGATATGAGAGAACAAGG + Intergenic
1098409476 12:70165324-70165346 TACAGATCCCTGAGAGAAGAGGG + Intergenic
1098977783 12:76921189-76921211 TAATGTAGCCTGAGAGAAGAAGG + Intergenic
1100290400 12:93208584-93208606 GAGAATGAATTGAGAGAAGAGGG + Intergenic
1102043982 12:109818199-109818221 TAGATTGACCAGGGAGGAGAGGG + Intronic
1102409212 12:112702640-112702662 AAGAGTGACTGAAGAGAAGAGGG + Intronic
1103809078 12:123599663-123599685 TAGAGAAACCTGAGAGCAAAGGG - Intergenic
1104531304 12:129573331-129573353 GAGCCAGACCTGAGAGAAGAGGG + Intronic
1105256154 13:18745077-18745099 AAGCGGGACCTGGGAGAAGAGGG + Intergenic
1107006785 13:35620837-35620859 TAGAGATACCTGAGGGAAAATGG - Intronic
1108197795 13:48012026-48012048 AAGAGAGACCTGTTAGAAGAGGG + Intergenic
1109139254 13:58693333-58693355 TATAGTGACAGGAGAGAAGCAGG - Intergenic
1111990300 13:95109798-95109820 TAGAGTAAACTCATAGAAGAAGG + Intronic
1112843431 13:103608121-103608143 TAGATTGACTTGAGAGAATATGG - Intergenic
1115820723 14:37210101-37210123 TAGTGTGCTGTGAGAGAAGAGGG - Intronic
1117667024 14:58066965-58066987 TAGAGTGACCTGATACAAAATGG + Intronic
1117766075 14:59084836-59084858 GAGAGTGACATGAGTGTAGAAGG - Intergenic
1118004977 14:61557559-61557581 GAGAGTGAACTGAGTGATGAAGG + Intronic
1118372943 14:65153241-65153263 TTGAGGGCCCTGAGAGCAGATGG + Intergenic
1118448252 14:65871294-65871316 TAGAGTGGCCAGAGAGGAGCAGG + Intergenic
1119613838 14:76085362-76085384 TGGAGTGACCACAGAGCAGAGGG + Intergenic
1119834394 14:77735004-77735026 TACAGTCATCTGAGAGAAGAGGG + Exonic
1119946824 14:78704059-78704081 CAGAGTGGCCTGGGATAAGATGG + Intronic
1120408907 14:84125738-84125760 TAGAATAACTTGAGAGAACAAGG - Intergenic
1122056889 14:99105133-99105155 CAGAGTCCCCGGAGAGAAGAGGG + Intergenic
1122682313 14:103475052-103475074 GATAGTGACCTCAAAGAAGATGG + Exonic
1202835858 14_GL000009v2_random:76951-76973 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1125558316 15:40605118-40605140 TAGAGAGACCTGTTAGAAGACGG + Exonic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1128894617 15:71361049-71361071 TAGAGTGTCCTGAAAGAAAAAGG + Intronic
1129910534 15:79222578-79222600 TAGAGAGAGCTGAGGAAAGAGGG - Intergenic
1130617222 15:85422294-85422316 TAGAGTGAGTTGAGAGAATTAGG + Intronic
1130789760 15:87141463-87141485 TAGTGTAACCTGAGAGAAATAGG + Intergenic
1131163077 15:90121838-90121860 TTGAGTAACCTGAGAGATGGAGG - Intergenic
1131849759 15:96526189-96526211 TACAATGACCTGAGAGTGGAGGG - Intergenic
1133781334 16:8941491-8941513 TCGGTTGACCTGCGAGAAGAGGG - Intronic
1134688522 16:16175430-16175452 TGGAGGGAGCTGAGAAAAGAGGG + Intronic
1136615064 16:31393546-31393568 GAGTGTGACCTGAATGAAGAGGG + Intronic
1137065136 16:35832720-35832742 TTTAATGAGCTGAGAGAAGAAGG - Intergenic
1137783676 16:51119548-51119570 TTGGGAGGCCTGAGAGAAGAAGG - Intergenic
1138567852 16:57846438-57846460 GAGGGTGACCTAACAGAAGAGGG + Intronic
1139225242 16:65228217-65228239 TAGATTGACCTGTTTGAAGATGG - Intergenic
1141820313 16:86441297-86441319 TAGGGTGATTTGGGAGAAGAGGG - Intergenic
