ID: 1147782261 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:42952001-42952023 |
Sequence | TCATCAGGAGCGTCACTTGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 53 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 51} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1147782261_1147782266 | 12 | Left | 1147782261 | 17:42952001-42952023 | CCACCAAGTGACGCTCCTGATGA | 0: 1 1: 0 2: 0 3: 1 4: 51 |
||
Right | 1147782266 | 17:42952036-42952058 | CCCCTCCACACTGGCCCACGAGG | 0: 1 1: 0 2: 0 3: 21 4: 237 |
||||
1147782261_1147782268 | 13 | Left | 1147782261 | 17:42952001-42952023 | CCACCAAGTGACGCTCCTGATGA | 0: 1 1: 0 2: 0 3: 1 4: 51 |
||
Right | 1147782268 | 17:42952037-42952059 | CCCTCCACACTGGCCCACGAGGG | 0: 1 1: 0 2: 0 3: 15 4: 163 |
||||
1147782261_1147782264 | 3 | Left | 1147782261 | 17:42952001-42952023 | CCACCAAGTGACGCTCCTGATGA | 0: 1 1: 0 2: 0 3: 1 4: 51 |
||
Right | 1147782264 | 17:42952027-42952049 | ATGATACAGCCCCTCCACACTGG | 0: 1 1: 0 2: 0 3: 7 4: 93 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1147782261 | Original CRISPR | TCATCAGGAGCGTCACTTGG TGG (reversed) | Intronic | ||