ID: 1147768488

View in Genome Browser
Species Human (GRCh38)
Location 17:42852172-42852194
Sequence CTGGAGGCCCAGTTTGAGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 2, 1: 0, 2: 3, 3: 25, 4: 304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147768479_1147768488 23 Complete closest: 23
total_pairs: 2
max_distance: 1000
Left 1147768479 17:42852126-42852148 CCAGAAGGTGTTCTATCAAGGCC 0: 2
1: 0
2: 1
3: 2
4: 73
Right 1147768488 17:42852172-42852194 CTGGAGGCCCAGTTTGAGGCCGG 0: 2
1: 0
2: 3
3: 25
4: 304
1147768481_1147768488 2 Complete closest: 2
total_pairs: 2
max_distance: 1000
Left 1147768481 17:42852147-42852169 CCGCTACTACGACAGCCTGGCCC 0: 1
1: 1
2: 0
3: 5
4: 106
Right 1147768488 17:42852172-42852194 CTGGAGGCCCAGTTTGAGGCCGG 0: 2
1: 0
2: 3
3: 25
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147768488 Original CRISPR CTGGAGGCCCAGTTTGAGGC CGG Exonic
900796445 1:4711442-4711464 CTGGGGTCCCAGGTGGAGGCCGG + Intronic
900817351 1:4858715-4858737 CTGGATGTCCAGTTTGCTGCAGG + Intergenic
900965258 1:5952916-5952938 CTGCAGGCCCCGGCTGAGGCTGG - Intronic
901402668 1:9025322-9025344 CTGGAGGCCAAGTGTGAAGTAGG + Intronic
901686869 1:10948049-10948071 CGGGATGCCCAGGGTGAGGCTGG - Exonic
901792671 1:11662499-11662521 CTGGAGGCCCAGCCACAGGCTGG + Exonic
903501907 1:23805123-23805145 CTGTAGGCCCAGATGTAGGCAGG - Intronic
903539702 1:24090031-24090053 CAGGAGGCCCAGTGTGTGGGAGG + Intronic
903543191 1:24108250-24108272 CTGGAAACCCTGTTTGAGGAGGG - Intronic
903570214 1:24298584-24298606 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
904461704 1:30684608-30684630 ACTGAGGCCCAGATTGAGGCAGG - Intergenic
904784229 1:32973389-32973411 CTGGAAGCCCAGTGAGAGGCAGG - Intergenic
905145371 1:35883564-35883586 ATGGGGGCCCAGTTTGAAGGAGG + Intronic
905232357 1:36522142-36522164 CTGGAGACCCAGTCTGAGGGGGG - Intergenic
905771650 1:40641882-40641904 CTGGAGGCCCCAGATGAGGCAGG + Exonic
906063653 1:42964393-42964415 TAGGAGACCCAGTGTGAGGCAGG - Intergenic
907272595 1:53299581-53299603 CTGGATGACCAATGTGAGGCTGG - Intronic
907985895 1:59530066-59530088 ATGAATGCCCAGTTTGAGACTGG - Intronic
909877547 1:80828158-80828180 ATGGAGGCCCAGATTGAGGGTGG - Intergenic
910410874 1:86943473-86943495 TTGGAGGCTGAGGTTGAGGCTGG + Intronic
912710269 1:111944839-111944861 CCGGAGGCCCAGGTTGAACCAGG + Intronic
914956972 1:152171664-152171686 CTGGGGCCTCAGTTAGAGGCAGG + Intergenic
916790611 1:168121874-168121896 CTGGGAGCCCAGTTCCAGGCAGG - Intronic
918070437 1:181130257-181130279 CTGCAGGGACATTTTGAGGCAGG - Intergenic
919075365 1:192807290-192807312 CAGGAGACCCAGTTAGAGCCTGG - Intergenic
919452510 1:197788160-197788182 CTGGAGGCCAAACTAGAGGCTGG + Intergenic
922669114 1:227495248-227495270 CTGGGAGCCCAATCTGAGGCTGG - Intergenic
922670483 1:227506054-227506076 CTGGGAGCCCAATCTGAGGCTGG + Intergenic
1062908804 10:1199174-1199196 CTGCAGGCCCAGCATGAGGCTGG + Intronic
1064100152 10:12456653-12456675 CTGTTGTCCCAGGTTGAGGCGGG + Intronic
1065968318 10:30786153-30786175 CTGGAGATGCAGTTTCAGGCTGG - Intergenic
