ID: 1147767969

View in Genome Browser
Species Human (GRCh38)
Location 17:42849514-42849536
Sequence CTCACACAGAATCGGATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 46}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147767960_1147767969 14 Left 1147767960 17:42849477-42849499 CCCTCAAACCCAAGTTAGATACA 0: 1
1: 0
2: 2
3: 10
4: 163
Right 1147767969 17:42849514-42849536 CTCACACAGAATCGGATCTAAGG 0: 1
1: 0
2: 0
3: 7
4: 46
1147767966_1147767969 5 Left 1147767966 17:42849486-42849508 CCAAGTTAGATACACGGTGGGAA 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1147767969 17:42849514-42849536 CTCACACAGAATCGGATCTAAGG 0: 1
1: 0
2: 0
3: 7
4: 46
1147767958_1147767969 18 Left 1147767958 17:42849473-42849495 CCTCCCCTCAAACCCAAGTTAGA 0: 1
1: 0
2: 1
3: 12
4: 146
Right 1147767969 17:42849514-42849536 CTCACACAGAATCGGATCTAAGG 0: 1
1: 0
2: 0
3: 7
4: 46
1147767959_1147767969 15 Left 1147767959 17:42849476-42849498 CCCCTCAAACCCAAGTTAGATAC 0: 1
1: 0
2: 0
3: 9
4: 90
Right 1147767969 17:42849514-42849536 CTCACACAGAATCGGATCTAAGG 0: 1
1: 0
2: 0
3: 7
4: 46
1147767957_1147767969 24 Left 1147767957 17:42849467-42849489 CCTGTACCTCCCCTCAAACCCAA 0: 1
1: 0
2: 2
3: 20
4: 222
Right 1147767969 17:42849514-42849536 CTCACACAGAATCGGATCTAAGG 0: 1
1: 0
2: 0
3: 7
4: 46
1147767965_1147767969 6 Left 1147767965 17:42849485-42849507 CCCAAGTTAGATACACGGTGGGA 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1147767969 17:42849514-42849536 CTCACACAGAATCGGATCTAAGG 0: 1
1: 0
2: 0
3: 7
4: 46
1147767956_1147767969 25 Left 1147767956 17:42849466-42849488 CCCTGTACCTCCCCTCAAACCCA 0: 1
1: 0
2: 0
3: 20
4: 278
Right 1147767969 17:42849514-42849536 CTCACACAGAATCGGATCTAAGG 0: 1
1: 0
2: 0
3: 7
4: 46
1147767961_1147767969 13 Left 1147767961 17:42849478-42849500 CCTCAAACCCAAGTTAGATACAC 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1147767969 17:42849514-42849536 CTCACACAGAATCGGATCTAAGG 0: 1
1: 0
2: 0
3: 7
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147767969 Original CRISPR CTCACACAGAATCGGATCTA AGG Intronic
910223421 1:84912760-84912782 CTCACACAGGATCCAATCCAGGG - Intergenic
913118131 1:115715140-115715162 ATCAAACAGAATCGGATCCCTGG - Intronic
915946626 1:160157130-160157152 CTGGCACAGAATCAGATCTAGGG - Intronic
919560248 1:199109466-199109488 CTCACACAGAATGGGAGAGAGGG - Intergenic
1071474063 10:86010012-86010034 CAGACACAGAATAGGATCCAGGG + Intronic
1075779766 10:125009616-125009638 CAGACACAGAATCAGAACTAAGG + Intronic
1076808865 10:132876319-132876341 CTCCCACAGAATTGCATTTAGGG - Intronic
1077651739 11:3978983-3979005 CCCAAACAGAATCAGAGCTAAGG + Intronic
1079000203 11:16746934-16746956 CTCACAAAGAATTTAATCTATGG - Intronic
1080306691 11:30844357-30844379 CTCACAGAGAATCTGTACTAGGG - Intronic
1090374413 11:126278857-126278879 GTCACACTGTATCTGATCTAGGG - Intergenic
1093471378 12:19505698-19505720 CTCACACAGAATAAAAGCTAAGG - Intronic