1145290615 17:21542702-21542724 GAGAGTGCCCTGAGAGAGCAGGG - Intronic
1145305607 17:21673372-21673394 CAGAGCGACCTGAAAGAAGATGG - Intergenic
1145371050 17:22306111-22306133 TAGAGAGACCTGGAAAAAGATGG + Intergenic
1145900164 17:28485420-28485442 TAGAGTGACCTGGAAGGATAAGG + Intronic
1146841703 17:36160905-36160927 TGGAGAGGCCTGACAGAAGAAGG - Intergenic
1146854015 17:36248865-36248887 TGGAGAGGCCTGACAGAAGAAGG - Intronic
1146869919 17:36372757-36372779 TGGAGAGGCCTGACAGAAGAAGG - Intronic
1146877276 17:36423838-36423860 TGGAGAGGCCTGACAGAAGAAGG - Intronic
1147072801 17:37973381-37973403 TGGAGAGGCCTGACAGAAGAAGG - Intergenic
1147084322 17:38052919-38052941 TGGAGAGGCCTGACAGAAGAAGG - Intronic
1147100270 17:38176885-38176907 TGGAGAGGCCTGACAGAAGAAGG - Intergenic
1147451571 17:40508559-40508581 CTGATTGACATGAGAGAAGATGG - Intergenic
1147766683 17:42841484-42841506 TAGAGTGACCTGAGAGAAGAGGG - Exonic
1147892980 17:43730334-43730356 GGGAGTGCCATGAGAGAAGATGG + Intergenic
1148021249 17:44555530-44555552 TAGACTGCTCTGAGAGAAAATGG + Intergenic
1149857601 17:60096457-60096479 TGGAGAGGCCTGAGAGAAGAAGG + Intergenic
1150083213 17:62259932-62259954 TGGAGAGGCCTGAGAGAAGAAGG - Intergenic
1150439570 17:65180181-65180203 TAATCTGCCCTGAGAGAAGAGGG + Intronic
1150506936 17:65708647-65708669 TAGAGTGACCTGAAAAATCAAGG - Intronic
1154050764 18:10954822-10954844 CAGAGAGAAATGAGAGAAGAAGG - Intronic
1155505511 18:26528904-26528926 TACAGTGACAGAAGAGAAGAGGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157690585 18:49678683-49678705 AAGAGCGACCTGAGAGGACAAGG + Intergenic
1161737837 19:6002521-6002543 CAGAGGGCCCTGAGAGATGATGG + Intronic
1162736884 19:12751866-12751888 TAGGGGGCCCTGAGGGAAGAGGG + Exonic
1163034707 19:14563968-14563990 TAGGAAGACCTGAGAGTAGAGGG - Exonic
1165417247 19:35702416-35702438 TAGATTGACCAGAGAGCAGCGGG - Intergenic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1202636779 1_KI270706v1_random:50412-50434 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
927412208 2:22839491-22839513 GATAAGGACCTGAGAGAAGATGG - Intergenic
929878678 2:45818030-45818052 GAGTATGACCTGAGACAAGAGGG + Intronic
930097735 2:47579587-47579609 TACAAATACCTGAGAGAAGAGGG - Intergenic
930417136 2:51103278-51103300 TTGAGTGTCCTCAGGGAAGAGGG - Intergenic
931188468 2:59976550-59976572 TAAAGTGAGCTCAGGGAAGAAGG - Intergenic
931222047 2:60296863-60296885 TAGAGGAACCTGAGTGGAGAAGG - Intergenic
932437893 2:71713637-71713659 TAGAGTAAGCAGAGAGGAGAAGG + Intergenic
934582933 2:95460627-95460649 TAGAGACAACTGAGAGAAGAGGG - Intergenic
934596517 2:95616087-95616109 TAGAGACAACTGAGAGAAGAGGG + Intergenic
934786248 2:97009475-97009497 TAGAGACAACTGAGAGAAGAGGG - Intronic
936441862 2:112561082-112561104 GAGAGTGGCCTGTAAGAAGAGGG + Intronic
938753651 2:134359986-134360008 TAGAGTCACCTGGGAGGCGAAGG + Intronic
939057842 2:137384693-137384715 TAGAGTGACTTGGCAGAAGGAGG + Intronic
939634944 2:144570791-144570813 TATAGAGACATTAGAGAAGATGG + Intergenic