1065968326 10:30786225-30786247 CTGGAGATGCAGTTTCAGGCTGG - Intergenic
1066394010 10:35001435-35001457 CTGGAGGCTGAGGCTGAGGCAGG + Intergenic
1068318829 10:55383032-55383054 CTGGAGGCCAAGTTAGAACCTGG - Intronic
1069997184 10:72349594-72349616 CTGGTGGCCCAGGCTGAGCCTGG + Intronic
1070513927 10:77186141-77186163 CTCGGGGCCCACTTAGAGGCAGG + Intronic
1073009183 10:100346843-100346865 CTGGGGACCCGGTTTGGGGCTGG - Intergenic
1073103323 10:101018500-101018522 CTTGAGGCCCAGTTAGAGAAGGG + Intronic
1073242377 10:102066876-102066898 CTGAAGGCCCAGCTGGTGGCTGG + Exonic
1074064786 10:110004409-110004431 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1074246869 10:111703176-111703198 CTGGAAAACAAGTTTGAGGCTGG - Intergenic
1074448749 10:113541707-113541729 CTGGAGGCCAAGTTTAACTCTGG + Intergenic
1074520956 10:114223414-114223436 CTGGAGCCCAAGATTGAGGAAGG - Intronic
1074678872 10:115882864-115882886 CTGGCGGCCCATTGGGAGGCAGG - Intronic
1076121348 10:127939516-127939538 CTGAAGGGCCAGTTTGGTGCAGG + Intronic
1076189735 10:128474697-128474719 AGGGAGGCCCAGTGTGAGCCAGG - Intergenic
1076250850 10:128982774-128982796 CTGGATGCCCAGGTTGAGCCAGG + Intergenic
1076317633 10:129553795-129553817 ATGGAGGCCACGTTTGGGGCAGG - Intronic
1076519617 10:131073505-131073527 TTGGAGGCCCTGATGGAGGCAGG - Intergenic
1076988135 11:253988-254010 ATGGAGGACAGGTTTGAGGCTGG - Intergenic
1077431116 11:2516468-2516490 CTGGGGGCCAATTTTGAGCCCGG - Intronic
1078079829 11:8195865-8195887 CTGGAGGCTCAGCTAGGGGCTGG + Intergenic
1078129589 11:8602331-8602353 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
1080231165 11:30018290-30018312 CTGGAGTTACAGTTTGAGGAAGG + Intergenic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1084755247 11:71234525-71234547 GTGGAGGACCAGTCTGGGGCGGG - Intronic
1084891867 11:72240690-72240712 CGGGAGGCTGAGTTTGTGGCAGG - Intronic
1085779918 11:79398816-79398838 CTGGGGGCCCAAGTAGAGGCTGG + Intronic
1086212533 11:84338131-84338153 TTGGAAGCACAGTTTGAGACAGG + Intronic
1087723082 11:101688695-101688717 CTGGGAGAACAGTTTGAGGCTGG - Intronic
1088696468 11:112370392-112370414 CTGGGGGTCCAGCCTGAGGCTGG + Intergenic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1088815804 11:113419995-113420017 CTGGATGCCCATTTTGCGGGTGG + Intronic
1089561286 11:119344537-119344559 CGGAGGGCCCGGTTTGAGGCTGG + Intronic
1090565042 11:127980983-127981005 CTGGGGGCACAGTATTAGGCAGG - Intergenic
1091305267 11:134532352-134532374 CTGGAGGGCCGGGCTGAGGCTGG + Intergenic
1091318149 11:134630611-134630633 CTGGAAGTCCAGATTTAGGCTGG + Intergenic
1091642724 12:2249880-2249902 CGGGAGGCGGAGCTTGAGGCAGG - Intronic
1092052446 12:5481195-5481217 CTGGAGGAGCAATTTGATGCCGG + Intronic
1092713670 12:11365468-11365490 CTGCAGTCCCAGTTAGTGGCAGG + Intronic
1092898365 12:13035594-13035616 CTGTAGCCCCAGGCTGAGGCAGG - Intergenic
1096238380 12:49944983-49945005 GTTGAGGCCCAGGTGGAGGCAGG - Intergenic
1097058256 12:56263646-56263668 CAGGAGGCTGAGGTTGAGGCAGG - Intergenic
1097942181 12:65322547-65322569 CTGGAGGCTGAGGCTGAGGCAGG + Intronic
