ID: 1147782258 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:42951993-42952015 |
| Sequence | AGCGTCACTTGGTGGTTTAG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 61 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 59} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1147782258_1147782268 | 21 | Left | 1147782258 | 17:42951993-42952015 | CCCCTAAACCACCAAGTGACGCT | 0: 1 1: 0 2: 0 3: 1 4: 59 |
||
| Right | 1147782268 | 17:42952037-42952059 | CCCTCCACACTGGCCCACGAGGG | 0: 1 1: 0 2: 0 3: 15 4: 163 |
||||
| 1147782258_1147782266 | 20 | Left | 1147782258 | 17:42951993-42952015 | CCCCTAAACCACCAAGTGACGCT | 0: 1 1: 0 2: 0 3: 1 4: 59 |
||
| Right | 1147782266 | 17:42952036-42952058 | CCCCTCCACACTGGCCCACGAGG | 0: 1 1: 0 2: 0 3: 21 4: 237 |
||||
| 1147782258_1147782264 | 11 | Left | 1147782258 | 17:42951993-42952015 | CCCCTAAACCACCAAGTGACGCT | 0: 1 1: 0 2: 0 3: 1 4: 59 |
||
| Right | 1147782264 | 17:42952027-42952049 | ATGATACAGCCCCTCCACACTGG | 0: 1 1: 0 2: 0 3: 7 4: 93 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1147782258 | Original CRISPR | AGCGTCACTTGGTGGTTTAG GGG (reversed) | Intronic | ||