ID: 1147769170

View in Genome Browser
Species Human (GRCh38)
Location 17:42856023-42856045
Sequence CTGTGGGTGTCACCCTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147769158_1147769170 29 Left 1147769158 17:42855971-42855993 CCTCAGTTGTGGGGAACTCTTGG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1147769170 17:42856023-42856045 CTGTGGGTGTCACCCTCTGGGGG 0: 1
1: 0
2: 3
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147769170 Original CRISPR CTGTGGGTGTCACCCTCTGG GGG Intronic
900362690 1:2297545-2297567 CTGTGGCTGGCAGCTTCTGGAGG + Intronic
900480207 1:2894530-2894552 CTGAGTGTGCCACCCTCCGGAGG + Intergenic
901441301 1:9280153-9280175 CAGAGGGTGTCTCCCTCGGGAGG + Intergenic
906667866 1:47634203-47634225 CTGAGGGTTTCACAGTCTGGGGG + Intergenic
908631692 1:66116527-66116549 CTGAGGGTGTCAACATCCGGAGG + Intronic
910064661 1:83139221-83139243 CTGTGGGTGTCACTATTTGTGGG + Intergenic
912344222 1:108949269-108949291 CTGTGGGAGCCACCCTCGGTTGG - Intronic
912419121 1:109531548-109531570 CTGTGGGTTCCACTCTCTGTGGG + Intergenic
915570751 1:156743957-156743979 CTGTGGGTGTCAGCCTGGGAAGG - Intronic
917348178 1:174050251-174050273 CTGGGGGTGTTCCCATCTGGGGG - Intergenic
920403827 1:205694086-205694108 CTGTGGGGGCTTCCCTCTGGGGG + Intergenic
924243641 1:242061809-242061831 CAGTGGCTGTCACCCTCTGAGGG + Intergenic
924457792 1:244231929-244231951 CAGTGTGTGTCACCCTGCGGAGG - Intergenic
1065969909 10:30798108-30798130 CTGTGGGTGCCCCTCTCTTGGGG - Intergenic
1067061203 10:43078750-43078772 CTGTGGGGGCCAGGCTCTGGGGG + Intronic
1067202515 10:44185561-44185583 CTGTGCGAGTCACCCTCAGGGGG - Intergenic
1067685671 10:48464981-48465003 CTGTGGGAGGCACCCTGTGCTGG + Intronic
1068820929 10:61376954-61376976 CTGTGGGAGCCCACCTCTGGGGG + Intergenic
1069625845 10:69867230-69867252 CTGTGGGTGGCAGACCCTGGAGG + Intronic
1070475715 10:76827227-76827249 CTGTGGATGGCACCCTTTTGGGG + Intergenic
1072628783 10:97131571-97131593 ATGTGAGTTCCACCCTCTGGAGG + Intronic
1074348530 10:112712206-112712228 TTGTAGGTGTCACACTCTGCAGG + Intronic
1076002060 10:126920061-126920083 CTGTGGGAAGCACCCACTGGGGG + Intronic
1077031995 11:472521-472543 CTGAGGGTCTCACCCTCGGCAGG - Intronic
1077062508 11:624076-624098 ATGTGGGCATCACCCTCGGGGGG + Intronic
1077590611 11:3488150-3488172 ATGTGGGTGGCGCCCCCTGGAGG - Intergenic
1081386945 11:42483011-42483033 TTGTGGGTGGCACCCTCCTGGGG + Intergenic
1083674811 11:64319315-64319337 CTGAGGGTCCCACCCTCAGGAGG - Intronic
1083776690 11:64897608-64897630 CTGTGGCTGAGTCCCTCTGGGGG - Intronic
1084246331 11:67859931-67859953 ATGTGGGTGGCGCCCCCTGGAGG - Intergenic
1084826350 11:71734569-71734591 ATGTGGGTGGCGCCCCCTGGAGG + Intergenic
1084967653 11:72752749-72752771 CTGGGGGTGTGGCCCTCTTGTGG - Intronic
1085196110 11:74672821-74672843 CTGTGGATGTGGCCCTCTGTGGG - Intergenic