1097998997 12:65921369-65921391 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1098343051 12:69470896-69470918 CTGGAGCCCAAGATTGAGTCTGG - Intronic
1099075684 12:78104479-78104501 CTGGATTCACAGTTAGAGGCAGG - Intronic
1099960443 12:89392069-89392091 CTAGAGGCCAAATATGAGGCCGG - Intergenic
1101432683 12:104639774-104639796 GTGCAGGCCCAGTTGGAGGTCGG + Intronic
1101565021 12:105896893-105896915 CTGTAGGACCAGGTTGAGCCTGG + Intergenic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1101880786 12:108624127-108624149 CTGGAGGCTCCGTTTCTGGCAGG + Exonic
1103200301 12:119082677-119082699 CTGGAGGCCCAGGGTGGGGCTGG - Intronic
1103459188 12:121090145-121090167 CTGCAGGCCCAGCCTGGGGCCGG + Intergenic
1103544066 12:121687238-121687260 CTGGTGGCCGAGTTTGGGGCGGG + Intergenic
1104192511 12:126496457-126496479 TTGAAGGCCCACTTTGTGGCTGG + Intergenic
1104313723 12:127677774-127677796 CTGCAGGCCCAGTGGGTGGCTGG + Intergenic
1104980665 12:132571876-132571898 CCGGAGGCCCGGTCTGAGGAGGG + Intronic
1105443926 13:20436563-20436585 CTGAAGGCCCAGGAAGAGGCTGG - Intronic
1111919417 13:94394831-94394853 CAGTAGGCACAGTTAGAGGCTGG + Intronic
1112229008 13:97569052-97569074 CTGGAAGCCCAGCCTGGGGCTGG + Intergenic
1115804901 14:37039858-37039880 CTTGAGGCTAAGCTTGAGGCAGG + Intronic
1119387405 14:74266227-74266249 CTGGAGGGCCAGCAGGAGGCTGG - Intergenic
1120064404 14:80023455-80023477 CTGGAGGTACAGTTTGAAGTCGG + Intergenic
1121311937 14:92940088-92940110 CAGGATGCCCACTTTGAGGAGGG - Exonic
1121715282 14:96069566-96069588 CTGGCAGCCCAGTTTGGAGCTGG + Intronic
1121752667 14:96370501-96370523 TTGGGGGGCCAGTTTGAGGTGGG + Intronic
1121762098 14:96454588-96454610 TTGGTGGCCCAGGCTGAGGCAGG - Intronic
1122761664 14:104033301-104033323 CAGGAGCCCCAGTGTGAAGCCGG + Intronic
1123057177 14:105576023-105576045 CTGGAGGCTCAGATGGAGACGGG - Intergenic
1123081067 14:105695868-105695890 CTGGAGGCTCAGATGGAGACGGG + Intergenic
1123213649 14:106785353-106785375 CTGCAGGCCCAGCAGGAGGCCGG - Intergenic
1202884196 14_KI270722v1_random:88645-88667 CTTGAGGCCCAGTTACAGGTCGG + Intergenic
1124416041 15:29473950-29473972 CAGGAGGCCCAGCTTGATGTGGG - Intronic
1125107593 15:35991564-35991586 CAGGAGGCCAAGGTTCAGGCAGG + Intergenic
1125592202 15:40861822-40861844 CTGGAGGCTGAGGCTGAGGCAGG - Intergenic
1126552386 15:49947083-49947105 CTGGAGCCCCAGTTTGAGCTGGG + Intronic
1127631449 15:60831499-60831521 CTGGAGGTCAGGTCTGAGGCAGG + Intronic
1128428471 15:67567893-67567915 ATGGAGGCCCAGTTCTAGGAGGG + Intronic
1128430808 15:67591490-67591512 CTGTAGTCCCAGCTGGAGGCTGG - Intronic
1128562570 15:68678331-68678353 CTGGGGGCTCAGTGTGAGGGAGG - Intronic
1128645521 15:69376022-69376044 CTGGATGCTGAGCTTGAGGCAGG + Intronic
1129882979 15:79019179-79019201 CAGGAGGCCCAGTCTGAGGAGGG + Intronic
1131021595 15:89103827-89103849 CTGGAGGCCCAGTGTTGGGCTGG + Intronic
1131317153 15:91349427-91349449 CTGGGGGCCATCTTTGAGGCTGG + Intergenic
1132826360 16:1907541-1907563 CTGGAGGGTCAGGGTGAGGCGGG - Intergenic
1132885866 16:2181681-2181703 CTTGGGGCCCAGCTTGGGGCTGG + Intronic