941520155 2:166532170-166532192 TGGAGTGACCAGAGACTAGAAGG - Intergenic
943178882 2:184515993-184516015 TAGAGAGACTAGAGAGAAGCAGG + Intergenic
943377988 2:187104545-187104567 TACAGTAACCTCAGAGCAGAGGG + Intergenic
943496135 2:188623040-188623062 TGGAGGGAACTGAGAGAAGCTGG - Intergenic
945009692 2:205447822-205447844 TAGAGTGATCTAAAAGAAAAAGG - Intronic
948537672 2:238658275-238658297 TACAGTGTCCAGGGAGAAGAGGG - Intergenic
948618838 2:239220537-239220559 GACAGTGACCTCGGAGAAGATGG + Intronic
948822818 2:240558432-240558454 AAGAGTCACCGCAGAGAAGAGGG + Intronic
948880637 2:240855633-240855655 TACAGTCACTTGGGAGAAGAGGG + Intergenic
948935608 2:241162368-241162390 GAGAGTGAACTGACAGAGGAGGG + Intronic
949077016 2:242066561-242066583 TGCAGTGACCTCAGAGAAGATGG - Intergenic
1169307812 20:4508340-4508362 TAGGGTGAGATGAGAGAAGGTGG + Intergenic
1170381509 20:15764900-15764922 TAGAGTGAGCAGAGAGCAGAAGG - Intronic
1171523124 20:25790861-25790883 CAGAGCGACCTGAAAGAAGGTGG - Intronic
1171530864 20:25852839-25852861 CAGAGCGACCTGAAAGAAGGTGG - Intronic
1171553703 20:26065022-26065044 CAGAGCGACCTGAAAGAAGGTGG + Intergenic
1171880892 20:30616828-30616850 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
1172927471 20:38551904-38551926 TGGAGAGACCAGGGAGAAGAAGG + Intronic
1173268470 20:41509443-41509465 TAGAGTGCCCTAAGAGCAAAGGG + Intronic
1173303565 20:41826852-41826874 GAGAGAGACTTGATAGAAGACGG - Intergenic
1173405182 20:42758321-42758343 TACAGTGACCTGTCAGGAGAGGG + Intronic
1175171155 20:57082401-57082423 TGGGGTGACCTGGGAGAAAAGGG - Intergenic
1175708614 20:61201779-61201801 TGGAGTGTCCTGAGTGAGGATGG - Intergenic
1176842157 21:13850101-13850123 AAGCGGGACCTGGGAGAAGAGGG + Intergenic
1176968435 21:15237914-15237936 AAGGGTGACCCTAGAGAAGAGGG + Intergenic
1178891576 21:36524863-36524885 TAGAAGGAGCTGAGAAAAGATGG - Intronic
1180364092 22:11923901-11923923 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1180377725 22:12110795-12110817 TTTAATGAGCTGAGAGAAGAAGG - Intergenic
1180621438 22:17165200-17165222 GTGAGTTACCTGAGAGAAGCTGG + Intronic
1181112594 22:20610720-20610742 GAGAGTGAACAGAGAGAAGCCGG + Intergenic
1181768445 22:25109037-25109059 CAGTATGACCTCAGAGAAGAAGG + Intronic
1181915158 22:26273933-26273955 CAGAGTCACCTGAGAGAGCAGGG + Intronic
1182314259 22:29433420-29433442 TATAGTGACCACAGAGCAGATGG - Intergenic
1183449794 22:37886846-37886868 GTGAGAGATCTGAGAGAAGAGGG + Intronic
1183528238 22:38336660-38336682 TAGAGTGGGCTGCGAGGAGAAGG - Intronic
1183767927 22:39896541-39896563 TAGAGATAACTGAAAGAAGAGGG + Intergenic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1184003980 22:41695604-41695626 AAGAGAAACCTGAGAGAAGTTGG + Exonic
1184526848 22:45029073-45029095 TGGACTGGCCTGAGTGAAGAGGG + Intergenic
1185410020 22:50676950-50676972 TGGAGTGTCCTGTGAGAAGCTGG + Intergenic
949475666 3:4442616-4442638 TAGAGGGACAAGAGAGAAAAAGG + Intronic
949892499 3:8743734-8743756 TAAAGTCACATGAGAAAAGAGGG + Intronic
