ID: 1147782263

View in Genome Browser
Species Human (GRCh38)
Location 17:42952016-42952038
Sequence GGGCTGTATCATCATTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147782263_1147782274 26 Left 1147782263 17:42952016-42952038 CCTGATGAATGATGATACAGCCC 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1147782274 17:42952065-42952087 AAACTTTTTGAGAGCAACTATGG 0: 1
1: 0
2: 1
3: 18
4: 247
1147782263_1147782266 -3 Left 1147782263 17:42952016-42952038 CCTGATGAATGATGATACAGCCC 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1147782266 17:42952036-42952058 CCCCTCCACACTGGCCCACGAGG 0: 1
1: 0
2: 0
3: 21
4: 237
1147782263_1147782275 27 Left 1147782263 17:42952016-42952038 CCTGATGAATGATGATACAGCCC 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1147782275 17:42952066-42952088 AACTTTTTGAGAGCAACTATGGG 0: 1
1: 0
2: 2
3: 18
4: 174
1147782263_1147782268 -2 Left 1147782263 17:42952016-42952038 CCTGATGAATGATGATACAGCCC 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG 0: 1
1: 0
2: 0
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147782263 Original CRISPR GGGCTGTATCATCATTCATC AGG (reversed) Intronic