1132975620 16:2709825-2709847 CTGGGTGCCCAGCATGAGGCCGG + Intergenic
1133322908 16:4925235-4925257 CTGGAGGGCCAGCTTGGGGGAGG + Intronic
1134269657 16:12722611-12722633 CTGTAGTCCCAGCGTGAGGCAGG + Intronic
1134666645 16:16023734-16023756 CTGGAGCCCCAGGCTGAGTCAGG - Intronic
1135544343 16:23355652-23355674 CTGGAGGCAGAGCCTGAGGCAGG + Intronic
1136016998 16:27406749-27406771 CTGGATGCGGAGTGTGAGGCAGG - Intronic
1136283716 16:29229495-29229517 CTGCAGGCCATGTTTGAGGTGGG + Intergenic
1136580927 16:31150252-31150274 CTGGAGGCCCAGGGTGGGGGTGG + Intergenic
1137013120 16:35344258-35344280 CTCGGAGCCCAGTTTGACGCAGG + Intergenic
1137578942 16:49621764-49621786 CTGCAGGCCTGGTTTGGGGCTGG - Intronic
1137930628 16:52584052-52584074 CTGGAGGCACAGGGTGAGGGAGG - Intergenic
1138315225 16:56064047-56064069 TTGGAGGTTCAGTTTCAGGCTGG + Intergenic
1138343006 16:56303057-56303079 GTGGAGGTCCCGTTTCAGGCCGG - Intronic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1140280521 16:73550410-73550432 CAGTAGGCCCAGTGTGAGGCTGG + Intergenic
1141172020 16:81697485-81697507 CTGGAAGCCCAGTTTGAGTGTGG - Intronic
1142088749 16:88199006-88199028 CTGCAGGCCGTGTTTGAGGTGGG + Intergenic
1142776588 17:2144831-2144853 CTGGAATCCCAGCTTTAGGCAGG + Intronic
1142797321 17:2318574-2318596 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1143434096 17:6909716-6909738 CTGGAGGCCCATGGTGAGGGTGG + Intronic
1144375831 17:14640154-14640176 GTGGAAGCACAGTTAGAGGCAGG + Intergenic
1145813254 17:27777568-27777590 CTGAAGACCCAGTTTGTGCCAGG + Intronic
1145983826 17:29031029-29031051 CGGGAGGCCGTGGTTGAGGCAGG - Intronic
1146055344 17:29578070-29578092 GAGGAGCCCCAGTCTGAGGCTGG + Intronic
1147768488 17:42852172-42852194 CTGGAGGCCCAGTTTGAGGCCGG + Exonic
1147771076 17:42868104-42868126 CTGGAGGCCCAGTTTGAGGCCGG + Intergenic
1150114307 17:62531929-62531951 TTGGAGGCCCAGCTTGAAGTGGG + Intronic
1150133538 17:62681781-62681803 GTGGAGGCCCAGCTGGGGGCCGG + Intronic
1151408901 17:73907676-73907698 ATGGAGGCCGAGGCTGAGGCGGG + Intergenic
1151766881 17:76137411-76137433 CCGGAGCCCCTCTTTGAGGCTGG - Exonic
1151812543 17:76453008-76453030 CCGGAGGCCGAGTCCGAGGCGGG + Exonic
1151861089 17:76762542-76762564 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1154132513 18:11749745-11749767 AGTGAGGCCCAGCTTGAGGCTGG + Intronic
1155074378 18:22342002-22342024 CTGGAGGCATAGGCTGAGGCTGG + Intergenic
1158712013 18:59845996-59846018 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
1160947695 19:1651364-1651386 CTGGAGGCCGGGTGTGAAGCGGG + Intronic
1161218147 19:3105012-3105034 CTCCAGACCCAGTCTGAGGCAGG + Intronic
1161243157 19:3234158-3234180 ATGGAGGCCCAGGTAGAGGAGGG + Intronic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1161775747 19:6261169-6261191 CAGGAGGCCCACTTGCAGGCAGG + Intronic
1161960653 19:7521106-7521128 CTGGAGCTCCAGATTGTGGCTGG - Intergenic
1163829772 19:19542035-19542057 CTGGGGGCCCAGTAAGGGGCTGG - Intronic
1163865766 19:19772095-19772117 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