950138444 3:10599450-10599472 TAGAGTGCACTGGGAGAACAAGG - Intronic
951785370 3:26412882-26412904 TGCAGTGACCTGAGAAAATATGG - Intergenic
953355578 3:42253764-42253786 TGGAGTGAAGTGAGTGAAGAGGG + Intergenic
959402790 3:105923179-105923201 TAACGTGACTTGCGAGAAGAGGG - Intergenic
961093641 3:124136778-124136800 GAGTGTGACCTGGGAAAAGATGG + Intronic
962646382 3:137444933-137444955 AAGAGGGAGCTGTGAGAAGAGGG - Intergenic
963206678 3:142643249-142643271 TAGAGTGATCAGAGAGGAGGTGG + Intronic
963485188 3:145927009-145927031 AAGGGAGACCTGAGAGTAGATGG + Intergenic
964776708 3:160287158-160287180 TGATGTGTCCTGAGAGAAGAGGG + Intronic
967467366 3:189823379-189823401 TAGATTAACCTGACAGCAGATGG + Intronic
967843176 3:194023523-194023545 TATATGGACCTGAGAGAGGAAGG - Intergenic
969213052 4:5702240-5702262 CAGAGTGGTCTGAGAGATGAGGG - Intronic
971133190 4:23836412-23836434 TAGAGCGCCCTTAGAGAATAAGG - Intronic
972644790 4:40957024-40957046 TTGTGTGACCTCAGAGAAAATGG + Intronic
973394025 4:49578653-49578675 AAGCGGGACCTGGGAGAAGAGGG - Intergenic
974421662 4:61683953-61683975 TAGACTTTCCTGAGAGAAGAAGG + Intronic
975315793 4:72951844-72951866 TAGAATGACATCAGAGAAAAAGG - Intergenic
975591392 4:76003691-76003713 TTGGCTGACCTGTGAGAAGAAGG + Exonic
975609121 4:76186430-76186452 TAGGGTGACCACAGAGAAGAGGG + Intronic
977146791 4:93452411-93452433 TGGAGTAACCAGAGAGTAGAGGG + Intronic
977748630 4:100581340-100581362 TAGAGTGTTCTATGAGAAGAGGG - Intronic
978801717 4:112761812-112761834 TAGAGTGACATGAGGAAAAAAGG - Intergenic
980436922 4:132788526-132788548 GAGAGTGATGTCAGAGAAGATGG + Intergenic
980607431 4:135111242-135111264 TTTGGTGAGCTGAGAGAAGAAGG - Intergenic
982233402 4:153230027-153230049 CAGGCTAACCTGAGAGAAGAAGG + Intronic
983102307 4:163639973-163639995 TGGAGTGATCTGTGAGATGAGGG - Intronic
983184573 4:164687130-164687152 TAGAGTGATTTGAATGAAGAAGG - Intergenic
983464218 4:168066699-168066721 AAGAGTGTCTTGAAAGAAGATGG + Intergenic
983639670 4:169933409-169933431 TAGAGTGACCTGGGGGAGGATGG + Intergenic
984331567 4:178327384-178327406 TAGAGTGACCGAAAAGAGGAAGG + Intergenic
985859130 5:2456544-2456566 CAGAGTGACCTGATTGGAGAGGG - Intergenic
988018742 5:25596286-25596308 AGGGGTGAGCTGAGAGAAGATGG + Intergenic
989224973 5:39016338-39016360 GAGAGGGAACTGAGAAAAGAGGG + Intronic
990159696 5:52924047-52924069 TGGAGTGAGGGGAGAGAAGAGGG + Intronic
990523785 5:56605324-56605346 AAGGGAGACCTGATAGAAGATGG - Intronic
990934842 5:61136996-61137018 CAGAGTAAGCTGAGAGAATATGG + Intronic
991532954 5:67636042-67636064 TTGAGTGTCCTGAAAGATGAAGG + Intergenic
992022990 5:72643309-72643331 TAGGATGAGATGAGAGAAGATGG + Intergenic
992143716 5:73824385-73824407 TAGAAAGAGCTCAGAGAAGAAGG + Intronic
992407519 5:76473946-76473968 TAGAGTGACTTTAGGGAAGCTGG + Intronic
993133023 5:83923217-83923239 TAGAGTGTCTGGAGAGAAGGAGG - Intergenic
995146977 5:108797365-108797387 TAGAGAGACATGAGAGAGGGAGG - Intronic
996029305 5:118687169-118687191 TGCAGTGACCTGAGAGCAGAGGG + Intergenic
998367473 5:141640398-141640420 TAGAGACACCTGAGAGAAAGGGG - Exonic
