ID: 1147781950

View in Genome Browser
Species Human (GRCh38)
Location 17:42949695-42949717
Sequence CTGCAGCACTTACCCCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147781947_1147781950 8 Left 1147781947 17:42949664-42949686 CCCTGAGAATACTCGCCAGTGAT No data
Right 1147781950 17:42949695-42949717 CTGCAGCACTTACCCCAAGAAGG No data
1147781948_1147781950 7 Left 1147781948 17:42949665-42949687 CCTGAGAATACTCGCCAGTGATG No data
Right 1147781950 17:42949695-42949717 CTGCAGCACTTACCCCAAGAAGG No data
1147781946_1147781950 16 Left 1147781946 17:42949656-42949678 CCTGTTTGCCCTGAGAATACTCG No data
Right 1147781950 17:42949695-42949717 CTGCAGCACTTACCCCAAGAAGG No data
1147781944_1147781950 23 Left 1147781944 17:42949649-42949671 CCCTTTTCCTGTTTGCCCTGAGA 0: 10
1: 15
2: 46
3: 108
4: 446
Right 1147781950 17:42949695-42949717 CTGCAGCACTTACCCCAAGAAGG No data
1147781945_1147781950 22 Left 1147781945 17:42949650-42949672 CCTTTTCCTGTTTGCCCTGAGAA 0: 16
1: 21
2: 56
3: 106
4: 419
Right 1147781950 17:42949695-42949717 CTGCAGCACTTACCCCAAGAAGG No data
1147781949_1147781950 -7 Left 1147781949 17:42949679-42949701 CCAGTGATGCTTGCAACTGCAGC No data
Right 1147781950 17:42949695-42949717 CTGCAGCACTTACCCCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147781950 Original CRISPR CTGCAGCACTTACCCCAAGA AGG Intergenic
No off target data available for this crispr