1165078311 19:33293058-33293080 CTGAAGGCCCACTGTGAGCCAGG + Intergenic
1168723915 19:58570440-58570462 TTGGAGGCTCAGTTTCAGGTAGG + Exonic
925104817 2:1282487-1282509 CAGAAGGCCCAGCTTCAGGCTGG + Intronic
925315799 2:2922188-2922210 CTGGAGGGTCAGCATGAGGCTGG - Intergenic
925912781 2:8584006-8584028 CTGGAGGCCCTCCCTGAGGCTGG - Intergenic
927736356 2:25526055-25526077 CAGGAGCCCCAGGTGGAGGCAGG + Intronic
928939904 2:36717288-36717310 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
929428989 2:41870994-41871016 CTTGAGGCTCATTTGGAGGCTGG - Intergenic
929667491 2:43844493-43844515 CTGGAGGCCCTGTGGGAGACAGG - Exonic
932667397 2:73708363-73708385 GTGGAGGCCCAGTTGGGGGAGGG - Intergenic
935173163 2:100626393-100626415 TTGGAGGTCCAGCTTCAGGCTGG + Intergenic
935560780 2:104557489-104557511 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
935607187 2:104982972-104982994 CTGGTGGCCAAGTTTGAGGCAGG + Intergenic
936876890 2:117200897-117200919 CTGGAACCCCAGTTAGGGGCTGG - Intergenic
937307252 2:120879882-120879904 GTGGAGGCTCAGCTAGAGGCTGG - Intronic
937341791 2:121095936-121095958 CTGGGGAACCAGTCTGAGGCCGG + Intergenic
937416904 2:121722239-121722261 TTGGAAGCACAGTTTGAGGTTGG + Intergenic
937506747 2:122546236-122546258 TTTGAGGCAAAGTTTGAGGCGGG - Intergenic
937909498 2:127068659-127068681 CAGGAGGCCCATTCTCAGGCTGG + Intronic
938343796 2:130552358-130552380 CAGGAGGCCCAGGTGGAGGAGGG - Intergenic
938346037 2:130568364-130568386 CAGGAGGCCCAGGTGGAGGAGGG + Intergenic
941936968 2:170989762-170989784 CTGTAGTCCCAGCTTGAGCCCGG + Intergenic
944168678 2:196750809-196750831 CTGGTGGCCCAGACTGAGCCAGG - Intronic
944306583 2:198186542-198186564 CTGGAGGTCCACTTGGGGGCTGG - Intronic
944581699 2:201137666-201137688 CTGGATGCCCACTATGAGGTAGG + Intronic
947885527 2:233566603-233566625 TTGGTGGCCCAGTCTGAGGAGGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1168992048 20:2103228-2103250 CTGGTGGCGCCGCTTGAGGCTGG - Exonic
1170662883 20:18360092-18360114 CTGGAGGACAAGCCTGAGGCTGG - Intergenic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1171311841 20:24150989-24151011 CTGGAGGCAGAGTTTGAGGCTGG - Intergenic
1171465263 20:25323632-25323654 CTGCAGGCCCAGCCTCAGGCAGG + Intronic
1171824065 20:29878625-29878647 CTGGAGGAGCAGGTTGGGGCGGG - Intergenic
1172110506 20:32541894-32541916 CTGGGTGGCCTGTTTGAGGCAGG + Intronic
1172277194 20:33686197-33686219 CTGGAGGCCCTGCTCGGGGCCGG - Exonic
1173555105 20:43960440-43960462 GAGGTGTCCCAGTTTGAGGCAGG - Intronic
1174149107 20:48473623-48473645 CTGGAGTTCTAGTTTGAGGTGGG - Intergenic
1176671350 21:9738032-9738054 CTGGAGTCCCTGTTGGATGCTGG + Intergenic
1178660742 21:34505521-34505543 CTGGAGGGAGAGTGTGAGGCAGG + Intergenic
1179562791 21:42227103-42227125 CTGCAAGCCCAGTTGGTGGCTGG + Intronic
1179597165 21:42450669-42450691 TTGGCTGCCCAGCTTGAGGCCGG - Intergenic
1179878880 21:44285361-44285383 ATGGAGGCTCAGTCTGATGCAGG - Intergenic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1181125862 22:20702261-20702283 CTGCAGGCGCTGGTTGAGGCAGG - Intergenic
