ID: 1147771076

View in Genome Browser
Species Human (GRCh38)
Location 17:42868104-42868126
Sequence CTGGAGGCCCAGTTTGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147771067_1147771076 23 Left 1147771067 17:42868058-42868080 CCAGAAGGTGTTCTATCAAGGCC No data
Right 1147771076 17:42868104-42868126 CTGGAGGCCCAGTTTGAGGCCGG No data
1147771069_1147771076 2 Left 1147771069 17:42868079-42868101 CCGCTACTATGACAGCCTGGCCC 0: 1
1: 1
2: 0
3: 10
4: 117
Right 1147771076 17:42868104-42868126 CTGGAGGCCCAGTTTGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147771076 Original CRISPR CTGGAGGCCCAGTTTGAGGC CGG Intergenic
No off target data available for this crispr