998515528 5:142750293-142750315 TAGATTGAGCTGGGGGAAGAGGG - Intergenic
998590894 5:143477052-143477074 TAGAATGAACTGAGATATGAAGG + Intergenic
999228781 5:150049178-150049200 CAGAGTGAGCTGAGAGGAGGGGG + Intronic
1000243949 5:159433563-159433585 GAGTGTGACCTTAGGGAAGAAGG + Intergenic
1000923452 5:167165490-167165512 TGGGGTGACCAGAAAGAAGAGGG + Intergenic
1001943108 5:175754507-175754529 TGGAGTGGCCTGAGCAAAGATGG - Intergenic
1007094086 6:39202713-39202735 TTGAGTGCCCTCAGAGAGGAGGG - Intronic
1007492791 6:42236977-42236999 TAGAGTGAAAGGAGAGAAAATGG + Intronic
1008568370 6:52791276-52791298 TAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008572822 6:52831269-52831291 CAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008579769 6:52896235-52896257 CAGGGTGGCCTGAGAGCAGAGGG + Intronic
1010502096 6:76613370-76613392 TACAATGATCTGAGAGAATAGGG + Intergenic
1010945015 6:81963793-81963815 TAGAGTGAGATGACATAAGAAGG - Intergenic
1011865907 6:91826618-91826640 TAGAGGGAACAGAGAGAAGATGG - Intergenic
1012152020 6:95765898-95765920 TAACTTGACCTGAGAGAAGTAGG - Intergenic
1015180995 6:130362412-130362434 TTGACTGAAATGAGAGAAGATGG - Intronic
1016356733 6:143226800-143226822 CAGAGTTCCCTGAGAGAGGATGG - Intronic
1016707597 6:147129824-147129846 TAGAGAGACAGGACAGAAGAAGG + Intergenic
1017248429 6:152253182-152253204 TAGGGTGATCTCAGGGAAGATGG - Intronic
1017448051 6:154527085-154527107 TGAAGAGACATGAGAGAAGATGG + Intergenic
1017875398 6:158520084-158520106 GAGAGTGGCCTGGGGGAAGAGGG - Intergenic
1020231711 7:6324211-6324233 GAGGGTGAGCTGAGAAAAGAGGG - Intergenic
1020853274 7:13384472-13384494 TAGAAAGAACTCAGAGAAGATGG - Intergenic
1021403870 7:20241293-20241315 TATTGTTTCCTGAGAGAAGAGGG + Intergenic
1022077670 7:26989031-26989053 AAGAATGACCTGAGTGAATAGGG - Intronic
1022318446 7:29265656-29265678 GAGAGAGACATGAGAGAAGAGGG + Intronic
1022976007 7:35557535-35557557 TTGAGAGGCATGAGAGAAGATGG - Intergenic
1024673401 7:51616880-51616902 CAGAGTGACCAGAGAGAACTGGG + Intergenic
1026862573 7:73800574-73800596 TAGAGAGAACAGAGAGAATAGGG - Intronic
1028527997 7:91806679-91806701 TAGTGTCACATGAGAGAAAAAGG + Intronic
1028928909 7:96391264-96391286 AGGAGTGATCTGAGAGAGGATGG - Intergenic
1029359191 7:100075882-100075904 AAGAGTGACTGGAGAGAAGAGGG - Intronic
1031199759 7:118666134-118666156 TTGAGTGACCTGAGATGTGAGGG + Intergenic
1034369920 7:150585973-150585995 TAGAATGACCAGGGAGCAGAAGG - Intergenic
1035535568 8:388445-388467 TGCAGTGACCTCAGAGAAGATGG - Intergenic
1037806072 8:22058517-22058539 GAGAGAGACCTAGGAGAAGATGG + Intronic
1039550020 8:38436637-38436659 TAGAGACACCTTAGAGAAGCAGG - Intronic
1039796618 8:40921087-40921109 TAGAATCACCTGAGATAAGTAGG + Intergenic
1041159013 8:55018359-55018381 CAGAGTGATATCAGAGAAGAAGG + Intergenic
1042694750 8:71544529-71544551 AAAATTGACCTTAGAGAAGAGGG - Intronic
1043849809 8:85203916-85203938 CACAGATACCTGAGAGAAGACGG - Intronic
1044717662 8:95115290-95115312 TATAGTGACCCAAGAAAAGATGG + Intronic