1181164825 22:20977591-20977613 CTGGAGGATCAGTCTGGGGCTGG + Intronic
1181694454 22:24585932-24585954 GTGGAGTCCCAGGTGGAGGCAGG + Exonic
1181974552 22:26719711-26719733 CTGTAGTCCCAGTTACAGGCTGG + Intergenic
1182118612 22:27772933-27772955 CACTAGGCCCAGTTTGAGGCTGG + Intronic
1183367017 22:37412356-37412378 CAGGAGCCCCAGTCTGAGGGTGG - Intronic
1183670786 22:39271277-39271299 CTGGAGGCCCAGGTCTCGGCAGG + Intergenic
1184144744 22:42603004-42603026 CTTGACTCCCAGTTTGAGCCGGG + Exonic
1184992717 22:48181735-48181757 CTGGAGGCCTGGTCTTAGGCTGG - Intergenic
1185247446 22:49780658-49780680 CTGGTGGTCCAGGTGGAGGCTGG - Intronic
1185322620 22:50208955-50208977 CTGCAGGGCCAGCTTGGGGCGGG + Intronic
950193205 3:10992307-10992329 CTGGTGACCCAGGATGAGGCCGG + Intergenic
950400296 3:12764634-12764656 CTGGAGGCCCAGGATGAGTAAGG - Intronic
951059035 3:18183117-18183139 TTGGAGTCCCAGATTGAGGGTGG - Intronic
953236418 3:41111383-41111405 CTGTAGGACCAGGTAGAGGCTGG + Intergenic
953925530 3:46980567-46980589 CTGGATGCCCAGGGTGAGGGTGG + Intronic
954772729 3:52987180-52987202 CTGAAGGACCTGTCTGAGGCTGG + Intronic
955389684 3:58512145-58512167 CAGGAGGCCCAGGTTTGGGCAGG - Intronic
955926820 3:64014801-64014823 CTGGTGCTCCAGTTTGGGGCTGG + Intronic
961483247 3:127197241-127197263 CTGGAGGCCCATTCTGAGGGAGG - Exonic
961486555 3:127221337-127221359 CTGGAGGTCCATTCTGAGGGAGG + Intergenic
966151964 3:176875364-176875386 CTGGAAGCCCAGTTACAGGGAGG + Intergenic
966189847 3:177262251-177262273 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
966405026 3:179587744-179587766 CTGGAGTCCCAGGCTGAGGTGGG + Intronic
967823845 3:193862952-193862974 TTGGAGTCCCAGACTGAGGCAGG - Intergenic
968250899 3:197212326-197212348 CTGGAGGCCCTAATTGTGGCTGG + Intronic
968652177 4:1764657-1764679 CTGGGGGCCGAGTGTGAGCCTGG + Intergenic
968966629 4:3772255-3772277 CTGCAGGCCCATCTCGAGGCTGG + Intergenic
969385269 4:6841248-6841270 CTGGAAGAGCAGTTTGAGCCTGG - Intronic
970030808 4:11672540-11672562 GTGGAAGCTCAGATTGAGGCAGG - Intergenic
970974131 4:22023413-22023435 CTGGGGACACAGGTTGAGGCTGG + Intergenic
971209837 4:24605251-24605273 CTGGTGCCTCAGTATGAGGCTGG - Intergenic
971419102 4:26459599-26459621 CTGAAGGCCCACTTTGTGCCAGG + Intergenic
971833752 4:31734170-31734192 CGGGAGGCCGAGGCTGAGGCAGG - Intergenic
972630324 4:40836550-40836572 TTAGAGGCCTTGTTTGAGGCAGG + Intronic
974935809 4:68408717-68408739 CAGGAGGCTCAGGCTGAGGCAGG - Intergenic
977223762 4:94370381-94370403 CTGGAGGCTCTGAATGAGGCAGG + Intergenic
978834050 4:113126407-113126429 ATTCTGGCCCAGTTTGAGGCAGG - Intronic
979667386 4:123327345-123327367 TAGGAGGCACTGTTTGAGGCTGG - Intergenic
980131881 4:128824306-128824328 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
980421556 4:132566707-132566729 CTGGAGACCCAGTTTGGTGGGGG + Intergenic
982206220 4:152999074-152999096 CTGCTGGCCCTGTTTGTGGCGGG - Intergenic
982405063 4:155010252-155010274 CTGGAGGCCATTTTGGAGGCTGG - Intergenic
984490912 4:180433354-180433376 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
985403376 4:189613761-189613783 CTGGAGTCCCTGTTGGATGCTGG - Intergenic