1085300654 11:75456382-75456404 CTGTGGCACCCACCCTCTGGGGG - Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1085823935 11:79822776-79822798 CTGTGGGTGTTACCATATGAGGG + Intergenic
1087038196 11:93774240-93774262 CTGTGGTTTTCCCCCACTGGTGG + Intronic
1088755279 11:112880604-112880626 CTGTGGTTGTCACCCCCTCAAGG + Intergenic
1089989982 11:122850162-122850184 CTGAGGGGGTCAGCCACTGGAGG - Exonic
1090269110 11:125373567-125373589 CTGTGGGTGTCAGCCGCTGTTGG + Intronic
1090534473 11:127625656-127625678 CTGTGGGTGTGACCCTCTCCAGG - Intergenic
1090666320 11:128917068-128917090 CTCTAGGTGTCAGCCCCTGGAGG - Exonic
1090975186 11:131673900-131673922 CTGTTGGTGTCAGACTCTGATGG + Intronic
1092416899 12:8297054-8297076 ATGTGGGTGGCGCCCCCTGGAGG - Intergenic
1095478341 12:42608921-42608943 CTGTGGGTTTCAGCCTGTGATGG + Intergenic
1096430251 12:51537351-51537373 CTGTGGATTTCACCATCTGTCGG - Intergenic
1097390456 12:59005835-59005857 CTGTCTATGTCACCCTCGGGAGG + Intergenic
1097439103 12:59587605-59587627 CTCTGGGTCTCACAATCTGGGGG - Intergenic
1099277973 12:80602516-80602538 GTGAGGGTTGCACCCTCTGGAGG + Intronic
1102452489 12:113052330-113052352 CTGTGGATGTCACCCTTCTGAGG + Intergenic
1103058748 12:117842134-117842156 CTGGGAGTGGAACCCTCTGGGGG + Intronic
1104382846 12:128323037-128323059 CTGTGTGTGTCATATTCTGGTGG + Intronic
1107837253 13:44422010-44422032 GTGTGGGTGTCAGCATCTGCTGG + Intergenic
1109828425 13:67754378-67754400 CTATGGGTGTGACCCTCTTTAGG + Intergenic
1109840427 13:67911697-67911719 CTGAGGGTTTCATCATCTGGTGG + Intergenic
1119934975 14:78583824-78583846 CTGTGGGTTTTAGCCTCTGTGGG + Intronic
1121046346 14:90791058-90791080 CTTTGGATGTCTCCCTGTGGTGG - Intronic
1121560702 14:94873409-94873431 GTCTGGGTGTCACACTCTTGGGG - Intergenic
1122725937 14:103752341-103752363 CTGTGGCTGCCAGGCTCTGGAGG + Intronic
1122888442 14:104721978-104722000 CTGTGGGTTCCACTCTTTGGGGG - Intronic
1123475722 15:20591792-20591814 CTGTGGGGGGGTCCCTCTGGGGG + Intergenic
1123642289 15:22408571-22408593 CTGTGGGGGGGTCCCTCTGGGGG - Intergenic
1125904292 15:43376241-43376263 CTGTGGGTGTACACCTCTAGAGG + Intronic
1127640195 15:60909007-60909029 CCCTGGGTGTCTCTCTCTGGAGG - Intronic
1128672360 15:69583782-69583804 CTGTGGAAGTCACACTCTGTAGG + Intergenic
1129678221 15:77643706-77643728 CTGTGGGTGCTGCCCTCTGGGGG - Intronic
1132858360 16:2057677-2057699 ATGTCGGTGTCACCCTTTGCTGG + Intronic
1133355982 16:5137234-5137256 ATGTGGGTGGCACCTCCTGGAGG - Intergenic
1133436922 16:5787706-5787728 CTGGTGGTGTCACCCTCTCCTGG - Intergenic
1136500406 16:30667311-30667333 TTGTGGGAGTCACCCTGTGTGGG - Exonic
1137744813 16:50812789-50812811 ATGTGGTTTTCACCCTCTGGGGG - Intergenic
1141154497 16:81587796-81587818 CTGAGGCTCTCACCCTCAGGAGG - Intronic
1141919898 16:87128635-87128657 CTGTGTGTGTGACCCCTTGGGGG - Intronic
1146186490 17:30727738-30727760 CTGTGCATGGCACCCTCTGATGG + Intergenic
