ID: 1147782263 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:42952016-42952038 |
| Sequence | GGGCTGTATCATCATTCATC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 80 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 73} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1147782263_1147782274 | 26 | Left | 1147782263 | 17:42952016-42952038 | CCTGATGAATGATGATACAGCCC | 0: 1 1: 0 2: 0 3: 6 4: 73 |
||
| Right | 1147782274 | 17:42952065-42952087 | AAACTTTTTGAGAGCAACTATGG | 0: 1 1: 0 2: 1 3: 18 4: 247 |
||||
| 1147782263_1147782266 | -3 | Left | 1147782263 | 17:42952016-42952038 | CCTGATGAATGATGATACAGCCC | 0: 1 1: 0 2: 0 3: 6 4: 73 |
||
| Right | 1147782266 | 17:42952036-42952058 | CCCCTCCACACTGGCCCACGAGG | 0: 1 1: 0 2: 0 3: 21 4: 237 |
||||
| 1147782263_1147782275 | 27 | Left | 1147782263 | 17:42952016-42952038 | CCTGATGAATGATGATACAGCCC | 0: 1 1: 0 2: 0 3: 6 4: 73 |
||
| Right | 1147782275 | 17:42952066-42952088 | AACTTTTTGAGAGCAACTATGGG | 0: 1 1: 0 2: 2 3: 18 4: 174 |
||||
| 1147782263_1147782268 | -2 | Left | 1147782263 | 17:42952016-42952038 | CCTGATGAATGATGATACAGCCC | 0: 1 1: 0 2: 0 3: 6 4: 73 |
||
| Right | 1147782268 | 17:42952037-42952059 | CCCTCCACACTGGCCCACGAGGG | 0: 1 1: 0 2: 0 3: 15 4: 163 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1147782263 | Original CRISPR | GGGCTGTATCATCATTCATC AGG (reversed) | Intronic | ||