ID: 1147782260

View in Genome Browser
Species Human (GRCh38)
Location 17:42951995-42952017
Sequence GGAGCGTCACTTGGTGGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147782260_1147782266 18 Left 1147782260 17:42951995-42952017 CCTAAACCACCAAGTGACGCTCC 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1147782266 17:42952036-42952058 CCCCTCCACACTGGCCCACGAGG 0: 1
1: 0
2: 0
3: 21
4: 237
1147782260_1147782268 19 Left 1147782260 17:42951995-42952017 CCTAAACCACCAAGTGACGCTCC 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG 0: 1
1: 0
2: 0
3: 15
4: 163
1147782260_1147782264 9 Left 1147782260 17:42951995-42952017 CCTAAACCACCAAGTGACGCTCC 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1147782264 17:42952027-42952049 ATGATACAGCCCCTCCACACTGG 0: 1
1: 0
2: 0
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147782260 Original CRISPR GGAGCGTCACTTGGTGGTTT AGG (reversed) Intronic