1146907308 17:36626058-36626080 CAGTGTCTGTCGCCCTCTGGTGG - Intergenic
1147769170 17:42856023-42856045 CTGTGGGTGTCACCCTCTGGGGG + Intronic
1148453075 17:47793515-47793537 CAGTGGGTGTCAGCAACTGGAGG + Intergenic
1151215860 17:72575894-72575916 CTGTGTGTGTGCCCCTTTGGAGG - Intergenic
1151564607 17:74890861-74890883 GTGTGGGTGTAACACTTTGGTGG + Intronic
1154273211 18:12937583-12937605 CTGTAGATGTCACCGTTTGGTGG + Intergenic
1155096738 18:22563293-22563315 ATGTGGTTGTCACCCTCTAGTGG + Intergenic
1157570689 18:48710176-48710198 CTGTGGGTTACACCCTGTGGTGG - Intronic
1158411028 18:57206301-57206323 CTGGGAGTGTCACCTTCTAGGGG - Intergenic
1160004466 18:75059736-75059758 CTGTGGGCGCCACCCTCTTGAGG + Intronic
1161361571 19:3852860-3852882 CTGTGGTTGTCACCACTTGGGGG + Intronic
1162420425 19:10562974-10562996 TTGTGCTTGTCACCATCTGGTGG + Intronic
1163250640 19:16124616-16124638 ATGTGGGGGCCACCCTCTGACGG - Intronic
1166214336 19:41325666-41325688 CTGCTGGAGTCTCCCTCTGGGGG + Intronic
1166432195 19:42737231-42737253 ACGTGGGTGTCAGCCTCTGAAGG + Intronic
1166484618 19:43202409-43202431 ACGTGGGTGTCAGCCTCTGAAGG + Intronic
1166491741 19:43266290-43266312 ACGTGGGTGTCAGCCTCTGAAGG + Intronic
1166540238 19:43600258-43600280 CAGTGGGTGTCACCCTCAACTGG + Exonic
1166793118 19:45409554-45409576 CTGGGGGTGTCACCTTCTGGTGG - Exonic
928172228 2:29011180-29011202 GTGTGGGTGTCAGCCTCCTGGGG + Intronic
937138559 2:119577233-119577255 ATGAGGGTGGCACCCTCTGATGG - Intronic
938076660 2:128342331-128342353 TTGTGGATGTCACCTTCTGCAGG + Intergenic
938164807 2:129017331-129017353 TCCTGGGTGTCACCCTCTGTAGG - Intergenic
938665459 2:133530830-133530852 CAGTGGCTGTCACCCTCTTGTGG - Intronic
938981087 2:136527835-136527857 ATGTGTGTGTCCCCATCTGGAGG + Intergenic
939623028 2:144444474-144444496 CTCTGTGTGTCACCAGCTGGGGG + Intronic
940826257 2:158416087-158416109 TTGTGGCTTACACCCTCTGGAGG + Intronic
942045813 2:172098959-172098981 CTCTGTGAGTCACCCTCGGGAGG - Intergenic
942637917 2:178028372-178028394 CTGAAGGTGTCAACCTGTGGGGG + Intronic
943880998 2:193143339-193143361 CTGTGGGTGTTTCTCGCTGGGGG - Intergenic
945895262 2:215474150-215474172 ATGTGGATGTCACCCTGTTGTGG - Intergenic
947929193 2:233949173-233949195 CTGTGACTCTCACCCTCTGTGGG + Intronic
1169024431 20:2357063-2357085 GTGGGGGTGTTAACCTCTGGAGG + Intergenic
1169902602 20:10568877-10568899 TTCTAGATGTCACCCTCTGGTGG + Intronic
1169914597 20:10673252-10673274 CTGGAGGGGTCACCCTCAGGAGG + Intronic
1169946532 20:10995127-10995149 CTGGGGAAGTAACCCTCTGGGGG - Intergenic
1172612769 20:36264071-36264093 CTCTGGGTGTCAGAGTCTGGTGG + Intronic
1174176070 20:48645830-48645852 AGGTGGGTGTCACCGTCAGGGGG - Exonic
1174197722 20:48785467-48785489 CTTTGGGTGGGACCCCCTGGTGG + Intronic
1175619153 20:60428780-60428802 CTGGGGCTGTAGCCCTCTGGAGG + Intergenic