985752305 5:1687574-1687596 CTGGGGATCCAGTGTGAGGCTGG + Intergenic
989594812 5:43146481-43146503 CTGGAGGCTGAGGCTGAGGCAGG + Intronic
992555647 5:77900276-77900298 TGGGAGGCTGAGTTTGAGGCAGG + Intergenic
992751328 5:79865479-79865501 CTGTAGTCCCAGGTTGAGGTGGG - Intergenic
996540522 5:124626504-124626526 CTGGGGACCCCGTTTGTGGCTGG - Intergenic
998040052 5:138946088-138946110 CGGGAGGGCCAGTCTGGGGCAGG - Intergenic
998648550 5:144091452-144091474 CTGGAGGACCAATTTGAATCAGG - Intergenic
1001034786 5:168290075-168290097 GTTGAGGGCCAGTCTGAGGCTGG + Intergenic
1001128117 5:169039132-169039154 TTGTAGACCCAGTTTGAGGATGG + Intronic
1001410091 5:171505317-171505339 CTGGAGGCACTGGTTGCGGCTGG + Intergenic
1001654414 5:173338582-173338604 CTGGAGGCCCAGCATGTGGTGGG + Intergenic
1001859804 5:175044139-175044161 CTGGAGGCCCAGTAAGAGACTGG - Intergenic
1001953750 5:175833913-175833935 CTGGAGGCCCAGGTTCCTGCAGG + Intronic
1002338222 5:178495061-178495083 CTGCAGGCCCAGGAGGAGGCTGG - Intronic
1002528505 5:179829202-179829224 CGGGATGCCCAGTTTCAGGCTGG - Intronic
1003424415 6:5988173-5988195 CTGGAGGCCCTTTTGGAGGCCGG + Intergenic
1003648835 6:7939326-7939348 GTGGAGGCCCAGTGTGAGCTTGG - Intronic
1006507107 6:34496370-34496392 CTGCAGGCCCAGGCTGAGGGGGG + Intronic
1007502568 6:42309896-42309918 TTGTAGTCCCAGGTTGAGGCGGG - Intronic
1007750225 6:44066781-44066803 AGGGAGCCCCAGTCTGAGGCGGG - Intergenic
1007875769 6:45099056-45099078 CTGGAGGACCATGTTGGGGCAGG - Intronic
1008886843 6:56440648-56440670 CAAGAAGCCCAGTTGGAGGCAGG + Intergenic
1011259734 6:85458408-85458430 CTGGATGACCAGCTTCAGGCAGG + Intronic
1014579584 6:123120574-123120596 CTTGAAGTCCAGTATGAGGCAGG - Intergenic
1016409829 6:143771347-143771369 CTGTAGTCCCAGCTTGAGCCTGG - Intronic
1016668852 6:146676821-146676843 CTGGAGGCCCACTGTGAGCAAGG - Intronic
1017013037 6:150077091-150077113 TTGGAAGTCCAGTTAGAGGCAGG - Intergenic
1017491932 6:154952610-154952632 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1018822300 6:167382929-167382951 CTGGAGGGTCAGCTCGAGGCCGG - Exonic
1018844553 6:167546744-167546766 ATGGTGGCTCAGTTTCAGGCGGG + Intergenic
1019353104 7:564340-564362 CTGGCGGCGGAGGTTGAGGCTGG - Intronic
1019556810 7:1635889-1635911 TTGGAGGCCCTCTTAGAGGCTGG + Intergenic
1021788806 7:24179083-24179105 CTGCAGGCCCACTTTGAAGATGG - Intergenic
1022398094 7:30008851-30008873 CTGTAGCCCCAGGCTGAGGCAGG + Intergenic
1023656343 7:42425253-42425275 CTGGATGCCCAGGTTGGGGTTGG + Intergenic
1023659946 7:42460903-42460925 CTGCAGGCCCAGTGCGAGGAAGG + Intergenic
1027181560 7:75944028-75944050 GAGGAGGCCCAGTGTGAGTCAGG + Intronic
1027241900 7:76336041-76336063 CTGTAGTTCCAGGTTGAGGCAGG - Intronic
1027890895 7:83973331-83973353 TTGGTGTCCCAGTTTGATGCTGG + Intronic
1028024431 7:85820078-85820100 CTGTAGTCCCATTCTGAGGCAGG + Intergenic
1029272400 7:99385075-99385097 CTGTAGTCCCAGCCTGAGGCAGG - Intronic
1030533207 7:110735751-110735773 CTGTAGTCCCAGCTTGAGCCTGG + Intronic
1030924686 7:115437550-115437572 CTGTAGTCCCAGCCTGAGGCAGG - Intergenic