1046724789 8:117662708-117662730 TGGAGTGACATGAAAGATGAAGG - Intergenic
1047022857 8:120794906-120794928 TAGACTGACCAGAAAGTAGATGG - Intronic
1047051319 8:121116639-121116661 TATAGAAACCTGTGAGAAGAGGG + Intergenic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1049702228 8:144020528-144020550 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702323 8:144020882-144020904 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702431 8:144021268-144021290 GAGAGGGACCTGAGGGAAGGGGG - Intronic
1049702600 8:144021942-144021964 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702752 8:144022563-144022585 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702840 8:144022914-144022936 GAGAGTGTCCTTAGAGAAGAGGG - Intronic
1049703009 8:144023527-144023549 GAGAGTGTCCTTAGAGAAGAGGG - Intronic
1049703073 8:144023778-144023800 TAGAGGGTTCTGAGGGAAGAGGG - Intronic
1049703118 8:144023950-144023972 TAGAAGGTCCTGAGGGAAGAGGG - Intronic
1049703126 8:144023982-144024004 TAGAGGGTCCTGAGGGGAGAGGG - Intronic
1049703155 8:144024067-144024089 TACAGGGTCCTCAGAGAAGAGGG - Intronic
1049703228 8:144024341-144024363 GAGAGGGTCCTGAAAGAAGAGGG - Intronic
1049703323 8:144024651-144024673 GAGAGGGTCTTGAGAGAAGAGGG - Intronic
1049703366 8:144024816-144024838 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1050441625 9:5669972-5669994 CAGATGGACCTAAGAGAAGAAGG + Intronic
1052259653 9:26499281-26499303 TAGAGTGAGGTTGGAGAAGAAGG + Intergenic
1054968945 9:71062028-71062050 TAGAGTTACCTGGGAGCAGTGGG - Intronic
1055774028 9:79748585-79748607 GAGAGTGAACAGAGAGAATAAGG + Intergenic
1055985862 9:82056251-82056273 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1057414148 9:94846421-94846443 TGGAGTGAGTTGAGAGAAGGTGG + Intronic
1057577313 9:96253575-96253597 TGGAGTGACCAGAGAGTGGATGG - Intronic
1057846175 9:98526407-98526429 TAAGGAGACCTGAGAGAAGAGGG - Intronic
1058568585 9:106314526-106314548 TTGAGTGACATGGGAAAAGATGG - Intergenic
1060831770 9:126722136-126722158 AAGAGGGGCCTGAGGGAAGAGGG - Intergenic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1187316124 X:18196812-18196834 AAGGGTGACCTGAGAGAGGTGGG + Intronic
1187921841 X:24211079-24211101 TTGTGTGAACTGAGAGAATATGG - Exonic
1188379905 X:29478689-29478711 GAGAAGGACCTGGGAGAAGAGGG - Intronic
1189318053 X:40069651-40069673 CAGAGGGACCTGGGAGAAGTGGG - Intronic
1191662620 X:63666702-63666724 TTTAGTGAACTGAGAGGAGAAGG - Intronic
1193082782 X:77422284-77422306 GAAAGTGACCTGAGAGAGGTTGG - Intergenic
1194247065 X:91528067-91528089 TTGAGTGACCTGTAAGAAAAAGG - Intergenic
1198767894 X:140096852-140096874 TATAGGAGCCTGAGAGAAGAAGG + Intergenic
1199315348 X:146370756-146370778 TAAAGTGACCTGAAAGAATTAGG - Intergenic
1200421966 Y:2979696-2979718 TTGTGTGAACTGAGAGAATATGG - Exonic
1200574189 Y:4867509-4867531 TTGGATGAGCTGAGAGAAGAAGG + Intergenic
1201702847 Y:16902794-16902816 TTTAATGATCTGAGAGAAGAAGG + Intergenic
1201936649 Y:19417983-19418005 TTTAATGAGCTGAGAGAAGAAGG - Intergenic