1176263736 20:64197765-64197787 CTGTGATTGTCACCCTCCTGGGG + Intronic
1179278280 21:39911473-39911495 AAGTGGGTGCCTCCCTCTGGTGG + Intronic
1179478727 21:41664594-41664616 CTGGGGGTGTCACCCGCAGAGGG + Intergenic
1181407802 22:22697332-22697354 ATGTGGGAGGGACCCTCTGGAGG - Intergenic
1181920193 22:26314705-26314727 CTGCAAGTGTCACCCTCTTGGGG - Intronic
1182066147 22:27433188-27433210 CTGCAGGTGTCACCCTCTTCAGG + Intergenic
1183472611 22:38017498-38017520 CTGTGGGTGTCTCCCTCTTCAGG + Intronic
1184339306 22:43877290-43877312 CTGGGTGTGTCACCCACTGGGGG - Intergenic
1185009893 22:48307000-48307022 CTGTGCAGCTCACCCTCTGGGGG + Intergenic
1185093113 22:48786837-48786859 CTGTGGGGTCCACCCTGTGGTGG + Intronic
1185130331 22:49035278-49035300 CTATGGGACTCACCTTCTGGCGG + Intergenic
1185286467 22:50002153-50002175 CAGTGGGTTACACCCTGTGGAGG - Intronic
953347923 3:42191317-42191339 CTGTGTGTGGCGCCCTCTAGTGG + Intronic
953559236 3:43971887-43971909 CTGTGGGTGTCTCACTCTGGGGG - Intergenic
954578383 3:51689551-51689573 CTGTGGCTATCAGCCTGTGGTGG + Intronic
955778584 3:62460375-62460397 CTGGTGATGTTACCCTCTGGAGG + Intronic
955890401 3:63644504-63644526 CTGTAGGAATCAGCCTCTGGGGG - Intergenic
961059860 3:123819367-123819389 CTCTTGGTGTCAACCTGTGGGGG + Intronic
961159035 3:124706362-124706384 CCCTGGCTGTCAACCTCTGGAGG - Intronic
961292743 3:125860736-125860758 ATGTGGGTGGCGCCCCCTGGAGG + Intergenic
961572615 3:127810858-127810880 CTGTGGATGTCAGAATCTGGAGG - Intronic
961894446 3:130155656-130155678 ATGTGGGTGGCGCCCCCTGGAGG - Intergenic
961918636 3:130403341-130403363 CTGTGGGTCTCATCTGCTGGTGG + Intronic
961925688 3:130477702-130477724 CAGTGGTTCTCAACCTCTGGAGG - Intronic
968646146 4:1741556-1741578 CTGTGGGCAGAACCCTCTGGCGG - Intronic
968779686 4:2571027-2571049 CTGTGGCTCTCTCCCTATGGGGG + Intronic
969004542 4:4008734-4008756 ATGTGGGTGTTGCCCCCTGGAGG - Intergenic
969635221 4:8365179-8365201 CTGTGGGTGGCAGCCTCAGTGGG + Intergenic
978605440 4:110474692-110474714 CAATGTGTGTCACCATCTGGAGG + Intronic
979186215 4:117797398-117797420 CTGTGTAGGTCACCCTCTGAAGG + Intergenic
981052702 4:140326576-140326598 CTGTGTTTGTCTCCCTCTGTAGG + Intronic
985575518 5:671822-671844 CTGTGGGTGCCACCCTGTCCCGG - Intronic
989398050 5:40979612-40979634 CTGTGGGTGATAACATCTGGGGG + Intronic
990635174 5:57717791-57717813 TTGTGCATGTCACTCTCTGGTGG + Intergenic
991608752 5:68428966-68428988 CTGTAGGTGGCAGCTTCTGGGGG + Intergenic
992820284 5:80488944-80488966 CTGTGGGTATCAGCATTTGGGGG - Intronic
992853357 5:80834216-80834238 CTGTGGGACTCACACCCTGGAGG - Intronic
998013690 5:138715603-138715625 GTGTGGGTGTCACACACTGGAGG + Intronic
999187757 5:149725417-149725439 CTGTGGTTCTCAGACTCTGGAGG - Intergenic
1003570041 6:7249931-7249953 TTGTGGTTGGCACCCTCGGGTGG + Exonic
1004562280 6:16761686-16761708 GGGTGGGGGGCACCCTCTGGCGG + Intergenic