1094635048 12:32218111-32218133 CTCACACAGAAAAGCATCTGTGG - Intronic
1095801639 12:46275154-46275176 ATCACACAGGATCAGAACTAAGG - Intergenic
1099393522 12:82109849-82109871 CAGACACAGATTCGGATCTGAGG - Intergenic
1109954996 13:69554035-69554057 CTCTCACAGAATGGGAGTTAGGG - Intergenic
1119636832 14:76280074-76280096 CTCACACAGGATCGGCTCCGAGG - Intergenic
1120485102 14:85103572-85103594 CTAACAGAGAATAGGATCTATGG - Intergenic
1121908854 14:97770922-97770944 CTCACACAGAGTGGGAACCATGG + Intergenic
1132017396 15:98330965-98330987 TTTACAGAGAATCGGATGTAAGG - Intergenic
1134820472 16:17242856-17242878 ATCACACAGTATCTGATCTATGG + Intronic
1140748520 16:78002559-78002581 CTCCCAGAGATTCTGATCTACGG + Intergenic
1147767969 17:42849514-42849536 CTCACACAGAATCGGATCTAAGG + Intronic
1157998656 18:52590253-52590275 ATCATACAGAATGAGATCTAAGG + Intronic
1162675294 19:12294296-12294318 CTCTCACGGAGGCGGATCTAGGG + Intronic
929914887 2:46126693-46126715 CTAACACAGAACCGGGTCTATGG + Intronic
944881282 2:204015336-204015358 ATCACACAGAATTGGAGCTGTGG - Intergenic
946427502 2:219607047-219607069 CTCACACGGACTCGGCTCTGAGG - Exonic
1170401434 20:15988312-15988334 CTTACTCAGAATCAGATATATGG + Intronic
1173552058 20:43939190-43939212 CACAGACAGAATTGGAACTAAGG - Intronic
1176970208 21:15256181-15256203 CTATCACAGAATGGGATCTTCGG - Intergenic
1177344475 21:19852433-19852455 CTTACACAGAATTAGATCCAAGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179971661 21:44839195-44839217 CTCACACAGAATGTGATGGAAGG - Intergenic
952542722 3:34384106-34384128 ATCACACAAAATCAGATTTAAGG - Intergenic
961739098 3:129021304-129021326 CTCACACAGCATCGGATTCTTGG - Intronic
965031065 3:163369040-163369062 CTCACACAGAATCCCTACTAGGG - Intergenic
990025670 5:51184709-51184731 GTCAAACAGAATGGGATCTTGGG - Intergenic
1000500474 5:162042515-162042537 TTAACCCAGATTCGGATCTATGG + Intergenic
1001995816 5:176156959-176156981 CTCACACAGAATGTGGTCTATGG - Intergenic
1003539305 6:7004098-7004120 CTCACACAGCAGCAGAGCTAGGG - Intergenic
1009659242 6:66589198-66589220 TTCACACATAATCTGATCTCTGG + Intergenic
1013074622 6:106760382-106760404 CTCACATACAATCTGATATAGGG - Intergenic
1013976260 6:116082273-116082295 CTCACTCAGAATCGAGTCTAAGG - Intergenic
1016042420 6:139444830-139444852 CTCAAACAGAAAGAGATCTAGGG - Intergenic
1016700422 6:147048163-147048185 CTTTCACAGAATCGGATCCAAGG + Intergenic
1027486921 7:78773092-78773114 CTCACAAATTATCTGATCTAAGG - Intronic
1030925535 7:115449123-115449145 CTCACACTGAATAAGTTCTAAGG + Intergenic
1031446584 7:121862407-121862429 GTCACACAGCATGGGATCTCAGG + Intergenic
1037199786 8:16238539-16238561 CTGACACAGCATAGGATGTAAGG + Intronic
1041661663 8:60407082-60407104 CTCACACATAAACGGATATCTGG + Intergenic
1053378678 9:37630313-37630335 CTTACACAGAATAGCTTCTAGGG - Intronic
1054986232 9:71264711-71264733 CTCACTCAGAATCTGTTCAAGGG - Intronic
1187263233 X:17706672-17706694 ATCACAGAGAATCTGATATAAGG + Intronic