1032044012 7:128587700-128587722 CTGGAGGCCCAGCTTGAAGTGGG + Intergenic
1033741226 7:144277208-144277230 CTGGAGCAGCAGTTTGAGGCGGG + Intergenic
1033752677 7:144372406-144372428 CTGGAGCAGCAGTTTGAGGCGGG - Exonic
1035825928 8:2644028-2644050 TGGGAGGCCAAGCTTGAGGCTGG + Intergenic
1037879620 8:22566346-22566368 CTGGAGCTCCAGGCTGAGGCCGG - Exonic
1037992965 8:23333527-23333549 CTGGGGGCCCAGCTTGCAGCTGG + Exonic
1038554135 8:28494595-28494617 GGGGACGCCTAGTTTGAGGCTGG + Intronic
1041465326 8:58152634-58152656 ATGGCGGCACACTTTGAGGCAGG - Intronic
1043231564 8:77808643-77808665 CTGCAGGCACCATTTGAGGCAGG - Intergenic
1047275458 8:123401937-123401959 CTGGATGCCCACTATGAGGTAGG - Intronic
1050219633 9:3372657-3372679 CTGGAGGCAGAGGTTGAGGCAGG - Intronic
1052857129 9:33414450-33414472 CAGGAGCCTGAGTTTGAGGCTGG + Intergenic
1052941237 9:34133307-34133329 CTGGATGCCCACTATGAGGTAGG + Intergenic
1053073622 9:35115426-35115448 TTGTAGGCCCAACTTGAGGCAGG - Intronic
1053482372 9:38424916-38424938 CTGGAAGCCGAGTTGGAGGATGG - Intergenic
1054141251 9:61531749-61531771 CTGGAGGCCAAATTTGAGACAGG - Intergenic
1054192335 9:61995206-61995228 CTGGTGGCCAAATTTGAGACAGG + Intergenic
1054337225 9:63817734-63817756 CTGGAGGAGCAGGTTGGGGCGGG - Intergenic
1054646071 9:67593485-67593507 CTGGTGGCCAAATTTGAGACAGG - Intergenic
1056571774 9:87823370-87823392 CTTGAGGCCCAGTGTGAGCAAGG - Intergenic
1057995008 9:99813899-99813921 CTGGTTGCCCAGATTGAGGGAGG - Intergenic
1058988230 9:110229160-110229182 CTGGCAGGGCAGTTTGAGGCAGG + Intergenic
1060209284 9:121700047-121700069 CTGGGGGCACAGCCTGAGGCTGG + Intronic
1060762869 9:126270939-126270961 CTGGTGGCCCATGCTGAGGCAGG + Intergenic
1061082680 9:128381571-128381593 CTGTAATCCCAGGTTGAGGCAGG + Intronic
1061779420 9:132987026-132987048 CTGGAGGCCCAGTCTAGGGCTGG + Intronic
1061895109 9:133643108-133643130 CTGCAGCCCCAGTGGGAGGCAGG - Intronic
1062501627 9:136854348-136854370 GTGGGGGCCCAGAGTGAGGCTGG + Intronic
1203441728 Un_GL000219v1:15787-15809 CTGACAGCCCAGTTTGATGCAGG + Intergenic
1203377132 Un_KI270442v1:385055-385077 CTGGAGGAGCAGGTTGGGGCGGG - Intergenic
1203406636 Un_KI270538v1:25779-25801 TTGGAGGCCCAGTTTGAAAAAGG + Intergenic
1203512538 Un_KI270741v1:134696-134718 CTGACAGCCCAGTTTGATGCAGG + Intergenic
1186530047 X:10286323-10286345 CTGGTGGAGCAGTTTTAGGCGGG + Intergenic
1188342476 X:29021099-29021121 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1189112382 X:38305197-38305219 CTTGAGGCCAGGTTTGAGACTGG + Intronic
1189655307 X:43238898-43238920 GAGGAATCCCAGTTTGAGGCAGG - Intergenic
1190451658 X:50588031-50588053 CTTAAGGTCCAATTTGAGGCTGG - Intergenic
1192453825 X:71261113-71261135 TTGGAGGCCGAGGCTGAGGCAGG - Intergenic
1198444589 X:136699747-136699769 CTGGAGAACCATCTTGAGGCGGG + Intronic
1198936997 X:141908890-141908912 GTGGAGGGCCTGGTTGAGGCTGG + Exonic
1200225732 X:154416321-154416343 CGGGAGGCGGAGCTTGAGGCAGG + Intronic
1200917326 Y:8582893-8582915 GTGAAAGGCCAGTTTGAGGCAGG + Intergenic
1201668400 Y:16487033-16487055 CAGGAGACTCAGTTTGAGCCAGG - Intergenic