1006606810 6:35263351-35263373 CTTTGGGTGTCAGCTTCTGCAGG + Intronic
1006788914 6:36686143-36686165 CGCTGGGTGGTACCCTCTGGAGG + Exonic
1008701992 6:54111851-54111873 GTGTGGGTGTCAACATCTGAAGG + Intronic
1009344484 6:62596362-62596384 CTGTAGTAGACACCCTCTGGAGG - Intergenic
1011268667 6:85552808-85552830 CTGTGGGTGTAACTCTCTCCAGG - Intronic
1011391330 6:86857133-86857155 CTGTGGAAGGCTCCCTCTGGTGG + Intergenic
1011662448 6:89606153-89606175 CTGTGGGTTTCTCCCCCTGTGGG + Intronic
1018291639 6:162298058-162298080 CTGTGGGTGTCAACCTCTGAGGG - Intronic
1019706039 7:2497822-2497844 CTGAGGGAGTCACCCACAGGAGG + Intergenic
1020324679 7:6965234-6965256 ATGTGGGTGGCGCCCCCTGGAGG - Intergenic
1022188809 7:27997126-27997148 CTGTGGGTCTCCCCCACTGCAGG - Intronic
1022412140 7:30147470-30147492 CTGAGGGTGTGGGCCTCTGGGGG + Intronic
1022970072 7:35508836-35508858 CTTTGGTTGTTGCCCTCTGGAGG - Intergenic
1025638689 7:63348568-63348590 TGGTGGGTGTCACCCTCTCCTGG + Intergenic
1025644007 7:63399521-63399543 TGGTGGGTGTCACCCTCTCCTGG - Intergenic
1025713603 7:63932533-63932555 TGGTGGGTGTCACCCTCTCCTGG - Intergenic
1029114757 7:98231422-98231444 CAGTGGGGGTCACCCTCCAGAGG - Intronic
1033118261 7:138645218-138645240 CTGTTCCTGTCACCCTTTGGTGG - Intronic
1034877909 7:154741654-154741676 CTGTAGGTGTCACTTTGTGGAGG + Intronic
1036371388 8:8165707-8165729 ATGTGGGTGGCGCCCCCTGGAGG + Intergenic
1036879515 8:12499937-12499959 ATGTGGGTGGCGCCCCCTGGAGG - Intergenic
1037619574 8:20551524-20551546 CCGTGGGTTTCACTCTCAGGAGG + Intergenic
1041411367 8:57560232-57560254 ATATGGGTGTCACCCTGGGGAGG - Intergenic
1042821639 8:72936323-72936345 CTCTGGGTTTCACCCTTAGGCGG + Exonic
1048855153 8:138680645-138680667 TTGTGGATGTCACCCTCTCTAGG + Intronic
1048901233 8:139039809-139039831 CTTTGTGTGTGACCCTCTGGAGG + Intergenic
1049465404 8:142749180-142749202 CCCTGGGTGTCACCCTCCTGGGG - Intergenic
1049534151 8:143170288-143170310 CTGTGGGTGGCACTCAGTGGTGG + Intergenic
1056435149 9:86568720-86568742 CTGTGGGTCTCAACAGCTGGGGG + Intergenic
1056846007 9:90038982-90039004 CTGTGGGTGATGCTCTCTGGGGG - Intergenic
1057021240 9:91699208-91699230 CCGGGTGTGCCACCCTCTGGGGG - Intronic
1057030020 9:91768520-91768542 CCGTGTGTGTCACCCGCAGGAGG + Intronic
1057918612 9:99077057-99077079 CTGTGGCTATCAGCCTCAGGAGG - Intergenic
1060988581 9:127835554-127835576 CTGTGGGTGTCACCATGGGATGG - Intronic
1186651507 X:11566178-11566200 CTGTTGCTGTCAGCCTCTGGTGG - Intronic
1187440181 X:19311126-19311148 CTGTGGCCATGACCCTCTGGAGG + Intergenic
1189245756 X:39561995-39562017 CTTGTGGTGTCACCCTCTGAAGG - Intergenic
1193269705 X:79515053-79515075 CTATGGGTGGCACCCTCTCATGG + Intergenic
1194444093 X:93966139-93966161 CTGTGTGTGTCATCCTCTGTTGG - Intergenic
1195135780 X:101906444-101906466 CTGTGGGTACCAGCCTCTTGGGG - Intronic
1198160117 X:133999807-133999829 CAGAAGGCGTCACCCTCTGGAGG - Intergenic